a line inintersects at triangle at least once, but not at any of its vertices. What is the maximum number of sides that a line can intersect a triangle? similarly, a square? a convex quadrilateral? A quadrilateral , in general?

Answers

Answer 1
I think it's the quadrilateral in general

Related Questions

What is $1200 at 5.6% for 4 years

Answers


[tex]i = prt[/tex]
[tex]i = unknown[/tex]
[tex]p = 1200[/tex]
[tex]r = 5.6\% \: or \: 0.056[/tex]
[tex]t = 4[/tex]
[tex]i = 1200(0.056)4[/tex]
[tex]i = (67.2)4[/tex]
[tex]i = 268.8[/tex]
$268.80

268.80 is your answer

A sign says that the price marked on all music equipment is at a discount for 30% off. You buy an electric guitar for the same price of $315.
{Im only in 7th grade.}
What is the percent you pay? _____________
Write an equation to find the regular price of the item. __________________
What was the regular price? ____________

Answers

Hi there!

a. So the electric guitar is sold for a sale price of $315 after the discount. The discount was 30%. Even though we get that amount off, we still pay 70% of the original price, because 100% (original price) - 30% is 70%.

b. An equation that can help us find the regular price of the item is through writing and solving a proportion. Set it up like this:

315/x = 70/100

This is because 315 is part of the whole and is 70% of the value of x.

How to solve it:

Okay. Let's solve this by cross multiplying the values. 315 * 100 is 31,500. 70 * x is 70x. That simplifies to 31,500 = 70x. Didivde each side by 70 to isolate the x. 70x/70 cancels out. 31,500/70 is 450. Let's check this by multiply the number by 70% and see what happens. 450 * 70% (0.7) is 315. There. x = 450. The regular price was $450.
Final answer:

The percent paid after a 30% discount is 70% of the regular price. The equation to find the regular price is 0.70 * P = $315. Solving this gives us the regular price of the electric guitar, which is $450.

Explanation:

If a sign says that the price marked on all music equipment is at a discount for 30% off, and you buy an electric guitar for $315, we need to figure out the percent you actually pay and the regular price of the guitar.

Since the discount is 30%, you pay 100% - 30% = 70% of the regular price.

Let's call the regular price 'P'. The equation to find the regular price of the item after a 30% discount is:

0.70 * P = $315

To find the regular price 'P', we divide both sides of the equation by 0.70:

P = $315 / 0.70

P = $450

The regular price of the electric guitar before the discount was $450.

24 is what percent of 40?
Show work please! Thanks

Answers

60% 

40 ÷ 10 = 4
24 ÷ 4 = 6
6 = 6/10 = 3/5 = 0.6 = 60%
60%
[tex] \frac{24}{40} \times \frac{100}{100} = \frac{60}{100} [/tex]
steps
1) find what 24 of 40 is
which is 24/40
2)multipy with denominator and numerator by 100 resulting in 60%

Divide and round to the nearest tenth 3.5 divided by 2.29

Answers

The answer will be 1.53 after dividing and rounding to the nearest tenth 3.5 divided by 2.29.

What is an arithmetic operation?

It is defined as the operation in which we do the addition of numbers, subtraction, multiplication, and division. It has a basic four operators that is +, -, ×, and ÷.

We have:

= 3.5/2.29

After dividing we will get:

= 1.528

Rounding to the nearest tenth:

= 1.53

Thus, the answer will be 1.53 after dividing and rounding to the nearest tenth 3.5 divided by 2.29.

Learn more about the arithmetic operation here:

brainly.com/question/20595275

#SPJ2

What are like terms? How do you combine them? Can you give an example?

Answers

like terms are when numbers with and without variables can be combined. ex: 4x+6-8x+=32
you would first combine 4x and -8x because they are the same.
Like terms are terms that have the same root and coefficient. For example, 2x and 3x both have the same variable, so you can combine them (add them). 

2x + 3x = 5x

You combine the coefficients by adding them. 2 + 3 = 5. 

Hope this helps!


1440 tons of grain were brought to a silo over two days. On the second day, 80% of the amount of the grain delivered during the first day was brought in. How many tons of grain were delivered to the silo on the first day?

Answers

Final answer:

To find out how many tons of grain were delivered on the first day, a simple algebraic equation was set up and solved to show that 800 tons were delivered on the first day.

Explanation:

Given that 1440 tons of grain were delivered to a silo over two days, we need to determine the amount delivered on the first day. It was stated that the second day's delivery was 80% of the first day's. Let's represent the first day's delivery as x tons. Therefore, the second day's delivery would be 0.80x tons. The sum of the two-day deliveries equals 1440 tons. This gives us the equation:

x + 0.80x = 1440

To solve this equation, we combine like terms:

1.80x = 1440

Dividing both sides by 1.80 gives us:

x = 1440 / 1.80

x = 800

Thus, 800 tons of grain were delivered on the first day.

The number of taxi accidents is approximated by y equals negative 143.3 x squared plus 1823.3 x plus 6820 and the number of injuries is approximated by y equals negative 416.72 x squared plus 4416.7 x plus 8500. Let xequals0 represents​ 1990, xequals1 represents​ 1991, and so on.

Answers

Answer:
number of taxi accidents = 12235.2 which is approximately approximately 12235 accidents

Explanation:
The equation for the number of accidents is given as:
y = -143.3 x² +1823.3 x + 6820

We are given that:
x = 0 represents 1990
x = 1 represents 1991
Therefore:
x = 8 represents 1998

Now, all we have to do is substitute with the value of x = 8 in the equation of accidents to get the number of taxi accidents in 1998 as follows:
y = -143.3 (8)² +1823.3 (8) + 6820
y = -143.3 (64) + 1823.3 (8) + 6820
y = -9171.2 + 14586.4 + 6820
y = 12235.2

If we are asked to approximate the answer, then it would be approximately 12235 accidents

Hope this helps :)

a soccer field has a length of 100 yards and a width of 60 yards .which equation can you use to find the area of the soccer field

Answers

60 × 100

Since the formula for area of a rectangle is length × width, multiplying the sides will get you the area.

Hope this helps!

Final answer:

To find the area of a soccer field with a length of 100 yards and a width of 60 yards, the equation used is Area = 100 yards × 60 yards, resulting in an area of 6000 square yards.

Explanation:

To calculate the area of a soccer field with a length of 100 yards and a width of 60 yards, we can use the formula for the area of a rectangle, which is Area = length × width. In this case, we would calculate the area as follows:

Step 1: Identify the Formula

Area = length × width

Step 2: Plug in the Measurements

Area = 100 yards × 60 yards

Step 3: Calculate the Area

Area = 6000 square yards

Therefore, the equation to find the area of the soccer field is Area = 100 yards × 60 yards, giving us an area of 6000 square yards.

Please help on #8, Due really soon!!

Answers

Answer: 72 square centimeters

-------------------------------------------------------------

Area of triangle ECD = (base)*(height)/2
Area of triangle ECD = 6*12/2
Area of triangle ECD = 72/2
Area of triangle ECD = 36 square cm

Subtract this area from the trapezoid area. This will get us the area of the parallelogram

Area of Parallelogram ABCE = (area of trapezoid ABDE) - (area of triangle ECD)
Area of Parallelogram ABCE = (180) - (36)
Area of Parallelogram ABCE = 144 square cm

The last step is to divide the area of the parallelogram in half. This is because the parallelogram is made of two congruent triangles (triangle ABE and triangle EBC). The two triangles ABE and EBC have equal areas

Area of triangle EBC = (1/2)*(area of parallelogram ABCE)
Area of triangle EBC = (1/2)*(144)
Area of triangle EBC = 72 square centimeters

Choose the correct simplification of (4x3 − 3x − 7) + (3x3 + 5x + 3). (5 points) 7x3 − 2x − 4 x3 − 8x − 10 7x3 + 2x − 4 x3 + 8x + 10

Answers

(4x3-3x-7)+(3x3+5x+3)= 7x3+2x-4

help plz i want help

Answers

Answer A is correct
Yw and have a nice day

What is the volume of a cylinder with a radius of 4 inches and a height of 7 inches

Answers

Cylinder
Formula = 3.14 x radius square x 7

3.14x 4x4 x7= 351.68 inches square

Answer is provided in the image attached.

Thomas has to type 1200 words. He has already typed 300 words. he can type 60 words per minute. Determine the number of minutes it will take him to finish typing.

Answers

15 minutes; First, you do 1,200-300, since he has already typed 300. (1200-300=900) Then you divide 900 by the number of words he has typed (60), and you get 15.

Izracunaj opseg i povrsinu kruga upisanog u kvadrat stranice duljine 8 cm.

Answers

(In English), your question would state the following:


Calculate the circumference and circumference of the circle entered in a square 8 cm long.

So when finding the answer this this question, we know that the circumference would be the complete area of a circle.

So, I believe we would want to find what is the radius and the diameter that would make this circumference 8[tex]^c^m[/tex].

The radius would then be (1.274).
__________________________________________________________

Now in your own language (Croatian).

Dakle, kad pronađemo odgovor na ovo pitanje, znamo da bi opseg bio cjelokupno područje kruga. Dakle, vjerujem da bismo željeli otkriti što je radijus i promjer koji bi ovaj opseg mogao učiniti 8cm. Radijus bi onda bio (1.274).




The question in English is

Calculate the circumference of the circle entered in a square 8 cm long

we know that

The circumference of a circle is equal to

[tex]C=\pi D[/tex]

where

D is the diameter of the circle

In this problem we have that

the diameter of the circle is equal to the length of the square

so

[tex]D=8\ cm[/tex]

Find the circumference

[tex]C=8\pi\ cm=25.13\ cm [/tex]

therefore

the answer is

The circumference of a circle is equal to [tex]8\pi\ cm\ or\ 25.13\ cm[/tex]

factor 2cos^2x-5cosx+2=0

Answers

[tex]TRIGONOMETRIC \: \: \: RESOLUTIONS \\ \\ \\

2 \: { \cos}^{2} \alpha \: - \: 5 \: \cos\alpha \: + \: 2 \: = \: 0 \\ \\ Let \: \: \cos \alpha \: = \: x \\ \\ Hence \: \: , \: \\ the \: given \: expression \: becomes \\ \: a \: Quadratic \: Equation\: - \\ \: \\ 2 {x}^{2 } \: - \: 5x + \: 2 \: = \: 0 \\ \\ 2 {x}^{2} \: - \: 4x \: - \: x \: + \: 2 \: = \: 0 \\ \\ 2x \: (x - 2) \: - \: 1 \: (x - 2) \: = \: 0 \\ \\ (2x - 1) \: (x - 2) \: = \: 0 \\ \\ Solving \: for \: \: x \: \: , \: \: \\ \: We \: get \: \: - \: \\ \\ \: \: x \: = \: \frac{1}{2} \: \: \: \: \: \: and \: \: \: \: \: \: \: \: x \: = \: 2 \\ \\ As \: value \: of \: \cos\alpha \: ranges \: from \: \\ \: \: - 1 \: \: \: to \: \: \: 1 \: \\ \\ Neglect \: \: x \: = \: 2 \\ \\ Hence \: , \: x \: = \: \frac{1}{2} \\ \\ \: \: \: \: \: \: \: \: \: \: \cos\alpha \: = \: \frac{1}{2} \\ \\ \\ \: \: \: || \: \: \: \alpha \: = \: \: 2n \pi \: + \: \frac{\pi}{3} \: \: \: \: or \: \: \: \: 2n \pi \: - \: \frac{\pi}{3} \: \: \: || \\ \:
\: \: \: \: \: \: \: \: \: Ans.\: \: \: \\ \\ \: \:( \: Where \: n \: represents \: any \: Integer\: ) \: \: \: \: \: [/tex]

one number is 9 times a first number. A third number is 100 more than the first number. Of the sum of the three numbers is 1167, find the numbers

Answers

Let x represent the first number.
The second number is 9x.
The third number is x +100.

The sum of all three numbers is
.. x +9x +(x +100) = 1167
.. 11x +100 = 1167
.. 11x = 1067
.. x = 97

The numbers are 97, 873, 197.

The function f(x) varies inversely with x and f(x) = 0.9 when x = 0.5 what is f(x) when x = 1.5 ? a. 0.02 b. 0.03 c. 0.3 d.0.75 PLEASE HELP ME I WILL MARK BRAINLIEST!!!!!!!!!!!!!

Answers

0.3 C) this is the answer i calculated it ok your welcome

Answer:

The answer is 0.3

Step-by-step explanation:

Simplify the expression 9 + 4n - 1 - 3n

Answers

To simplify this expression, we need to combine like terms.

9 - 1 + 4n - 3n
= 8 + n

Hope this helps!
Combine like terms to simplify.

=9 + 4n - 1 - 3n
= (4n-3n) + (9-1)
= n + 8

ANSWER: simplified expression=n + 8

Hope this helps! :)

Triangle ABC has angle measures as shown. (a) What is the value of x? Show your work. (b) What is the measure of angle C? Show your work.

Answers

all angles = 180 degrees
3(x-2)+35+52=180
distribute
3x-6+35+52=180
combine like terms 
3x+81=180
subtract 81 on both sides
3x=99
divide both sides by 3
x=33
plug in for x
3((33)+2)=
or 180-35-52=93

The value of x is 29.

The measure of angle C is 93.

What is a triangle?

A triangle is a 2-D figure with three sides and three angles.

The sum of the angles is 180 degrees.

We can have an obtuse triangle, an acute triangle, or a right triangle.

We have,

The sum of the angles = 180

So,

From the triangle,

3(x + 2) + 35 + 52 = 180

3x + 6 + 35 + 52 = 180

3x  + 93 = 180

3x = 180 - 93

3x = 87

x = 29

Now,

∠C = 3 (x + 2)

= 3 (29 + 2)

= 3 x 31

= 93

Thus,

The value of x is 29.

The measure of angle C is 93.

Learn more about triangles here:

https://brainly.com/question/25950519

#SPJ2

What are the coordinates of the vertex of the graph? Is it a maximum or minimum

Answers

first one........................................

Based on the graph, the coordinates of the vertex are at (0, -1), and since the parabola opens upwards, the vertex is a minimum.

Therefore, the correct answer is A:

(0,-1) ; minimum

The image shows a parabola opening upwards on a coordinate plane. The vertex of a parabola is the highest or lowest point on the graph, depending on whether the parabola opens downward or upward, respectively.

Here's a detailed explanation for identifying the vertex and determining if it is a maximum or minimum:

Step 1: Identify the Vertex

The vertex of a parabola in the form [tex]\(y = ax^2 + bx + c\)[/tex] can be found using the vertex formula [tex]\(x = -\frac{b}{2a}\)[/tex] for the x-coordinate and then substituting that back into the equation for y to find the y-coordinate. However, in this case, we can directly observe the vertex from the graph. It's the point where the parabola changes direction.

Step 2: Read the Coordinates from the Graph

From the graph, we can see that the vertex is at the origin of the parabola's turning point. It appears to be at (0, -1) by looking at where the axis of symmetry of the parabola intersects the y-axis.

Step 3: Determine Maximum or Minimum

Since the parabola opens upwards, as indicated by the shape of the graph, the vertex represents the minimum point of the parabola. If the parabola were to open downwards, the vertex would represent the maximum point.

I'll give brainliest to whoever shows their work. Plz answer fast.
Jana is ordering a list of numbers from least to greatest.
Which statement can be used to create her list?
A) The square root of 0.8 is less than 4/5 because 0.8= 4/5 and the square root of a number less than 1 is less than the number itself.
B) The square root of 7 is greater than the square root of 7^2 because the square root of 7^2=7 and the square root of a number greater than 1 is greater than the number itself.
C) (The square root of 5)^2 is less than the square root of 7 because (The square root of 5)^2= 5 and the square root of 7 is between 6 and 8.
D) the square root of 7 is greater than 4/5 because 4/5 is less than 1 and the square root of a number greater than 1 is greater than 1.

Answers

Lets check the validity of each one of our statements:

Statement A is false.
The square root of a number less than 1 is greater than the number itself. In fact, [tex] \sqrt{ \frac{4}{5} } = \sqrt{0.8} =0.89[/tex]. Since [tex]0.89[/tex] is greater than [tex]0.8[/tex], [tex] \sqrt{0.8} [/tex] is greater than [tex] \frac{4}{5} [/tex]; therefore, statement A is false.

Statement B is false. The square root of a number greater than 1 is less than the number itself. in fact, [tex] \sqrt{7} =2.64[/tex], whereas [tex] \sqrt{7^2} =7[/tex]. Since 2.64 is less than 7, [tex] \sqrt{7} [/tex] is less than [tex] \sqrt{7^2} [/tex]; therefore statement B is false.

Statement C is false. [tex] \sqrt{7} [/tex] is actually less than 7 divided by two, so there is no way that [tex] \sqrt{7} [/tex] is between 6 and 8. In fact [tex] \sqrt{7} =2.64[/tex]. Since 5 is greater than 2.64, [tex]( \sqrt{5} )^2[/tex] is greater than [tex] \sqrt{7} [/tex]; therefore, statement C is false.

Statement D is true. [tex] \sqrt{7} =2.64[/tex]. Since 2.64 is greater than 0.8, [tex] \sqrt{7} [/tex] is greater than [tex] \frac{4}{5} [/tex].

We can conclude that Jana should use statement D to create her list; also the correct order from least to greatest is: [tex] \frac{4}{5} [/tex], [tex] \sqrt{0.8} [/tex],[tex] \sqrt{7} [/tex], [tex]( \sqrt{5} )^2[/tex], [tex] \sqrt{7^2} [/tex]

Answer:

The Correct Would Be OPTION : D

Step-by-step explanation:

What property is l times w = w times l

Answers

Answer:

This property is communitive

Step-by-step explanation:

Whats the original price for this?

Answers

75 dollars who doesn't know that
original price is $93.75

Can anyone help me? Or at least explain how you solved the problem

Answers

The answer to this is 2. You can simplify it by crossing out the two 3's. Now you're left with 2/1 which is 2 in standard form.

What is the area of the figure?

A. 617.5 m^2
B. 824 m^2
C. 759 m^2
713.5 m^2

Answers

Hey !!

Check the attachment.

Hence, On proper calculations ,
We get our answer as D) 713.5 m^2


Hope it helps you :)

what is the surface area of a cube with a side length of 3 1/4 in

Answers

3 1/4 = 13/4
so
A = 6a^2
A = 6(13/4)^2
A = 6 (169/16)
A = 63.375 in^2 

Can you make a triangle with only acute angles, and none of the sides is the same length? If no can you please explain?

Answers

Yes you can
Hope this helps
Yes, I do think so. If you take a normal acute triangle such as an equilateral with all 60 degree sides, if you made one angle 70 degrees, and one 50, then that would still make 180 degrees, and fit. 

(Quick summary if that looks strange: 60 + 70 + 50 are all acute angles and none are the same!)
Hope i helped :)

Find 0.8% of 1,046 what is 0.8% of 1,046

Answers

Your correct answer should be 8.368

The required answer would be 8.368 which is 0.8 percent of 1,046.

What is the percentage?

The percentage is defined as a ratio expressed as a fraction of 100.

For instance, If Mishali obtained a score of 67% on her exam, that corresponds to 67 out of 100. It is expressed as 67/100 in fractional form and as 67:100 in ratio form.

We have to determine the evaluation of 0.8% of 1,046.

⇒ 0.8% of 1,046

0.8%  is expressed as 0.8/100 in fractional form

⇒ (0.8/100)(1,046)

0.8/100  is expressed as 0.008 in decimal form

⇒ (0.008 )(1,046)

Apply the multiplication operation, and we get

⇒ 8.368

Therefore, 0.8% of 1,046 would be 8.368.

Learn more about the percentages here:

brainly.com/question/24159063

#SPJ2

Jason takes 2 centiliters of medicine. How many milliliters is this?

Answers

Jason has 20 ml how I get 20 ml 2 times 10

what is 78 million in scientic notation?

Answers

In this problem, you are asked to write a number in scientific notation. In figures, 78 million would look like this:

78,000,000

To write this to scientific notation, you have to move the decimal point to the left until you will get a number between 1 and 10.

Here, you will have to move the decimal point 7 times to get 7.8

The exponent of the scientific notation is the number of times you moved your decimal point. Since the movement of decimal point is going to the left, you will have a positive exponent.

The scientific notation would look like this:

7.8 x 10^7

That would be 7.8 * 10^7
Other Questions
Analyze the following statement: Marcus notices that he runs faster in the mornings rather than the evenings. Is the statement an example of correlation or causation? A. Correlation, because time of day doesn't cause a person to run faster or slower B. Causation, because Marcus has noticed this over several trials C. No relationship, because time of day has nothing to do with how fast a person runs D.There is not enough information to make a conclusion Which head glands secrete sucrase, lipase, amylase, and invertase? What is the measure of an angle that turns through 3/4 of a complete circle What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatctcatccagcattctgaaagggtaatgaataattattccgctgagttcatgaggtatccgaaggaggagcaacacttaggctataagagtatcatgcacatagatcgggataaatcgcctatcatatgtgacaacaatttcatgattaaaagt code for? Which is a pro-election of federal judges argument?A. When judges are elected they can be biased by party politics. B. When judges are elected there they can focus more time on reviewing law.C. Judges are more accountable to the people and what they think is just when they are elected Which statement displays an effect of developing a successful atomic bomb? Question 11 options: A.encouraged private sector employees to not share their discoveries with the government B.was the final time that the government and private sector combined to form any great invention C.served as a model for future government or private research and development labs to create innovationsD.proved that military innovation is always ahead of private innovation the graph shows the percentage of dog breeds affected by elbow dysplasia, which causes dogs to limp. What???s the most likely explanation for the mixed breed???s disease incidence? The probability is 0.2 that a person shopping at a certain store will What is the differecne of the following polynomials? (6x^2 - 3x^3) - (2x^3 + 4x^2 -5) Congratulations As you know, the position for which you are applying requires superlative problem-solving skills in a variety of arenas, and the ability to think critically on the fly is essential. To evaluate your ability in this area, the practical portion of the interview process consists of a series of locked-room puzzles. You will need to use all of your ingenuity to find the key to unlocking each room. There are six rooms total; four of the rooms will have individual time limits, while the remaining two rooms will be untimed. You will be observed by the interview team from a remote location, and your progress through the rooms will be recorded. For which type of communication would this paragraph be used?A)casual noteB)informal emailC)formal business If 1495 J of heat is needed to raise the temperature of a 337 g sample of a metal from 55.0C to 66.0C, what is the specific heat capacity of the metal? Evaluate the expression when a=15 and b=5. b2 ------------ = a + 5Help Do you think that humans and humpback whales share a common evolutionary lineage? Help Im really stuck and need help fastttttttt!!!!!!!? which is an example of circadian rhythm in plants? Which of the following bodies of water is located between the countries of Malaysia and Indonesia and connects the Pacific Ocean to the east with the Indian Ocean to the west? Bodies of Water in Eastern Asia (Points : 1) The Strait of Sunda The Strait of Malacca The Makassar Strait The Java Sea, Who ran as a third party candidate in the 1968 presidential election answer.com\? The Sixth Amendment states that in criminal prosecutions, people have the right to speedy trial with a How do the functions of the skeletal system relate to muscular system functions Help with a few health questions I really can't get??20. An inflammation of the tissue under the foot (fascia) caused by overuse and improper athletic footwear. Characterized by intense "start-up" pain under the heel bone: (1point) pronation plantar fasciitis *my answerosteoporosis osteoarthritis21. Personal and specific fitness objectives and plans are referred to as: (1point) specific goals health issues fitness goals *my answerrealistic goals24. A set of actions to offset counterproductive behaviors: (1point) motivations strategies behaviors changes