According to james madison, america's fourth president, the problem with direct democracy is the _____ pushes its self-interest without paying attention to the rights of the_____. direct democracy, he concluded, offers no barrier to lynch mobs crying for blood.

Answers

Answer 1
liders , o the people

Related Questions

You are the leader of a great superpower. To keep the balance of power in nation's favor, you want to gain as many allies as possible. You are interested in gaining the support of nations in Africa, Asia, and Central and South America who do not yet favor either superpower.

1. How will you get these non-aligned (uncommitted) nations on your side????

2. How might actions affect your country? The other superpower?

3. How might being caught in a struggle between superpowers affect a developing nation?

Answers

1. How will you get these non-aligned (uncommitted) nations on your side????
This can be done many ways, my favorite is by using trade and economic ties. This is done by trading resources that the non-aligned nations might want or need.

2. How might actions affect your country? The other superpower?
These trade actions would increase trade within my country and the other nations. This would create an increase in jobs, money, and overall wellbeing. 

3. How might being caught in a struggle between superpowers affect a developing nation?
Joining one specific side could result in benefits from that superpower, but the other superpower might cut off all diplomatic relationships. This could result in a cut of needed or wanted resources, or even war. 

Which of the following helped rebuild Western European nations after World War II?
a.
Truman Doctrine
c.
Marshall Plan
b.
Yalta agreement
d.
George F. Kennan's plan

Answers

Marshall Plan

The "Marshall Plan" was named after the man who then was US Secretary of State, George C. Marshall.  Officially the plan was called the European Recovery Program.  Marshall announced the plan in 1947, and it went into effect in 1948.  The intent was to provide aid and rebuilding to European economies after the damaging effects of World War II.  The US intended to build up its allies in Europe and stave off communism.

Answer: The Marshall Plan, is the correct answer

Explanation:

_____ and _____ are the only presidents in american history to have been impeached and acquitted. andrew johnson; bill clinton richard nixon; franklin roosevelt andrew jackson; herbert hoover thomas jefferson; martin van buren woodrow wilson; jimmy carter

Answers

The correct answer are Andrew Johnson and Bill Clinton. Both mens impeachment were passed by the House of Representatives. However, the Senate acquitted both men. Johnson came closer to actual removal as he was only one vote away from being removed from office.

Andrew Johnson and Bill Clinton were the only U.S. presidents to have been impeached and acquitted. Johnson was impeached over post-Civil War actions, and Clinton for perjury and obstruction of justice. Both were acquitted by the Senate, continuing their presidencies.

Andrew Johnson and Bill Clinton are the only presidents in American history to have been impeached and acquitted. The impeachment process is a significant part of American political history that underscores the checks and balances inherent in the U.S. governmental system.

In 1868, President Andrew Johnson faced impeachment for his actions during Reconstruction post-Civil War. He was impeached by the House but later acquitted by the Senate. Over a century later, in 1998, President Bill Clinton was impeached by the House of Representatives for charges related to perjury and obstruction of justice, but he too was acquitted by the Senate. Unlike Johnson and Clinton, President Richard Nixon faced an overwhelming likelihood of impeachment due to the Watergate scandal. However, he resigned from the presidency in 1974 before the impeachment process could progress, thereby avoiding the potential of being impeached and removed from office.

These historic events illustrate the complexity and gravity of the impeachment process, which is reserved for what can be seen as abuses of power and catastrophic misjudgments in the conduct of presidential duties. Despite the media attention and heightened political drama that surrounded these events, neither Johnson nor Clinton was removed from office.

What was the most important effect of the emancipation proclamation

Answers

The Emancipation Proclamation was an executive order issued by Abraham Lincoln on January 1, 1863. It proclaimed the freedom of slaves in the ten Confederate states still in rebellion. It also decreed that freed slaves could be enlisted in the Union Army, thereby increasing the Union's available manpower.
Final answer:

The Emancipation Proclamation declared slaves in Confederate-held territory to be free, transforming the purpose of the Civil War and leading to the eventual abolition of slavery.

Explanation:

The Emancipation Proclamation, issued by President Abraham Lincoln on January 1, 1863, declared the freedom of all enslaved people in Confederate states during the American Civil War, a pivotal step toward abolishing slavery in the United States. The most important effect of the Emancipation Proclamation was that it declared all slaves in Confederate-held territory to be free.

While the Proclamation did not immediately free all slaves, it fundamentally transformed the purpose of the Civil War and provided a moral and political justification for the Union to continue fighting until slavery was abolished. This significant step towards abolition paved the way for the passage of the 13th Amendment, which formally ended slavery in the United States.

Learn more about Emancipation Proclamation here:

https://brainly.com/question/36622304

#SPJ6

What was the link between the political situation in lran and Nicaragua during the mid-1980?

Answers

Iran was holding American hostages. To get them back the CIA secretly sold missiles to them and then used the money to fund the Contras in Nicaragua. All of this was highly illegal.  

How did american women win the fight for suffrage?

Answers

They worked for a constitutional amendment.

The fight for women's suffrage in the United States was a long and challenging struggle that spanned several decades. American women won the fight for suffrage through a combination of activism, grassroots organizing, strategic advocacy, and determination.

Here are some key steps and strategies that led to the achievement of women's right to vote:

1. **First Wave Feminism**: The suffrage movement in the United States began in the mid-19th century as part of the broader women's rights movement known as First Wave Feminism. Activists like Susan B. Anthony, Elizabeth Cady Stanton, and others organized conventions, petitions, and rallies to advocate for women's right to vote.

2. **State-Level Efforts**: Initially, the suffrage movement focused on gaining voting rights at the state level. Several Western states, including Wyoming, Utah, and Colorado, granted women the right to vote in the late 1800s and early 1900s.

3. **National Women's Suffrage Association**: In 1869, the National Women's Suffrage Association (NWSA) was founded by Susan B. Anthony and Elizabeth Cady Stanton. It campaigned for a constitutional amendment granting women the right to vote.

To know more about suffrage:

https://brainly.com/question/8775137

#SPJ6

Founded in 1828, what publication was the first bilingual newspaper printed in the united states?

Answers

Cherokee Phoenix I hope its right let me know 

Answer:

hola buenas noches que haces

what was the situation in europe following the defeat of napoleon

Answers

After Napoleon had been defeated in 1814, the borders in Europe had to be reestablished.
The conservative governments that contributed to Napoleon's fall needed a way to make sure the power will never again be centered in the hands of a single leader. The new order was established at the Congress of Vienna, held from 1814 to 1815. 

This is the term used to generally describe the legislative branch of the u.s. government (house of representatives and senate).

Answers

Your answer would be Congress
Hi!!


Your answer is Congress.




Hope this helps!!

President eisenhower used the cia to overthrow which middle eastern government in the early 1950s, in large part because this government attempted to nationalize british-owned oil fields?

Answers

President Dwight D. Eisenhower overthrew Iran in 1953. 

Can someone help me.
I need to write a poem about the origins of drill in the military, and it's purpose of it in the military and daily life.
(I really need help)
(if you help me I can make you a Brainliest) :)

Answers

From early mornings,
when air is still,
we practice and train,
to survive and kill,
we learn our drill while you're on your grill,
organized in 1778,
when war was great,
we had what we did not love,
but showed no hate,
Baron Friedrich von Steuben,
created this for our discipline and organizement, which had no type of excitement,
but here we are still today,
when air is still,
and mornings are displayed

One of the advantages of being a career bureaucrat is __________.

Answers

Answer:

One of the advantages of being a Bureaucrat is that the job provides security.

Explanation:

because jesus said so

Answer: D.

Explanation: All of the above are considered advantages of a career in the bureaucracy. Hope I helped! :)

What did germany, Italy, Japan, and the Soviet union have in common during the world war 2?

Answers

Germany, Italy, and Japan were all part of the Allied powers. This was what they had in common. 

Hoped I helped a bit!

Why was Robespierre reign known as the reign of terror

Answers

Final answer:

The Reign of Terror under Robespierre was characterized by oppressive measures, including mass executions by guillotine, to eliminate opposition to the revolution. This period ended with Robespierre's execution, followed by the establishment of the Directory and later the ascent of Napoleon Bonaparte to power.

Explanation:

The reign of Maximilien Robespierre was known as the Reign of Terror because it was a period marked by extreme violence and repression. Robespierre, a lawyer and political figure, emerged as a leader during the French Revolution and pushed for the principles of equality, but he used draconian measures to quash opposition and perceived threats to the revolution. The Committee of Public Safety, under his influence, implemented the Laws of Suspects, which led to the arrest, trial, and guillotine executions of thousands, including former nobility, political opponents, and even revolutionaries deemed unfaithful to the cause.

During this time, the revolutionary government adopted repressive measures, embodied by the use of the guillotine in public executions, designed to prevent dissent and maintain power. However, as the external threats to the revolutionary government diminished, internal strife increased, and disillusionment with Robespierre's policies grew. This led to his arrest and execution, ending the Reign of Terror and paving the way for a more conservative government, the Directory, and eventually the rise of Napoleon Bonaparte.

What actions did the us take that led to start of the cold war?

Answers

Several significant US actions in early Cold War Europe were: 1) The Truman Doctrine of Containment on the 12th of March 1947. This effectively stated America's position against the Soviet Union, although indirectly. Furthermore, it pledged American support for the free peoples of Europe.


A nation that is sovereign is one that must obey another nation. is a member of the United Nations. has a system of taxation. is free from outside influence.

Answers

Final answer:

A sovereign nation is one that operates independently, with ultimate authority over its territory, capable of making its own policies and decisions without external interference.

Explanation:

A sovereign nation is one that is free from outside influence and has the authority to govern itself independently of any other power. Sovereignty is a core principle of international relations, signifying that a state has ultimate authority over its territory, capable of making its own foreign and domestic policies. This includes the ability to enter into treaties and alliances, conduct trade, and engage in or desist from conflicts as it sees fit.

Membership in the United Nations does not compromise a state's sovereignty; instead, it offers a platform for multilateral cooperation while maintaining the sovereign rights of each state. Sovereignty also enables a country to enforce its own laws and taxation systems within its borders, thereby maintaining its autonomy. It's important to note that while states are functionally equal in terms of sovereignty, they may differ in terms of size, power, and wealth.

Final answer:

A sovereign nation governs itself independently and is free from outside influence, with full authority to make laws and conduct foreign relations. Its sovereignty is intrinsic and recognized within the international community, as embodied by the United Nations which emphasizes cooperation among sovereign states.

Explanation:

A sovereign nation is one that has the authority to govern itself independently, without any foreign influence or control. Sovereignty implies that a state has the ability to run its institutions, make laws, determine its own affairs, and respond to threats without interference. It can form treaties, engage in trade, make war or peace, and operate its systems of governance and law enforcement without seeking the direct authority of another nation. Sovereignty is a core concept in international relations, signifying that states are equal in status and have a right to self-determination within the international community.

In the context of the United Nations (UN), while member states are sovereign, the UN creates obligations and rules of behavior for them. The sovereignty of member states is acknowledged, but the organization itself cannot act as a world government with ultimate authority over these states. Instead, the UN is a platform for cooperation and peaceful resolution of conflicts, and it may intervene to stop acts of aggression or maintain peace with the consent of the member states. Sovereignty allows nations to engage in international systems while maintaining control over their internal and external affairs.

Overall, the description of a sovereign nation does not match the statement that it must obey another nation. Instead, a sovereign nation is characterized by being free from outside influence, with full control over its own affairs.

The effort to establish better relations and ease tensions between the US and USSR is called...
A- domino theory
B-detente
C-debut

Answers

The answer is B... ^_^
Hi there Amigo!!



The answer to your question is B. Detente




Hope that helps!!


Sorry if I'm wrong

Best of luck!!

The policy used by the americans against communism was called

Answers

The answer to your question is Containment

How did John Quincy Adams treat Native Americans? A. He overturned a treaty that was signed unfairly. B. He made peace with many Native American nations. C. He formed many reservations for Native Americans to move to. D. He forced them to go on the Trail of Tears.

Answers

I believe the answer is A. He overturned a treaty that was signed unfairly. When he first became president, he signed The Indian Springs Treaty which would cause the natives to move to Mississipi. However, after talking with the tribe, he immediately decided that he had made a mistake and had wanted to reverse the treaties effects. Hope this helped! 

John Quincy Adams overturned a treaty that was signed unfairly, which had resulted in the illegal seizure of Native American lands. Therefore, option A is correct.

John Quincy Adams was the sixth President of the United States, serving from 1825 to 1829. Born on July 11, 1767, he was the son of President John Adams and played a key role in early American politics.

Adams had a distinguished career as a diplomat, senator, and Secretary of State before becoming president. During his presidency, he prioritized national infrastructure, education, and science, and advocated for the rights of Native Americans.

Adams was also known for his strong anti-slavery stance and his defense of free speech. After his presidency, he served as a member of the House of Representatives until his death in 1848.

Learn more about John Quincy Adams here:

https://brainly.com/question/12416301

#SPJ6

Do you think the internment of Fred Korematsu was justified? If he had not been a U.S citizen, would that have made any difference? Explain.

Answers

The internment of Fred Korematsu was unjustified. Korematsu was one of thousands of Japanese American citizens put into internment camps after the bombing of Pearl Harbor . Korematsu did not commit any crimes nor was he affiliated with the Japanese government at all.

This treatment would not be justified even if he wasn’t a citizen. Unless he committed a crime, his internment / constant surveillance is unjustified.

The internment of Fred Korematsu was unjustified, violating basic human rights; citizenship status should not determine individual rights.

let's break it down into detailed steps:

1. Understanding the Context:

  - Start by understanding the historical context of World War II and the events leading up to the internment of Japanese Americans.

  - Highlight the fear and paranoia in the United States following the attack on Pearl Harbor by Japan in 1941.

2. Introduction to Fred Korematsu:

  - Introduce Fred Korematsu as a Japanese American who defied the government's order to report to an internment camp during World War II.

3. Legal Case: Korematsu v. United States (1944):

  - Explain the legal case of Korematsu v. United States, where Korematsu challenged the constitutionality of the internment.

  - Mention that the Supreme Court upheld the internment based on the grounds of military necessity.

4. Criticism of the Decision:

  - Highlight the widespread criticism of the Supreme Court's decision in Korematsu v. United States.

  - Discuss how legal scholars and historians have condemned the decision as a violation of civil liberties and basic human rights.

5. Vacation of Conviction (1983):

  - Explain that in 1983, a federal court overturned Korematsu's conviction based on new evidence of governmental misconduct and racial prejudice.

  - Emphasize that this decision acknowledged the injustice of the internment and its violation of Korematsu's constitutional rights.

6. Ethical Considerations:

  - Discuss the ethical implications of the internment, highlighting the injustice suffered by Japanese Americans during World War II.

  - Emphasize the importance of safeguarding civil liberties and protecting individuals from discrimination, regardless of citizenship status.

7. Citizenship Status and Human Rights:

  - Address the question of whether Korematsu's citizenship status would have made a difference.

  - Assert that human rights should apply universally, irrespective of citizenship, emphasizing the principle of equality and dignity for all individuals.

8. Conclusion:

  - Summarize by reaffirming that the internment of Fred Korematsu and other Japanese Americans was unjustified and a violation of basic human rights.

  - Stress the importance of learning from history to prevent similar injustices from occurring in the future.

The military understanding reached by Great Britain France and Russia is called what?

Answers

The military understanding reached by these nations were called the Triple Entente.

How did the invention of the cotton gin ultimately affect north south relations?

Answers

the south needed less slaves. ?

1. How did Holocaust survivors handle the experience before the Eichmann trial?

Answers

They handled it hard because they knew that everyone of the German officers was guilty but their religions made them feel a type of guilt.

Answer:

They took care of it hard in light of the fact that they realized that Mechanized of the German officers was blameworthy yet their religions made them feel a sort of blame.  

Explanation:

the reality or condition of having carried out an offense, wrongdoing, infringement, or wrong, particularly against the good or punitive law; culpability: He conceded his blame. a sentiment of duty or regret for some offense, wrongdoing, incorrectly, and so forth., regardless of whether genuine or imagined.'Guilt' Canceled By Freeform After One Season. Restrictive: Freeform has picked not to arrange a second period of its spine chiller dramatization Guilt, leaving devotees of the show with some unanswered inquiries. Blame was made and official created by The Game Plan's Kathryn Price and Nichole Millard.

What chinese leader took steps in the 1970s to end china's isolation and improve relations with the united states?

Answers

 Mao Zedong, the Chairman of the Central Committee of the Chinese Communist Party

How did siam avoid colonization by a european nation ?

Answers

Siamese rulers gave concessions to Western colonies particularly Great Britain.

Are all Native Americans descended from a common ancestor

Answers

Yes.  All human come from a common ancestor.  The anthropolgy answer is that we are homerectus, and bipedalism.  Now some humans do have nedanthael in them.  Scientists believe that when the branches were separating there was some intermingling somewhere. 

Most indentured servants left their homes in the 19th century because they
a. were sold by their parents.
c. were pressured by their governments to leave.
b. hoped to better their economic and social position.
d. were tricked and did not know where they were going.

Answers

hoped to better their economic and social position

who produced large quantities of steel very efficiently by buying and controlling iron ore deposits, steel mills, and rainroads


A. Andrew Carnegie
B. Alexander Graham Bell
C. Jean Lenoir
D. Thomas Edison

need help asap!!

Answers

The correct answer is:  [A]:  "Andrew Carnegie" .
________________________________________________________

Which government entity did Jackson challenge as president?

A. The vice presidency
B. The National Bank
C. The Supreme Court
D. Congress

Answers

The correct answer is B. President Andrew Jackson loathed the National Bank as he believed it to be a primarily corrupt monolith. He also considered the National Bank as exerting an unfair amount of influence over the political system as it was mostly foreign owned and made loans with the intent of influencing elections.

The correct answer is b

The 1919 constitutional amendment that outlawed the sale and consumption of alcoholic beverages in the united states failed because __________.

Answers

It was seen as ok, to break the law.  
The country did not have enough people trying to enforce the law.  
People would make alcohol, or go find it on the corner.  
Many people just ignored the law and did it anyways. They did not have enough police force to stop this. Another main reason is because the government lost a lot of money due to the lack of TARIFFS
Other Questions
How much more would $1,000 earn in 5 years in an account compounded continuously than an account compounded quarterly if the interest rate on both accounts is $3.7% How to do this Im lost How do web based applications and websites differ? Describe the effects of Eastern Europes economic problems and ethnic and religious tensions What term refers to the coldest and densest zone, deep below the surface of a lake? Tyree is a skilled cyclist. when practicing on a stationary bike, his coach finds that when the women's cycling team enters the gym, his speed seems to increase significantly. tyree's increase in speed illustrates What factors are associated with recent intimate partner violence? findings from the who multi-country study on women's health and domestic violence? BY THE PRESIDENT OF THE UNITED STATES OF AMERICA. A PROCLAMATION. I, ABRAHAM LINCOLN, President of the United States of America, and Commander-in-Chief of the Army and Navy thereof, do hereby proclaim and declare that hereafter, as heretofore, the war will be prosecuted for the object of practically restoring the constitutional relation between the United States, and each of the States, and the people thereof, in which States that relation is, or may be, suspended or disturbed. That it is my purpose, upon the next meeting of Congress to again recommend the adoption of a practical measure tendering pecuniary aid to the free acceptance or rejection of all slave States, so called, the people whereof may not then be in rebellion against the United States and which States may then have voluntarily adopted, or thereafter may voluntarily adopt, immediate or gradual abolishment of slavery within their respective limits; and that the effort to colonize persons of African descent, with their consent, upon this continent, or elsewhere, with the previously obtained consent of the Governments existing there, will be continued. That on the first day of January in the year of our Lord, one thousand eight hundred and sixty-three, all persons held as slaves within any State, or designated part of a State, the people whereof shall then be in rebellion against the United States shall be then, thenceforward, and forever free; and the executive government of the United States, including the military and naval authority thereof, will recognize and maintain the freedom of such persons, and will do no act or acts to repress such persons, or any of them, in any efforts they may make for their actual freedom. That the executive will, on the first day of January aforesaid, by proclamation, designate the States, and part of States, if any, in which the people thereof respectively, shall then be in rebellion against the United States; and the fact that any State, or the people thereof shall, on that day be, in good faith represented in the Congress of the United States, by members chosen thereto, at elections wherein a majority of the qualified voters of such State shall have participated, shall, in the absence of strong countervailing testimony, be deemed conclusive evidence that such State and the people thereof, are not then in rebellion against the United States. That attention is hereby called to an Act of Congress entitled "An Act to make an additional Article of War" approved March 13, 1862, and which act is in the words and figure following: Be it enacted by the Senate and House of Representatives of the United States of America in Congress assembled, That hereafter the following shall be promulgated as an additional article of war for the government of the army of the United States, and shall be obeyed and observed as such: Article . All officers or persons in the military or naval service of the United States are prohibited from employing any of the forces under their respective commands for the purpose of returning fugitives from service or labor, who may have escaped from any persons to whom such service or labor is claimed to be due, and any officer who shall be found guilty by a court-martial of violating this article shall be dismissed from the service. SEC. 2. And be it further enacted, That this act shall take effect from and after its passage." What is the effect of the following passage on the U.S. government? ...and the executive government of the United States, including the military and naval authority thereof, will recognize and maintain the freedom of such persons, and will do no act or acts to repress such persons, or any of them, in any efforts they may make for their actual freedom.A) It intends to conscript former slaves into the military.B) It intends to prosecute former slave owners.C) It will not stop any slave from moving toward freedom.D) It will use its military and naval authority to stop the war. Which of the following words has the same root as the word biology? a zoology b geology c bibliography d biograph Which expression is equivalent to (2x^5+7x^3)-(5x^2-4x^3) What is the length of chord JK? Who was the first northern democrat elected to the presidency since 1968? determine the qotient of 7,684 and 78 Choose the sentence that best describes the history of Guatemala's capital city.The capital has always been Guatemala City.The capital has always been Antigua.The capital used to be Antigua, but is now Guatemala City.The capital used to be Guatemala City, but is now Antigua. As a healthier alternative to french fries, some fast food outlets offer pre-sliced, bagged apples as a side option. the ingredients list often reads, "apples and ascorbic acid." ascorbic acid is another name for vitaminc. what role does the ascorbic acid play in the product? ascorbic acid is a sequestrant that binds free metal ions and reduces the rancidity of fat in the apples. ascorbic acid is an antioxidant that prevents discoloration when the apples are cut and exposed to oxygen. ascorbic acid is a curing agent that prevents the growth of clostridium botulinum. ascorbic acid is a color additive that makes the color of the apples appear more vibrant. What are the causes of problems the milers and other Native American groups face in Guatemala how are people trying to solve these problems Which diagram shows the most useful positioning of a rectangle in the first quadrant of a coordinate plane? Answers are in the pictures. In an attempt to stem the rising tide of illegitimacy rates and single-parent families among the poor, which act mandated two-parent coverage for all state afdc programs? the family support act in 1988 the supplemental security income the affordable care act temporary assistance to needy families Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? view available hint(s) where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? it would not bind the target dna. ttttagccatttacgattaatcg ttttagccatttacgattaatcg ttttagccatttacgattaatcg? For the electric field shown, which of the following statements describes an increase in voltage?A) A negative charge crosses an equipotential line toward the source charge.B) You cannot tell from the information given.C) A positive charge crosses an equipotential line toward the source charge.D) A positive charge moves along an equipotential line.UPDATE: ANSWER IS C