A nonrenewable resource is defined as

Answers

Answer 1
A nonrenewable resource is a resource of economic value that cannot be readily replaced by natural means on a level equal to its consumption. Most fossil fuels, such as oil, natural gas and coal are considered nonrenewable resources in that their use is not sustainable because their formation takes billions of years.
Answer 2
Something you can't reuse once its all gone its gone.

(In some cases it takes a VERY long time to come back)

Related Questions

Which best describes the general air temperature on a cloudy night? less predictable than on a clear night lower than on a clear night higher than on a clear night the same as on a clear night?

Answers

Higher than on a clear night, because clouds can trap heat beneath them.

Answer:

higher than on a clear night

Explanation:

On a cloudy night the temperature is higher as compared to that of the clear sky thus we tend to feel more humidity and warm air at night time and the clouds carry enough raindrop and thereby general air temperature on a cloudy night is higher as they block the air movement and create a blockage. And thereby creates an insulating layer.

Which of the following bodies of water is located between the countries of Malaysia and Indonesia and connects the Pacific Ocean to the east with the Indian Ocean to the west?
Bodies of Water in Eastern Asia (Points : 1)
The Strait of Sunda
The Strait of Malacca
The Makassar Strait
The Java Sea,

Answers

The Strait of Malacca is thebodies of water is located between the countries of Malaysia and Indonesia and connects the Pacific Ocean to the east with the Indian Ocean to the west. The Strait of Malacca is named after the Sultanate Malacca that ruled for the time period 1400 and 1511. This Strait is narrow of approximately 890 km stretch.

What is highest estimate for the total number of muslims that live in the world today?

Answers

1 billion or 1.2 billion
Final answer:

The estimated total number of Muslims in the world is over 1.8 billion, making it the second largest religion globally. Notably vast Muslim populations exist in Indonesia, Pakistan, India, Bangladesh, and the Middle East, but Muslims span the globe, including a growing population in the United States.

Explanation:

According to a report by Pew Research Center, as of today, the estimated total number of Muslims in the world is over 1.8 billion. This makes Islam the second largest religion in the globe, accounting for about 19.6 percent of the world's population. With a high concentration across Middle East, Africa, and Asia, countries like Indonesia, Pakistan, India, and Bangladesh have the most significant numbers of Muslim populations. However, Muslims are situated globally with even countries like the United States having a growing Muslim population, expected to exceed the Jewish population by 2040.

Learn more about Global Muslim Population here:

https://brainly.com/question/1293585

#SPJ12

Can somebody please help me?
1. What are some of the natural disasters that Mexico experiences? (1 point)
tsunamis
earthquakes
blizzards
A and B only
2. Which of the following are effects of "El Nino"? (1 point)
hurricanes
floods
droughts
A and B only
A, B, and C,

Answers

Since it is on the San Andreas fault and has a coastline, Mexico is susceptible to A and B only. It doesn't snow much in Mexico. El Nino can cause all three of the options given, so A, B, and C is the best answer.

HELP!!! The Great Barrier Reef is adjacent to which Australian state?
A)Victoria
B)Tasmania
C)New South Wales
D)Queensland

Answers

The Great Barrier Reef is adjacent to Northeastern Queensland. Hope this helps!

the answer is queensland. hope this helps

What was the War Production Board’s purpose?



all of these


to enforce trade agreements with non-warring nations


to ensure that all countries followed the rules of engagement and that civilians were not harmed during the war


to oversee and control the US’ total war effort during WWII

Answers

The war production office was established to oversee and control USA total war effort during ww2. it was established in 1942. it was established by USA president Roosevelt.
It was aimed at streamlining production with war needs. its effect was widely felt. Textiles companies were converted to produce war related wears such as parachutess. It ended shortly after the defeat of Japan.

To oversee the conversion of peacetime industry to wartime industry --Gradpoint

The type of fossil that is widespread over a large geographic range and a short geologic time frame is called __________________________.

Answers

Index fossil is a type of fossil that is widespread over a large geographic range or area but in a short geologic time frame. Index fossil are usually used in determining the geological periods because of its short time frame, wide geological spread in area, and its rapid evolution.

Index Fossils are the type of fossils that has distinctive characteristics, abundant in number, global in range and existed for a short geological time frame.  They are the best type of fossils in telling time.  Examples of index fossils are ammonites, brachiopods, crinoids, bryozoans, rugose corals, mollusks and trilobites.  

When tectonic plates move and slip past each other, they cause ______________________in earth's crust?

Answers

Answer:  "faults" .
_________________________________________________________
When tectonic plates move and slip past each other, they cause movement in earths crust.

Name the large island that lies mostly within the attic circle and used the danish krone as it’s official currency.

Answers

The answer is Greenland. Hope this Helps:)))
Greenland is the answer

Which country bordering the southwestern pacific ocean is the worlds leading exporter of beef in terms of weight?

Answers

China for Southwestern Pacific, but US, Brazil, and the EU are top producers
Final answer:

Australia, which borders the southwestern Pacific Ocean, is the world's leading exporter of beef in terms of weight.

Explanation:

The country that borders the southwestern Pacific Ocean and is the world's leading exporter of beef in terms of weight is Australia. Although countries like the United States, and Brazil have a significant beef industry, neither borders the southwestern Pacific Ocean. Australia, however, does. It has a highly developed beef industry and exports a large quantity of beef across the world, making it the leading exporter by weight.

Learn more about Australia's Beef Exports here:

https://brainly.com/question/33958925

#SPJ12

Hundreds of millions of years ago, when fossil fuels were formed, large amounts of a carbon dioxide were trapped underground b nitrogen were trapped in rocks during extensive volcanic activity c phosphate gas were added to the atmosphere through erosion and evaporation. d sodium were used to form ancient fossils, seashells, and limestone

Answers

Final answer:

Fossil fuels formed hundreds of millions of years ago due to the anaerobic decay of plants and animals. Carbon dioxide was sequestered by the growth of land plants, altering the Earth's atmospheric conditions from the early Paleozoic era to become similar to what we experience today.

Explanation:

Hundreds of millions of years ago, when fossil fuels like coal, oil, and natural gas were formed, a significant process that contributed to their formation was the trapping of carbon dioxide in the earth's crust. Fossil fuels are the result of anaerobic decay of dead plants and animals, which mostly occurred before the dinosaurs existed. Over geological time, high pressures and temperatures transformed these materials into the hydrocarbon-rich energy sources we use today.

During the early Paleozoic era, the atmosphere contained much higher levels of carbon dioxide compared to today. The development and spread of land plants contributed to significant changes in atmospheric conditions. As plants took root, they began to sequester carbon dioxide into the soil and rock, thereby reducing atmospheric carbon dioxide levels and increasing oxygen levels. By the end of the Paleozoic, the atmospheric conditions had become more similar to those present today.

Fossil fuels are formed from the anaerobic decay of dead plants and animals that were buried under layers of sediment. The most accurate statement is that large amounts of carbon dioxide were trapped underground during the formation of fossil fuels. Correct option is A.

Fossil fuels, such as coal, oil, and natural gas, are formed from the anaerobic decay of dead plants and animals that were buried under layers of sediment millions of years ago.

The dead organic matter was compressed and heated over time, resulting in the formation of fossil fuels.

Therefore, the most accurate statement among the options provided is option A: When fossil fuels were formed, large amounts of carbon dioxide were trapped underground.

The probable question may be:

In the context of a geology or environmental science course analyze the following statements regarding the formation of fossil fuels and related geological processes. Select the most accurate statement among the options provided:

a. When fossil fuels were formed, large amounts of carbon dioxide were trapped underground.

b. Nitrogen was trapped in rocks during extensive volcanic activity.

c. Phosphate gas was added to the atmosphere through erosion and evaporation.

d. Sodium was used to form ancient fossils, seashells, and limestone.

What basic facilities and services dose la rinconada lack

Answers

The basic facilities and services that la rinconada lack is, inadequate social infrastructure which is not only an inconvenience for the residents but also a significant long term consequence and it is associated with increased costs.

 


Established during the Middle Ages, guilds were associations of skilled artisans designed to institute quality standards, establish training programs, and set prices in industries such as glassblowing or masonry. What most likely happened to the guild system following industrialization?
A.
Guilds likely incorporated new skilled artisans with industrialization-era skills.
B.
Guilds likely became more powerful as fewer people learned trade secrets for these industries.
C.
Guilds likely became less powerful as artisans were replaced by machinery.
D.
Guilds likely expanded to include factory workers, laborers, and unskilled workers.

Answers

The correct answer is C. Guilds likely became less powerful as artisans were replaced by machinery. During the Industrial revolution mass production allowed businesses to produce larger quantities using less capital. They needed less workers when they began incorporating machines that could not only produce more products quicker, but could also produce them uniformly. This meant that fewer artisans would have been needed to make certain products.

Answer:

The answer is C.

Guilds likely became less powerful as artisans were replaced by machinery.

Explanation:

Edge 2021

What is Confucianism?

A- It is a confusing system of government

B- It is a form of religion that focuses on human morality

C- It is the basis of the education system throughout Asia

D- It is complex military arrangement

Answers

B.) It is a form of religion that focuses on human morality

help me pls... this is my last question... brainiest 4 first answer and if u r right

Most Africans live _____.

A. south of the Sahara
B. north of the Sahara
C. east of the Sahara
D. west of the Sahara
E. on the Mediterranean shores

Answers

The answer is either a or b. I am pretty sure it is north. Hope this helps!!

Which of the following is not a form of water erosion?

A: mass wasting erosin
B: sheet erosion
C: rill erosion
D: stream erosion

Answers

A
mass wasting erosion.
The primary agent in mass wasting is the force of gravity. The forces of gravity works on large masses of sand,soil, and rocks downslope.

Water role in the process is simply to accelerate the process.

Answer:

The answer is option A.

Explanation:

The essential specialist in mass squandering is the power of gravity. The powers of gravity chips away at vast masses of sand,soil, and rocks down slope. Water job in the process is just to quicken the procedure. The essential contrast among weathering and disintegration is that weathering happens set up while disintegration includes development to another area. Both are caused by comparable elements of wind, water, ice, temperature, and even natural activity. They can likewise happen together.

Which of the following locations would probably have the highest humidity? arizona nevada california colorado ccalifornia?

Answers

California, particularly coastal regions like San Francisco or areas near the Pacific Ocean, would likely have the highest humidity among the listed options. The option (C) is correct.

The proximity to large bodies of water, such as the Pacific Ocean, significantly influences humidity levels. Coastal California experiences a maritime climate characterized by mild temperatures and relatively high humidity due to the ocean's influence.

The prevailing winds carry moisture from the ocean onto the land, increasing humidity levels in the region. Additionally, the presence of fog, common along the California coast, further contributes to elevated humidity.

This question is not complete, Here I am attaching the complete question:

Which of the following locations would probably have the highest humidity?

A) Arizona

B) Nevada

C) California

D) Colorado

E) California

What makes the Himalayas unique

Answers

They cover about 1,500 mi in total and pass through the parts of India, Pakistan, Afghanistan, China, Bhutan and Nepal. The mountain range is also made up of three parallel ranges.

Which of the following statements is false

Answers

Answer:

Most urban residents of the US are not engaged in agriculture is false.

The false statement among the ones listed is: B. Arabic land is very minimal in the United States. This seems to be a typo and if it intends to refer to 'arable land', then it is still incorrect as the United States has a significant amount of arable land.

The statement that is false is: B. Arabic land is very minimal in the United States.

Let's look at each statement:

1) Less than 2% of the US population is currently engaged in agriculture: This is true.

The ongoing technological advancements have decreased the demand for agricultural labor.

As such, most Americans now live in urban and suburban areas rather than rural, agricultural areas.

2) Arabic land is very minimal in the United States: This is false.

The term 'Arabic land' seems to be a typographical error.

If this statement is intended to refer to 'arable land', then this is still false as the United States has a significant amount of arable land being one of the world's leading agricultural producers.

3) Most urban residents of the US are not engaged in agriculture: This is true.

As earlier stated, most Americans now live in urban and suburban areas and are not engaged in agriculture.

4) The United States, India, and China are the world's three leading agricultural producers: This is true.

These three countries are indeed among the world's leading food producers due to their ample arable land and advanced agricultural technologies.

Learn more about Arable land:

https://brainly.com/question/11362044

#SPJ6

Question:

Which of the following statements is false?

A. Less than 2% of the US population is currently engaged in agriculture.

B. Arabic land is very minimal in the United States.

C. Most urban residents of the US are not engaged in agriculture.

D. The United States, India, and China are the world's three leading agricultural producers.

Please select the best answer from the choices provided.

1) A

2) B

3) C

4) D

Match the government term in column 1 to the definition in column 2. A. Repression Subjected to another's rule B. Democracy Rule of the people C. Oligarchy One-person rule D. Autocracy Rule by the elite few

Answers

Democracy is Rule of the people
Oligarchy is Rule by the elite few
Autocracy is One-person rule
Repression is Subjected to another's rule

Answer:

A- Repression --- Subjected to another's rule

B- Democracy --- Rule of the people

C- Oligarchy --- Rule by the elite few

D- Autocracy --- One-person rule

Explanation:

A- Repression is the use of means of force to impose the will of a person. In terms of government, repression implies the use of violence as a form of imposition of different political measures.

B- Democracy is the system of government in which the people elect their representatives, who govern in their name and by their mandate. Therefore, in democratic regimes governments come and belong to the people.

C- Oligarchy is the group of social elites that have control of the government, as a result of its economic influence, and therefore political. The oligarchic governments, then, are those that are established by the ruling classes of a given country, and that respond only to their interests.

D- Autocracy is a state of power without a division of power in which public power is exercised by a sovereign ruler or self-ruler (autocratic), with absolute power and tyranny.

Which is the correct solution to the expression 3 + 5 ^ 2? Use the scientific calculator given in this course. 10

Answers

3 + 5^2 = 3 + 25 = 28
the first step to finding out the correct solution to the expression 3 + 5^2 is to evaluate the power
3 + 25
next you will add these numbers together
3 + 25 = 28
the correct solution to your expression is 28
let me know if you have any other questions i can help you out with
:)

plzzz help 20 points will be given

Which group of topics would a study of Lake Superior's abiotic environment include? A. air, water, minerals in the water B. the plants found in the lake C. animals that make their homes in the lake D. all the organisms that are part of the lake ecosystem

Answers

The answer is A because abiotic is anything that is non-living. The other answers are wrong because plants, animals, and organisms are all living things. Hope this helps! :)
A Botox is no living factors

Burning fossil fuels, coupled with deforestation, increases the amount of _______ in the atmosphere greatly.

Answers

Carbon dioxide. Forests act as huge sources for carbon dioxide.

hope that helps! :)

The federal government estimates that as many as _____ illegal immigrants enter the United States each year.

5,000
35,000
350,000
3,500,000

Answers

35,000? may be I don't really know....
The Correct Answer is C. 350,000. :)

Describe the process scientists else when they study fossils

Answers

Usually to begin they use the process of relative dating, then chemical dating. Then look at where the environment that we found the fossil to determine if it has always been that environment.  When fossil is found in marine life in a country town suggesting that the environment was previously a marine environment.  Study the rocks that they found the fossils to help determine a relative age. This came before that, but after them to give us an approximate age. Then study the fossil itself to classify it into groups to determine which branch of evolution it has come from. Fossils can be found in rocks, bedding planes, (rock layers), trees (tree ring dating). Mostly there are found in rocks or weathered rocks (sands, mud).

How have Russians adapted to their climate conditions? a. developing new technology to adjust c. using special steel b. constructing buildings adapted to the cold d. all of the above

Answers

It's D all of the above.

When the South Pacific Nuclear Free Zone was established, all of the following activities were prohibited, except __________. A. storing nuclear weapons within the zone B. nuclear testing within the zone C. developing nuclear power outside of the zone D. dumping nuclear waste within the zone

Answers

C "Developing Nuclear power outside the zone" so it doesn't even involve the area, and the other options have things that would put nuclear material in that zone. whilst Nuclear Power is completely different that a weapons testing either way even if it was in the zone.

Correct answer is C. developing nuclear power outside of the zone.

The religious beliefs of many people in West Africa are ______?

A. Modern religions
B. A mix of traditional and modern faiths
C. Based on national identity
D. Traditional faiths only

Answers

D.Traditional faiths can  i get brainiest

Answer:

A mix of traditional and modern faiths

Explanation:

AFRICA is the world’s __________ largest continent made up of 53 countries. 1st 2nd 3rd 4th

Answers

your answer would be 2nd i hope this helps have a great day

Answer:

The answer is 2nd.

Explanation:

AFRICA is the world’s second largest continent. It's made up on 53 countries.

Hopefully, this helps! :D

Ask your question below!

Which of the following statements about quotas in the International Monetary Fund (IMF) is false?

A.
Quotas determine how much each country contributes to IMF funding.
B.
Quotas are determined by the size of a nation’s economy.
C.
The US has 17% of all votes on policy decisions.
D.
The US and Japan are the only countries with enough votes to block certain decisions single-handedly.

Answers

There are some basic facts about the IMF. Quotas determine how much funding each member state has to contribute to the common fund. Some of it will be in international currency and some of it in the state's own currency. Quotas are determined relative to the sice of the economy of a country since funding needs to be proportionate to money-giving ability. Votes on the IMF Board do not correspond proportionally to the budget but they are tightly correlated. We can see on the official website that US funds 17.46% of the budget and it has a 16.52% (17%) voting power. Hence, the fact D is wrong. Japan and the US have combined around 23% of the votes.

D is the answer on E2020

Other Questions
Which statement accurately describe the role of decomposers in the carbon cycle? When parking downhill on a road with a curb, you should turn your front wheels __________ .A. parallel to the curbB. towards the curbC. towards the street Which of the following terms describes the primary core of a comet? two cards are drawn without replacement from a standard deck of 52 playing cards. find the probability that both are odd numbers (aces are considered odd because they have a value of 1 or 11). 14) Which BEST describes the way the Fourteenth Amendment affected the states?A)States had to give all citizens, regardless of their race or religion, equal protection under the law.B)States could no longer make any laws that were not approved by the federal government.C)States had to pass laws that gave more rights to freed slaves than to other citizens.D)States could no longer institute poll taxes or tests for citizens before they voted.2) The term "Reconstruction" in United States history refers to the period after what event?A)the Civil WarB)the Revolutionary WarC)the Constitutional ConventionD)the Declaration of Independence The major problem with hydrogen as an alternative source of energy is that none exists on the surface of the earth. a. True b. False Analyze the following statement: Marcus notices that he runs faster in the mornings rather than the evenings. Is the statement an example of correlation or causation? A. Correlation, because time of day doesn't cause a person to run faster or slower B. Causation, because Marcus has noticed this over several trials C. No relationship, because time of day has nothing to do with how fast a person runs D.There is not enough information to make a conclusion Which head glands secrete sucrase, lipase, amylase, and invertase? What is the measure of an angle that turns through 3/4 of a complete circle What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatctcatccagcattctgaaagggtaatgaataattattccgctgagttcatgaggtatccgaaggaggagcaacacttaggctataagagtatcatgcacatagatcgggataaatcgcctatcatatgtgacaacaatttcatgattaaaagt code for? Which is a pro-election of federal judges argument?A. When judges are elected they can be biased by party politics. B. When judges are elected there they can focus more time on reviewing law.C. Judges are more accountable to the people and what they think is just when they are elected Which statement displays an effect of developing a successful atomic bomb? Question 11 options: A.encouraged private sector employees to not share their discoveries with the government B.was the final time that the government and private sector combined to form any great invention C.served as a model for future government or private research and development labs to create innovationsD.proved that military innovation is always ahead of private innovation the graph shows the percentage of dog breeds affected by elbow dysplasia, which causes dogs to limp. What???s the most likely explanation for the mixed breed???s disease incidence? The probability is 0.2 that a person shopping at a certain store will What is the differecne of the following polynomials? (6x^2 - 3x^3) - (2x^3 + 4x^2 -5) Congratulations As you know, the position for which you are applying requires superlative problem-solving skills in a variety of arenas, and the ability to think critically on the fly is essential. To evaluate your ability in this area, the practical portion of the interview process consists of a series of locked-room puzzles. You will need to use all of your ingenuity to find the key to unlocking each room. There are six rooms total; four of the rooms will have individual time limits, while the remaining two rooms will be untimed. You will be observed by the interview team from a remote location, and your progress through the rooms will be recorded. For which type of communication would this paragraph be used?A)casual noteB)informal emailC)formal business If 1495 J of heat is needed to raise the temperature of a 337 g sample of a metal from 55.0C to 66.0C, what is the specific heat capacity of the metal? Evaluate the expression when a=15 and b=5. b2 ------------ = a + 5Help Do you think that humans and humpback whales share a common evolutionary lineage? Help Im really stuck and need help fastttttttt!!!!!!!?