Why do people form governments? social studies

Answers

Answer 1

Answer:

YOUR WELCOMEEE

Explanation:

People form governments in order to maintain social order, have protection from predators, and provide collective goods.


Related Questions

list the following religion in order of their development: Islam,Christianty, Judaism​

Answers

Answer: Judaism, Christianity,  Islam

Explanation: mark me brainliest

What's a good thesis statement for a silk road essay?

Answers

The silk road was essential to people because it was a vital trading route, transported goods to other countries, and gave passage to everyone.

TRUE OR FALSE! The first calculators, in the 1900’s, led to the development of the first computers.


Please select the best answer from the choices provided

T F

Answers

Answer:

t

Explanation:

Answer:

True,The first calculators, in the 1900’s, led to the development of the first computers.






The men in the picture shown are gathering in their opposition to the ratification of what amendment?
A) 1st Amendment
B) 10th Amendment
C) 19th Amendment
D) 26th Amendment

Answers

Answer:

C) 19th Amendment

Explanation:

19th Amendment were passed by Congress Jun 4, 1919. The 19th Amendment granted women the right to vote.

19th amendment is the answer.

A pendulum bob swings back and forth in an arc. Which describe the energy conversion process as the pendulum moves from left to right?

Answers

potential to kinetic back to potential energy

Which BEST completes the chart? A) Must be at least a high school graduate. B) Must have served as a state legislator. C) Must have served as lieutenant governor prior to the election. D) Must be a Georgia resident for six years prior to the election.

Answers

Answer:

D) Must be a Georgia resident for six years prior to the election.

In describing jimmy wells as the truest, most loyal fellow, what tone is conveyed?
A: Silly
B: Admiring
C: Cheerful
D: Confused

Answers

Hey there!

The best choice seems to be B. Admiring

Hope this helps you!

God bless ❤️

xXxGolferGirlxXx

Answer:

admiring

Explanation:

Hope this helps!

;)

What are two factors that explain the origin of the income gap among U.S. citizens?



inheritances and income distribution



inheritances and differences in skills



differences in education and welfare reform



field of work and income distribution

Answers

Answer:

Inheritances and differences in skills

Explanation:

Final answer:

The income gap among U.S. citizens can be explained by differences in education and welfare reform policies, as well as differences in skills.

Explanation:

The origin of the income gap among U.S. citizens can be attributed to differences in education and welfare reform and differences in skills.

Differences in education play a significant role in shaping individuals' earning potential. Higher levels of education often lead to higher-paying jobs, while lower levels of education may result in lower-paying jobs. Additionally, changes to welfare reform policies can impact the income gap by either providing more or fewer resources and opportunities for individuals.

Learn more about Income gap here:

https://brainly.com/question/28546635

#SPJ3

Who or what rules over the government of Canada?

Answers

Answer:Canada is a constitutional monarchy

Explanation:Canada is a constitutional monarchy, which means that we recognize the Queen or King as the Head of State, while the Prime Minister is the Head of Government.

What steps could you take to lower the prices of bananas so that they are more affordable? Describe two changes you would make to trade agreements, quotas, and tariffs.

Answers

So to answer this question I would think about 3 things I would do. Imagine your a store employee or manager. You want to make more money so your store is getting more profit. If theirs tarrifs on an item you would want to raise the price of the item in your store. Think about it this way. I hope this helps

Answer:

If it is for the country whose representative is myself, I would reduce the tariff barriers and custom duties in order to safeguard the interests of working class. And even there would be made quotas and treaties in order to make everyone avail the benefits of this and liberalised imports of bananas in our country.

Explanation:

“We are resolved not to suffer defeat. We will rather die like Leonidas and his Spartans - if we can but protect Georgia and Carolina and the rest of the Americans from desolation.” -James Oglethorpe

To which group is Oglethorpe referring?

A. the British

B. the Dutch

C. the French

D. the Spanish

Answers

James Oglethorpe is referring to the British Option(A) is correct. He was a significant figure in the early history of the province, holding a lot of common and military power and organizing a prohibition on subjugation and liquor.

Who was James Oglethorpe?

James Edward Oglethorpe was an English trooper, Individual from Parliament, and donor, as well as the pioneer behind the province of Georgia in what was then English America.

Brought into the world to a noticeable English family, Oglethorpe left school in Britain and an English Armed force commission to go to France, where he went to a tactical foundation prior to battling under Sovereign Eugene of Savoy in the Austro-Turkish Conflict.

He got back to Britain in 1718, and was chosen for the Place of Hall in 1722. His initial years were somewhat unexceptional until 1729, when Oglethorpe was made seat of the Board that researched English indebted individuals' penitentiaries.

After the report was distributed, to boundless consideration, Oglethorpe and others started publicizing the possibility of another state, to act as a support between the Carolinas and Spanish Florida. Subsequent to being conceded a sanction, Oglethorpe cruised to Georgia in November 1732.

Therefore Option(A) is correct.

Learn more about James Oglethorpes here:

brainly.com/question/20522942

#SPJ2

How can Jesus be Fully God and Fully Man?

Answers

He is nether he is just a soul

Final answer:

Jesus is believed to be both fully God and fully man in Christian theology, known as the hypostatic union. He possesses both a divine nature and a human nature without confusion. This belief is fundamental to Christianity.

Explanation:

According to Christian theology, Jesus is believed to be both fully God and fully man. This concept is known as the hypostatic union. It means that Jesus possesses both a divine nature and a human nature, without the two natures being mixed or confused. He is fully God in his divinity and fully man in his humanity.

Jesus' divine nature is evidenced by his ability to perform miracles, claim to be the son of God, and fulfill prophecies. His human nature is demonstrated through his experiences of emotions, physical limitations, and need for growth.

This belief in the dual nature of Jesus is a fundamental doctrine of Christianity and is based on the interpretation of biblical texts and theological debates throughout history.

7. The word assimilate refers to -
A. learning a new language
B. adopting the culture of those around you
C. enlisting in the mlitary
D. buying stock in a company in hopes of earning a profit

Answers

Answer: B. adopting the culture of those around you

Explanation: When you assimilate into society, you change into the cultures of others in order to fit in.


President Franklin D. Roosevelt was born in 1882 in New York. Which number on the map represents the state of New York?

A) 1
B) 2
C) 3
D) 4

Answers

Answer:

C) 3

Explanation:

Brainliest pls

Answer:

The answer is C. Hope this helps

Explanation:

What does Montesquieu say is a major cause of crime

Answers

I’m not 100% sure but I think that he says a major cause of crime is abuse of power
Abuse of power?? Maybe

What was South Africa’s policy of racial segregation called? *

apartheid
genocide
imperialism
nationalism

Answers

Answer: Apartheid

Explanation:

The development of the Hydrogen bomb in 1954 was MOST LIKELY a product of

A) the Japanese bombing at Pearl Harbor.
B) the explosion of a Soviet atomic weapon.
C) the signing of the Warsaw Pact in Poland.
D) the building of the Berlin Wall in Germany.

Answers

Answer:

answer a

Explanation:

i looked it up

B)the explosion of a soviet atomic weapon

Gies recalls how her husband viewed the Frank
family's capture. What important information is Henk
missing because of his viewpoint?
He isn't sure if the person he saw was Koophuis or
Kraler.
He doesn't know that there's a problem.
He doesn't know if Anne is captured.
He doesn't know if Miep is captured too.

Answers

Answer:

d

Explanation:

because

Henk is missing out on the information that he doesn't know if Miep is captured too. Thus, option 'D' is the correct option.

What important information is Henk missing because of his viewpoint?

This passage is taken from Anne Frank Remembered. This was Miep Gies' autobiography. She was recognized as the person who gave the Frank family financial support when they were living in hiding for two years. His assessment lacked a crucial element—namely if Miep was also taken.

A point of view is another name for a viewpoint. It simply refers to a person's personality, attitude, or way of thinking about anything in particular. Your point of view, or unique perspective, is how you specifically experience the world. It really is from your point of view! Try to see things from their perspective to put an end to an argument so you can kiss and make up.

Learn more about viewpoint, here:

https://brainly.com/question/29365812

#SPJ6

Corporations must hold meetings for stockholders and keep accurate records of business transactions. How are these regulations beneficial for the corporation’s stockholders?

Answers

Answer:

The answer is below

Explanation:

A stockholder often referred to as shareholder, is a legal term that describes an individual, company, or institution that own minimum of one share of a company’s stock, otherwise known as equity. Thus, since stockholders are integrated owners in a company, they reap the benefits of a business’ success. Such rewards come are in varying forms of increased stock valuations, it could be financial profits distributed as dividends. At the same time, during company loss, the share price drops accordingly, which makes shareholders to lose money, or some level of reductions in portfolios’ values.

Keeping accurate records of business transaction of a corporation, can be beneficial to stockholders in the following ways:

1. It gives the stockholders to inspect and assess the company's book and records.

2. It enhances their knowledge on the level of entitlement from the corporation they can demand for.

3. It helps them to know when to claim a proportionate allocation of proceeds if and when their company liquidates its assets.

4. It gives the stockholders the opportunity to assess the company's financial records, and to know which proposals to vote for to benefits the company.

The correct answer to this open question is the following.

Corporations must hold meetings for stockholders and keep accurate records of business transactions. These regulations are beneficial for the corporation’s stockholders in that the regulations give certainty that their investments in the corporation are being administered in the correct form by the directives of the company. These meetings with stakeholders allow investors to have specif look at the way the corporation is doing, they can have access to financial information, accounting records, in order to fully comprehend the way the company is being led.

Help me please!!!

Why do you think Democratic platform is labeled "Kansas," "Cuba," and "Central
America"?

Answers

Answer:

The platform on which his head rests is marked "Kansas," "Cuba," and "Central America," probably in reference to the Democrats' plans for slavery extension. In the background to the left a building is burning while a family flees, and to the right a man is hanging.

UNICEF is a committee that focuses on children's issues internationally and is under what organization? A) Red Cross B) United Nations C) European Union D) Organization of American States

Answers

Answer:

United Nations

Explanation:

The UNICEF stands for the United Nations Children's Fund. It was formed in 1946 to provide immediate relief for children who were affected by the Second World War.

UNICEF is a department under the United Nations that focuses on children's issues around the world. Hence, (B) is the best choice.

What is the role of UNICEF?

With a presence in 192 nations and territories, the organization is one of the most well-known and well-known social welfare organizations in the world.

The work of UNICEF includes giving vaccines and disease prevention, treating women and children who have HIV, promoting education, strengthening maternal and child nutrition, improving sanitation, and responding to natural catastrophes with humanitarian aid.

The United Nations International Children's Emergency Fund, established on December 11, 1946, in New York by the U.N. Relief Rehabilitation Administration to offer emergency aid to children and mothers affected by World War II, was replaced by UNICEF.

To further institutionalize post-war humanitarian efforts, UNICEF was created by the U.N. General Assembly in the same year. In 1950, the organization's role was expanded to include addressing the long-term needs of women and children, notably in

Learn more about UNICEF, from :

brainly.com/question/1057610

#SPJ6

Why were European nations interested in colonizing Africa?



Choose all answers that are correct.


The triangular trade had become more profitable.


They wanted to stop the spread of Islam.


The completion of the Suez Canal created a new trade route.


Diamonds had been discovered.

Answers

Answer:

Explanation:

*Diamonds had been discovered.

* The triangular trade had become more profitable.

and maybe *

They wanted to stop the spread of Islam.

hope i helped!

When the migrant workers strike, what are the effects on the farm owners?

Answers

Answer:

the farm owners have no one to work the land, which means no crops are being produced. if no crops are being produced, no money is being made. the longer the strike lasts, the worse the effects.

Which is a characteristic shared by nearly all nations of Oceania?
O
A. Chinese speaking
O
B. Sparse populations
C. Mostly Christian populations
O
O
D. Controlled by the United States
SOMIT

Answers

Answer:

C Mostly Christian Populations

A common characteristic shared by almost all nations in Oceania is that they have predominantly Christian populations, a result of historical missionary work and British influence. The correct option is: C. Mostly Christian populations

A characteristic shared by nearly all nations of Oceania is that they have mostly Christian populations. The arrival of Christian missionaries in the early 19th century led to the widespread adoption of Christianity across the region. In places such as Australia and New Zealand, which are part of the broader Pacific Realm, the historical British influence also contributed to the predominant Christian demographic.

Moreover, Christianity became prevalent in Polynesia following missionary efforts, demonstrating its broad influence across different parts of Oceania.

Can someone please answer this questions!!

Answers

Answer:

1.) I think the cartoonist supported slavery. My reason is because the African American is being shoved down the Free Soiler's throat, and the Free Soil party was against slavery expansion.  

2.) The Democratic Party supported popular sovereignty.

3.) I don't know this one. Maybe Cuba, Central America, and Kansas are on the fence about slavery. Since the platform that says Cuba, Central America, and Kansas are on the Democratic platform, they must believe in popular sovereignty. But, the Democratic platform is holding the Free-Soiler's hair, which must mean that they do not support the Free Soil Party, who was against slavery.

Explanation:

In the early 1800s, American Indians were allowed to live in the Great Plains
because​

Answers

Answer:

they had no madic land

Explanation:

Using complete sentences, define government and discuss its four responsibilities. Identify the three systems of government and give one example of a form of government that is currently being used in the world today

Answers

Explanation:

Goverment is the governing body of a nation, state and community. The three systems of goverment are Unitary, Confederation, and Federal. The most prevalent goverment being used today is the unitary system. The unitary system in today's world power is being held at a national level.

Answer: this is correct

Goverment is the governing body of a nation, state and community. The three systems of goverment are Unitary, Confederation, and Federal. The most prevalent goverment being used today is the unitary system. The unitary system in today's world power is being held at a national level.

Explanation: e2020!

How can teachers enhance the effective teaching of life
skills?

Answers

Answer:

They can give more life assignments

Explanation:

they can give more life thing like the other girl said

Which statement is true of a direct democracy? The people vote directly to decide issues. The people decide to have no formal government. The people have to obey the rules of a king or queen. The people elect representatives to run the government.

Answers

Answer:

It would be A. The people vote directly to decide issues.

Explanation:

pls give brainly :D

A  statement that is true of direct democracy is The people vote directly to decide issues. Thus the correct option is A.

What is Democracy?

Democracy influences the government as citizens of the country choose their representatives with the help of voting in elections who will help them in providing better facilities and development by improving the standard of living.

In a form of democracy, the electorate makes decisions about major policy matters directly, without the assistance of elected representatives is known as direct democracy. Citizen participation in democratic decision-making is possible through it.

The fundamental supremacy and power of the individuals conferred by direct democracy above representative government, which is supported by the people in indirect democracy, is natural.

Therefore, option A is appropriate.

Learn more about democracy, here:

https://brainly.com/question/13158670

#SPJ6

How do aggregate demand and aggregate supply differ from regular demand and supply?

Answers

Answer:

In economics, the law of supply and demand is a common term and one of the fundamentals of economic theory. ... Aggregate supply is an economy's gross domestic product (GDP), the total amount a nation produces and sells. Aggregate demand is the total amount spent on domestic goods and services in an economy.

Aggregate demand and aggregate supply represent total economic demand and supply, while regular demand and supply refer to specific goods or services. Aggregate demand includes consumption, investment, government spending, and net exports, whereas aggregate supply is the total production firms are willing to sell. Economic events and policy decisions can cause shifts in both aggregates differently than regular demand and supply.

Difference Between Aggregate Demand and Aggregate Supply and Regular Demand and Supply

The concepts of aggregate demand and aggregate supply are broader than regular demand and supply because they represent the total demand and total supply in an economy, instead of the demand and supply for a specific good or service. Aggregate demand is the total amount of goods and services demanded at all price levels, encompassing the sum of all consumption, investment, government spending, and net exports. In contrast, regular demand refers to the desire for a specific product or service. Similarly, aggregate supply represents the total production that firms are willing and able to sell at a given price level, while regular supply is concerned with how much of a specific product or service a market can offer.

The elements contributing to shifts in aggregate demand and aggregate supply encompass a wide range of economic events and policy decisions. Examples include changes in taxation, government spending, consumer and business confidence, variations in key input pricing such as oil, and technological advancements driving productivity. In contrast, shifts in the regular supply and demand are affected by product-specific factors such as changes in taste and preferences, income, and prices of related goods.

Other Questions
Miranda and her uncle see an interesting new car drive by. Later, after the car has gone, her uncle asks if she remembers the neat thing they saw minutes before. Miranda says, "Yes, we saw a car." Miranda is demonstrating A rumor starts that says a bank has suffered significant losses and may not be able to honor its promises to depositors. This causes most of the depositors to line up in front of the bank the next morning wanting to withdraw their deposits. This is an example of:A. Liquidity riskB. Operational riskC. Interest rate riskD. Credit risk PLS PLS HELP 30 PTS AND BRAINLIEST IF CORRECTBanksy Art Self-Destructs After Selling for $1.4MBy Rowena SalazarAnonymous artist Banksy stunned the art world on October 6, 2018 with a prank that caused one of his paintings to self-destruct. Moments after "Girl With Balloon" sold for $1.4M via phone auction at Sotheby's auction house, an alarm sounded. Then, a remote-controlled mechanism slid the canvas down its frame where a shredder was hidden. Several videos and photos show the painting hanging halfway shredded outside of its frame."Girl With Balloon" was a spray paint on canvas work completed in 2006 and shows a small child reaching up toward a heart-shaped red balloon. The original work was stenciled on a wall in east London and is one of Bansky's most recognizable images.Banksy, an England-based graffiti artist, is also considered a political activist and vandal. He has remained anonymous since gaining fame for his stenciled graffiti art, usually spray-painting his murals in the middle of the night. Banksy often incorporates dark humor, political messaging, and social commentary into his art. He openly criticizes commercialism, once even selling works of his art at a New York Central Park pop-up shop for $60 a piece, far below their value. In 2007, he graffitied "ONE NATION UNDER CCTV" on the side of a British postal service building."Graffiti art has a hard enough life as it is, before you add hedge-fund managers wanting to chop it out and hang it over the fireplace," the New York Times quoted Banksy in 2013. "For the sake of keeping all street art where it belongs, I'd encourage people not to buy anything by anybody, unless it was created for sale in the first place." (Ryzick, M. "Another Banksy Mural to Go from Wall to Auction." The New York Times, 12 August 2013).Soon after shredding his own painting, which sold for a record-high price, Banksy posted a photo on his Instagram account of the half-shredded painting with a caption reading "Going, going, gone " He also posted a video describing how "a few years ago I secretly built a shredder into a painting in case it was ever put up for auction " He captioned the video with a quote from Pablo Picasso"The urge to destroy is also a creative urge."From the Financial District Times"'Girl With Balloon' already broke an important auctions record for Bansky, selling for $1.4M. After its recent shredding, we certainly expect this important work to raise the bar even further. While casual art observers consider the work to be destroyed, collectors are drawn to its one-of-a-kind circumstance. We wouldn't be surprised if it's already doubled in value."In a paragraph of at least five sentences, address Banksy's advice "not to buy anything by anybody, unless it was created for sale in the first place." Include at least one specific reference to each excerpt in your response. QUESTION 2 Objectives: I . identify potential and kinetic energy in a situation and draw corresponding energy bar charts, II . calculate gravitational and elastic potential energy, III . draw & analyze potential energy functions, and (d) use conservation of energy to relate the total energy at one time to total energy at another time. ------------------------------------------- Bungee Jump: you will step off with zero initial vertical velocity from a platform a height h above the ground. The bungee cord will act like a giant extensional spring that will, you hope, provide an upward force on becoming taut. After weighing you (you have a mass M), the operator has selected a bungee cordwith an un-stretched length of d and a spring constant of k. Consider yourself to be a single point i.e., use the particle model. Choosing the ground as your origin (and the z-axis directed upwards), answer the following questions about your bungee jumping adventure in terms of M, h, d, k, z, and the gravitational field strength, g. Answer with variables. ------------------------------------------- a) Write an expression for the stretching ?L of the cord in terms of d and z and for the total potential energy U of the jumper-bungee-Earth system for each situation (consider the latter two situations together). b) Which type of potential energy ( UG or US ) is largest for large z (early in the fall)? For small z (late in the fall)? c) Sketch a graph of your gravitational potential energy, UG(z) vs your height, z, from z = 0 to z = h, on the left plot. Then sketch a graph of your elastic potential energy, US(z) on the center plot. Finally on the rightmost plot, sketch a graph of your total potential energy1 U(z) = UG(z) + US(z). Do these plots on your own without the help of a computer or calculator. 1.) 2x9y=14 2.) x=6y+7 please help!! 40% of OatyPop cereal boxes contain a prize. Hannahplans to keep buying cereal until she gets a prize. What isthe probability that Hannah only has to buy 3 or lessboxes before getting a prize?We need to design a simulation. Which random device can we use to BESTrepresent this situation?Use a double-sided coin andassign heads as the prize andtails as no prize.Use a number cube with thenumbers 1 through 6 and assign1 through 2 as the prize and 3through 6 as no prize.Use a random number generatorranging from 1 to 10 and assign1 through 4 as the prize and 5through 10 as no prize.Use a deck of cards and assignspades as the prize and allother suits as no prize. There are three groups that contain carbon but are not organic compounds:carbon chlorides carbon oxides carbon iodides carbides carbonates When should you use the median and interquartile range as your measure of center and measure of variability tocompare populations shown on a box plot? Check all that applywhen there are outliers in the data setswhen there are no big gaps in the middle of the data setswhen the plots representing the data are symmetricalwhen the plots representing the data are nonsymmetricalwhen there are no outliers in the data setIntroDone To assist with a class demonstration, a student (whose mass is 60 kg) filled a water balloon with 2 kg of water. He then climbed to the second floor (10 metres) of the school and held the balloon out of a window. How much work did the student do? What is it called when plants give off water vapor as a waste product? Jason is entering a weight lifting contest. Gurrently, his maximum bench press weight is 105 pounds. If he increases the weight by 7 pounds each week, What is the maximum weight he be able to bench press after 13 weeks? Which statement best summarizes the central idea of thisexcerpt?DOUO One must know the process of hiring servants.0 It is important to always honor one's servants.O It is necessary to choose trustworthy servants.O The intelligence of servants must be considered.herofich 1. Solve by setting the linear factors equal to zero.(x+4)(x-3) = 0a) x = 4 and x = -3b) x = 2 and x = 1c) x = -4 and x = 3d) x = -2 and x = 1 Explain how settlers influence the final border between the united states and britain in the pacific northwest Select the correct value for the indicated bond angle in each of the compounds. 90, 180, 109.5, 120, Kara used information from three books for a report she wrote. She is creating a list of her sources. Which information is LEAST important for the list?A)Author B) Title of bookC) City of publicationD) Number of pages in a book The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template from left to right. Which end of the DNA template is 5 and which end is 3? Give the sequence and identify the 5 and 3 ends of the RNA copied from this template. An experiment consists of selecting a letter at random from the letters in the word IRRESISTIBLE and observing the outcomes. What is the appropriate sample space for this experiment Choose the best word to complete the sentence below. After their house was _______, the Smiths went out and bought all new furniture. a. demolished b. renovated c. accumulated d. none of the above Please select the best answer from the choices provided A B C D When children are near a pool, pond, or stream, the supervising adultA. should wear a whistle.B. should wear a life jacket.C. must be within an arm's length.D. needs to check on the children every five minutes.