An apple farm yields an average of 31 bushels of apples per tree when 17 trees are planted on an acre of ground. each time 1 more tree is planted per​ acre, the yield decreases by 1 bushel​ (bu) per tree as a result of crowding. how many trees should be planted on an acre in order to get the highest​ yield?

Answers

Answer 1
Final answer:

To maximize the apple yield from an acre, the optimal number of apple trees to plant is 24 trees.

Explanation:

In this problem, we need to maximize the yield of apples from an acre of an apple farm. The yield of apples from an acre is given by the product of the number of trees and the number of bushels per tree. The number of bushels of apples per tree decreases by 1 bushel every time an additional tree is added due to crowding. In mathematical terms, this can be expressed as the equation Y = N * (31 - (N - 17)), where Y is the total yield, and N is the number of trees per acre.

To find the maximum yield, we differentiate this equation with respect to N and set the derivative equal to zero. This gives us N = 24. Therefore, the optimal number of trees to plant per acre in order to maximize apple yield is 24 trees.

Learn more about Maximizing Yield here:

https://brainly.com/question/32287841

#SPJ12

Answer 2

To maximize the yield of apples per acre, plant 24 trees. This balances the number of trees and the yield per tree due to crowding.

To find the number of trees that should be planted per acre to get the highest yield, we need to model the yield per acre as a function of the number of trees planted and then find the maximum value of this function.

1. Define the variables:

  - Let ( n ) be the number of trees planted per acre.

  - The yield per tree decreases by 1 bushel for each additional tree planted, starting from 31 bushels per tree when there are 17 trees planted.

2. Model the yield per tree:

  - If ( n = 17 ), the yield per tree is 31 bushels.

  - For each additional tree, the yield decreases by 1 bushel, so the yield per tree can be expressed as ( 31 - (n - 17) ).

  Simplifying this, we get:

   Yield per tree = 31 - n + 17 = 48 - n

3. Model the total yield per acre:

  - The total yield ( Y ) per acre is the number of trees ( n ) times the yield per tree.

 Y = n × (48 - n)

4. Formulate the quadratic function:

  Y = 48n - [tex]n^2[/tex]

5. Find the maximum yield:

  - This is a quadratic function of the form [tex]\( Y = -n^2 + 48n \)[/tex], which is a downward-opening parabola. The maximum value of \( Y \) occurs at the vertex of the parabola.

  - The vertex of a quadratic function [tex]\( ax^2 + bx + c \)[/tex] occurs at [tex]\( x = -\frac{b}{2a} \)[/tex] . In our case, ( a = -1 ) and ( b = 48 ).

 [tex]\[ n = -\frac{48}{2(-1)} = \frac{48}{2} = 24 \][/tex]

So, to get the highest yield, 24 trees should be planted per acre.


Related Questions

The following table gives the science scores and times spent studying for 10 students:
Name Scores (%) Time Spent
Studying (hrs)
Angela 90 4
Brad 70 2
Curt 80 3
Dozer 60 1
Enda 50 1
Frank 40 2
Gill 100 4
Hailey 100 3
Intra 50 1
John 80 3
Describe the correlation between the score and time spent studying.

Answers

There appears to be a positive correlation between the number of hour spent studydng and the score on the test.

When identifying the independent and dependent quantities, we think about what would cause the other to change.  The score on the test would not cause the number of hours spent studying to change; rather, the number of hours spent studying would cause the score to change.  This means that the number of hours studying would be the independent quantity and the score would be the dependent quantity.

Plotting the graph with the time studying on the x-axis (independent) and the score on the y-axis (dependent) gives you the graph shown.  You can see in the image that there seems to be a positive correlation; the data seem to generally be heading upward.

As per the table, the given science scores and time data for studying about 10 hours are given.

A positive correlation can be seen between the number of hours spent studying and the scores.  This states that the no. of hours of studying could be on the independent and the score would be the dependent quantity. When on the graph with the time studying on the x-axis and the y-axis gives you the graph the line seems to be going up hence a positive correlation.

Learn more about the gives the science scores and times spent studying.

brainly.com/question/25299087.

A recipe calls for 1 1/2 cups of sugar. Alexis only has measuring cups that measuring cups that measure 1/4 cup. how many times will alexis have to fill the measuring cup?

Answers

Change 1 1/2 into improper faction

1 1/2 = 3/2

Change 3/2 to quarters

3/2 = 6/4

1 measure cups = 1/4 cup

To get 6/4 cups 
6/4 ÷ 1/4 = 6/4 x 4/1 = 6 

He needs to fill in 6 times

Please help will give Brainliest!! 1.Find the length of line segment AB when A=(2, 0) and B=(2, 6)
2.Find the length of CD: C(12, -10) and D(0, -6)

3.Find the length of EF: E(-3, 2) and F(6, 2)

Answers

To find the distance you can use the formula [tex] \sqrt{(x2 - x1)^{2} + (y2 - y1)^{2}} [/tex]

Try to work it out but if you still need help then ill be be happy to do so :)

Match each angle measure in degrees with its equivalent measure in radians

Answers

To convert angle from radian measure to degree measure, multiply it by 180/π.

So,
a) 5π/4 in degree measure will be:

[tex] \frac{5 \pi }{4}* \frac{180}{ \pi } = 225[/tex]

So, 5π/4 radian is equal to 225°.

b) 9π/5 in degree measure will be:

[tex] \frac{9 \pi }{5}* \frac{180}{ \pi } = 324 [/tex]

So, 9π/5 radian is equal to 324°.

c) 2π/3 in degree measure will be:

[tex] \frac{2 \pi }{3}* \frac{180}{ \pi } = 120[/tex]

So, 2π/3 radian is equal to 120°.

d) 4π/9 in degree measure will be:

[tex] \frac{4 \pi }{9}* \frac{180}{ \pi } = 80[/tex]

So, 4π/9 radian is equal to 80°.

e) 5π/6 in degree measure will be:

[tex] \frac{5 \pi }{6}* \frac{180}{ \pi } = 150[/tex]

So, 5π/6 radian is equal to 150°.

f) 7π/4 in degree measure will be:

[tex] \frac{7 \pi }{4}* \frac{180}{ \pi } = 315[/tex]

So, 7π/4 radian is equal to 315°.

Answer:

Hm..

Step-by-step explanation:

Rules that govern the ways that logarithms are simplified and combined are going to be very similar to simplifying and combining rules for what other family of functions?

Exponential
Linear
Rational
Polynomial

Answers

They are going to be very similar to rules governing exponential functions.  This is due to the fact that logarithms in essence "cancel" exponents.

Rules that govern the ways that logarithms are simplified and combined are going to be very similar to simplifying and combining rules for the exponential family of function.

This comes from the definition of logarithm itself which says that a logarithm is a quantity representing the power to which a fixed number (the base) must be raised to produce a given number.

Let us illustrate this by way of an example. We know that 100 can be represented as [tex] 10^2 [/tex]. Here 10 is the base, 2 is the power and 100 is the given number. Therefore,

[tex] 10^2=100 [/tex]

Likewise, we can represent 1000 as [tex] 1000=10^3 [/tex]

Now, if we multiply [tex] 10^2 [/tex] and [tex] 10^3 [/tex] we will get: [tex] 10^2\times 10^3=10^{2+3}=10^5 [/tex]. We added the powers. Therefore, the logarithm of [tex] 10^5 [/tex] to the base 10 is 5.

Let us see if we will get the same result by using the rules of logarithms.

[tex] log(10^2\times 10^3)=log(10^2)+log(10^3)=2log(10)+3log(10)=2+3=5 [/tex]

As we can see we got the same result by using the logarithm and the exponential rule, thus, verifying our answer. Similar results can be obtained for other operations of the logarithmic rule.

PLEASE HELP ME ON THIS

QUICKLY!!!!!!!!!!!!!!!!!

~BRAINLIEST AVAILABLE

Answers

First off, we can rule out that this is not an arithmetic sequence, as the y values do not have a common difference.
Next, let's look at the y values again, and test out the common ratios given. First, let's use 0.6. If it's a common ratio of 5, 3, 1.8, and 1.08, then we can find that out by multiplying it by 5 first.
5 x 0.6 is 3.
Then, 3 x 0.6 is 1.8.
Finally, 1.8 x 0.6 is 1.08.
Therefore, B is correct. The table represents a geometric sequence because the successive y-values have a common ratio of 0.6, since multiplying the values by 0.6 equals the next value down.

Line AB intersects line DF. Which statement shows that the two lines are perpendicular?

Line AB and line DF are on the same plane.
Line AB and line DF intersect only once.
Line AB and line DF intersect at a 90° angle.
Line AB and line DF intersect at a 180° angle.

Answers

Answer:
Line AB and line AD intersect at a 90° angle

Explanation:
Two lines are said to be perpendicular if the angle between the two lines is 90 degrees.
If the angle between the two lines is 180, the two lines are said to be supplementary angles
The first and second options do not imply that the lines are perpendicular as the angle formed between them could be less or more that 90°.

Hope this helps :)

Convert the fraction to decimal and decimal into the fraction 10.222

Answers

10.222=10 and 222/1000
I'm not sure if that's what you were looking for but I hope this helps!

Answer:

10 and 222/1000

Step-by-step explanation:

PLEASE HELP ASAAAAPPPPPP

Answers

the correct answer is A

the answer is A hope it helps

PLEASE HELP ME ON THIS

Answers

it's B the second one
the answer is 
8x+12y<96
x+y>10

A school baseball team earned $3416.90 from selling 5716 tickets to their game. If grandstand tickets sold for 65 cents each and bleacher tickets sold for 40 cents each, how many of the bleacher tickets were sold? Answer: bleacher tickets

Answers

Let g and b represent the numbers of grandstand and bleacher tickets sold... g + b = 5716 . . . . . . . . . total number of tickets sold.. 65g +40b = 341690 . . value of tickets sold
Using the first equation.. g = 5716 -bSustituting into the second equation.. 65(5716 -b) +40b = 341690.. -25b + 371540 = 341690 . . . . . collect terms.. -25b = -29850 . . . . . . . . . . . . . . subtract 371540.. b = 1194 . . . . . . . . . . . . . . . . . . . . divide by -25

The table below shows the data collected on the number of car washes, y, each day since the Auto Spa opened, x.

Days Since Auto Spa Opened 0 20 40 60 80 100
Number of Car Washes 29 35 18 31 28 14

The owner of the new Auto Spa created a line of best fit for the data that can be modeled by the following equation.

y = -0.12x + 31.76

Match the slope and y-intercept with the correct description for the given situation.

titles
the number of cars washes on the day the Auto Spa opened

the ratio of car washes to the number of days since the Auto Spa opened

the number of car washes

the total number of days since the Auto Spa opened

the ratio in the number of days since the Auto Spa opened to the total profit

pair
y-intercept

slope

Answers

The slope is the ratio of car washes to the number of days since Auto Spa opened; and the y-intercept is the number of car washes on the day the Auto Spa opened.

Explanation:
This line of best fit is in slope intercept form: y=mx+b, where m is the slope and b is the y-intercept.

In this equation, m corresponds with -0.12 and b corresponds with 31.76.

The slope is the ratio of change in y to change in x. The y-coordinate of each point represents the number of car washes and the x-coordinate represents the number of days since Auto Spa opened; the ratio of change in y to change in x is then the ratio of the number of car washes to the number of days since Auto Spa opened.

The y-intercept is the point where the data crosses the y-axis; at this point, and all on the y-axis, the x-coordinate is 0. In this problem, the x is the number of days since Auto Spa opened; if it is 0, this means 0 days since it opened, which would be its opening day. Thus the y-intercept is the number of car washes on opening day.

Answer:

The slope is the ratio of car washes to the number of days since Auto Spa opened; and the y-intercept is the number of car washes on the day the Auto Spa opened.

Step-by-step explanation:

Does anyone know what the system of equations for this would be?

Answers

a + b = 10 pounds
rewrie as:
a = 10 pounds  - b

0.75a + 0.50 b = $6.00
replace a with the above equation:

0.75(10-b) +0.50b = 6.00

distribute the(10-b):

7.50 - 0.75b + 0.50b = 6.00

combine like terms:

7.50-0.25b = 6.00

subtract 7.50 from each side:

-0.25b = -1.50

divide both sides by 0.25 to find b
b = -1.50 / -0.25
b = 6 

she bought 6 pounds of bananas and 4 pounds of apples

The measure of a minor arc is equal to the measure of __________

Answers

The measure of a minor arc is less than 180º

Factor completely x2 - 8x + 16

A. (x+4)(x+4)
B. (x-4)(x-4)
C. (x+4)(x-4)
D. (x-2)(x-8)

Answers

B (x-4)(x-4)

 When you take -4+-4, you will get -8 and when you multiply -4 x -4, you will get 16

what is the measure of AC?

Answers

we know that
The inscribed angle measures half of the arc it comprises
∠ABC=mAC/2
so
mAC=2*∠ABC
mAC=2*75°
mAC=150°

the answer is mAC=150°

32 to 28 is what percentage of what change an increase or decrease

Answers

im not sure but i think its decreased by 12,5%

5. Write a conditional statement. Write the converse, inverse and contrapositive for your statement and determine the truth value of each. If a statement’s truth value is false, give a counterexample.

Answers

Conditional Statement: If it is a beagle, it is a dog.
Converse: If it is a dog, it is a beagle. This is a false statement, since a dog can be any other breed (ex. Pomeranian).
Inverse: If it is not a beagle, it is not a dog. Again a false statement, since if it is a different breed, it is a dog despite not being a beagle. For example, it could be a Pomeranian.
Contrapositive: If it not a dog, it is not a beagle. This is true, since if something is not a dog, it won't be any particular breed of dog either (and it won't be a beagle).

A grocery store sells chili peppers at $2.04 for a dozen. At this rate, what's the cost per pepper? A. $0.17 B. $1.70 C. $0.07 D. $1.07

Answers

The answer is A. $0.17 . 

Gretchen's gross annual salary is $57,852 what is the maximum amount of rent she can afford to pay

Answers

Answer: Varies depending on the percent that you use.

To find the amount that you should spend on rent, you simply multiply your total annual salary by the recommend percent. Use the one that you were given.

A common percent is 30%.

So you would do the following problem if you were using 30%.
0.30 x 57852 = $17,355.6.


Rent should be no more than 28% of a person's gross monthly income. Divide the annual salary by 12 and multiply the quotient by 0.28.

Answer is $1350

helpppppppppppppppppppppppppp

Answers

A. First notice that the function is moved up by two units from the origin, not four, so the answer must be in A, B, and D. Also notice that the period of the function is pi instead of 2pi, so the coefficient before x is 2pi/pi=2, so eliminate B. The function is opposite of original sin function, so there's a negative sign in front of the expression. The answer is A.

What is the vertex of the graph of y = x2 + 4x?
(–2, –12)
(–2, –8)
(–2, –6)
(–2, –4)

Answers

the answer is (-2,-4)

Answer:

(-2, -4)

Step-by-step explanation:

Let's remember how to calculate the vertex of a parabola:

If we have the equation of the parabola given in the form y = ax^2 + bx + c, the x-coordinate of the vertex is x = -b/2a. For the y-coordinate we just replace the x of the equation with -b/2a and do the calculation.

In this case, a = 1, b = 4, c = 0.

The x-coordinate of the vertex is x = -4/2*1 = -2

The y-coordinate is y = (-2) ^2 + 4*(-2) = 4 - 8 = -4

Therefore, the vertex is (-2, -4)

The mean of the data set is 18 what’s the missing number 21,11,blank,27,22,13,16

Answers

9514 1404 393

Answer:

  16

Step-by-step explanation:

The sum of the 7 numbers needs to be 7·18 = 126.

Then the missing number is ...

  126 -21 -11 -27 -22 -13 -16 = 16

Can someone please help me out on this?

Answers

(Y>x/3+0) - I think the answer B
I hope it can help you.



Your school drama club is putting on a play and hopes to raise $600 from ticket sales. They sell adult tickets for $8 each and student tickets for $5 each. Let x represent the number of adult tickets and y represent the number of student tickets. The equation to represent the number of tickets sold to reach their goal, 8x+ 5y = 600, is graphed below. If 40 adult tickets are sold, how many student tickets must be sold to reach their goal?

Diagram can be shown here:
https://static.k12.com/eli/bb/343/3_23939/2_15013_4_23943/d7066d09bfa7bf4e8df2b2c0b508a3e8ba21c76d/media/b1cd8381087979f1dffbcd6f3efef158a61fbd57/mediaasset_649354_1.gif

Answers

8x40=320 +280=600 5x50=250 +5x6=30 320+250+30+600 so they will have to sell 40 adult tickets and 256 student tickets to accomplish their goal

Please help ASAP!! Super appreciated!!! <3

Answers

The data is not linear. From (3, 1) to (7, 2), we add 4 to the x-value and add 1 to the y-value. This pattern continues for a little while, however, from (11, 3) to (18, 5), we add only 7 to the x-value even though we added 2 to the y-value. Given this information, we can determine that this is not linear data.

There are seven black marbles and nine white marbles in a bag what is the aprroximate probability of drawing two black marbles and then a white marble without replacement

Answers

There are a total of 16 marbles in the bag. Black marbles compound 7/16 or 43.75% of the bag. White marbles compound 9/16 or 56.25% of the bag.

There is a probability of 43.75% to pick a black marble in the bag with 16 marbles.
If you do , there will be 6 black marbles and 9 white marbles left in the bag. The probability to pick anpther black marble is 6/15 or 40%.


If you do pick another black marble , there will be 5 black marbles and 9 white marbles left in the bag , which means the probability of you getting a white marble next is 9/14 or 64.28%.

Now we just have to multiply the probability of you picking the marbles in the right order :

0.4375 × 0.4 × 0.6428 = 0.11249

Which is approximately 11.25%

There is a probability of 11.25% of you getting two black marbles and one white marble in a bag with 7 black marbles and nine white marbles .

I hope you understood my brief explanation. And please consider marking this awnser as Branliest if you think it deserves it. Thank you :)

The approximate probability of drawing two black marbles and then a white marble without replacement is 9/80.

What is probability?

Probability deals with the occurrence of a random event. The chance that a given event will occur. It is the measure of the likelihood of an event to occur.The value is expressed from zero to one.

For the given situation,

Number of black marbles = 7

Number of white marbles = 9

The event of drawing two black marbles from seven black marbles is

⇒ [tex]\frac{7C_{2} }{16C_{2} }[/tex]

[tex]7C_{2} =\frac{(7)(6)}{(1)(2)}[/tex]

⇒ 21

[tex]16C_{2}=\frac{(16)(15)}{(1)(2)}[/tex]

⇒ 120

Now, [tex]\frac{7C_{2} }{16C_{2} }=\frac{21}{120}[/tex]

Total number of balls, after drawing 2 black balls without replacement is

⇒ 16 - 2 = 14

The event of drawing a white marble without replacement from nine white marbles is

[tex]\frac{9C_{1} }{14C_{1} } = \frac{9}{14}[/tex]

Thus, the approximate probability of drawing two black marbles and then a white marble without replacement is

P(E) = [tex](\frac{21}{120}) (\frac{9}{14} )[/tex]

⇒ 9/80

Hence we can conclude that the approximate probability of drawing two black marbles and then a white marble without replacement is 9/80.

Learn more about probability here

https://brainly.com/question/22221548

#SPJ2

What is the correct definition of the third quartile of a data set?
A. The third quartile is all the numbers of the data set added together and divided by 3. B. The third quartile is the difference between the maximum and median. C. The third quartile is the median of the upper half of data in the data set. D. The third quartile is the mode of the upper half of data in the data set.

Answers

we know that 

The third quartile (also called the upper quartile) has 75 percent of the data below it and the top 25 percent of the data above it. The third quartile is the same as the median of the part of the data which is greater than the median. 

therefore

the answer is the option
C.) The third quartile is the median of the upper half of data in the data set.
Answer:

Option: C is the correct answer.

C.    The third quartile is the median of the upper half of data in the data set.

Step-by-step explanation:

We know that our data is divided into three quartiles:

1)

First quartile or lower quartile--

It is the median of the lower set of the data.

2)

Middle quartile or Median--

Median is the central tendency of the data and it always exist in the middle of the data set.

3)

Third quartile or upper quartile--

It is obtained by finding the median of the upper set of the data.

               Hence, the answer is: Option: C

Galileo wanted to release a wooden ball and an iron ball from a height of 100 meters and measure the duration of their fall. He found a plane with an incline of 12 degrees that he could climb until he could get to an altitude of 100 m. How far should Galileo walk up the inclined plane? Round your final answer to the nearest hundredth.

Answers

For this case what you have is the same as a rectangle triangle where you have as data the degree of inclination of the hypotenuse with respect to the base and the height of the triangle.
 We have to find the value of the hypotenuse.
 For this we use the following trigonometric relationship:
 senx = C.O / h
 Where
 x: angle
 C.O: opposite leg
 h: hypotenuse.
 Substituting the values we have:
 sen (12) = 100 / h
 We cleared h:
 h = 100 / sin (12)
 h = 480.97 m
 Answer: 
 Galileo should walk 480.97 m up the inclined plane

Galileo walk 480.97 meters up the inclined plane if Galileo wanted to release a wooden ball and an iron ball from a height of 100 meters and measure the duration of their fall.

What is the trigonometric ratio?

The trigonometric ratio is defined as the ratio of the pair of a right-angled triangle.

We have:

Galileo wanted to release a wooden ball and an iron ball from a height of 100 meters.

Let's suppose Galileo walked x meters up the inclined plane.

The plane with an inclined a 12°

As we can see in the right angle triangle the sin ratio:

[tex]\rm sin24\° = \frac{100}{x}[/tex]

[tex]\rm x = \frac{100}{sin24\°}[/tex]

x = 480.97 meters   (Sin12° = 0.20791)

Thus, Galileo walk 480.97 meters up the inclined plane if Galileo wanted to release a wooden ball and an iron ball from a height of 100 meters and measure the duration of their fall.

Know more about trigonometry here:

brainly.com/question/26719838

#SPJ3

A bike ramp has a slope of 3/4. What is the angle the ramp makes with the ground?

Answers

That would be 36.87°
Hope it helps !
And it would be awesome if you marked this awnser as Branliest! Thank you :)
Other Questions
What happened to American life as a result of new technology in the late twentieth century?A.Americans could purchase cars for the first time.B.Americans could shop at home on the Internet.C.Americans could see movies in theaters.D.Americans could fly on airplanes. The sum of two angles in a triangle totals 117 degrees, what is the measure of the third angle What types of anthropologists explore all aspects of living human culturefrom war and violence to love, sexuality, and child rearingand look at the meanings that people from all over the world place on these things? Read this excerpt from "Goodbye to All That" by Joan Didion.We stayed ten days, and then we took an afternoon flight back to Los Angeles, and on the way home from the airport that night I could see the moon on the Pacific and smell jasmine all around and we both knew that there was no longer any point in keeping the apartment we still kept in New York.Which statement best explains how the imagery in the excerpt affects the meaning of the text?It highlights the isolation and loneliness of life in Los Angeles, demonstrating that Didion faces the same problems there that she faced in New York.It captures the beauty and serenity of life in Los Angeles, suggesting why Didion feels more content living there than she did in New York.It provides an unrealistic and idealized impression of Los Angeles, showing that Didion has not changed at all.It depicts the dark and mysterious atmosphere of Los Angeles, indicating why Didion is drawn to this new, exciting city. What is the equation, in slope-intercept form, of the line that is perpendicular to the line y 4 = 2/3(x 6) and passes through the point (2, 2)? y = 2/3x 10/3 y = 2/3x +10/3 y = 3/2x 1 y = 3/2x + 1 Your gross pay on your paycheck is $400. your deductions are as follows: federal income tax - $50.00 state income tax - $20.00 social security tax - $7.00 medicare tax - $3.50 please calculate your net pay (in dollars). question 2 options: Which statement accurately describe the role of decomposers in the carbon cycle? When parking downhill on a road with a curb, you should turn your front wheels __________ .A. parallel to the curbB. towards the curbC. towards the street Which of the following terms describes the primary core of a comet? two cards are drawn without replacement from a standard deck of 52 playing cards. find the probability that both are odd numbers (aces are considered odd because they have a value of 1 or 11). 14) Which BEST describes the way the Fourteenth Amendment affected the states?A)States had to give all citizens, regardless of their race or religion, equal protection under the law.B)States could no longer make any laws that were not approved by the federal government.C)States had to pass laws that gave more rights to freed slaves than to other citizens.D)States could no longer institute poll taxes or tests for citizens before they voted.2) The term "Reconstruction" in United States history refers to the period after what event?A)the Civil WarB)the Revolutionary WarC)the Constitutional ConventionD)the Declaration of Independence The major problem with hydrogen as an alternative source of energy is that none exists on the surface of the earth. a. True b. False Analyze the following statement: Marcus notices that he runs faster in the mornings rather than the evenings. Is the statement an example of correlation or causation? A. Correlation, because time of day doesn't cause a person to run faster or slower B. Causation, because Marcus has noticed this over several trials C. No relationship, because time of day has nothing to do with how fast a person runs D.There is not enough information to make a conclusion Which head glands secrete sucrase, lipase, amylase, and invertase? What is the measure of an angle that turns through 3/4 of a complete circle What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatctcatccagcattctgaaagggtaatgaataattattccgctgagttcatgaggtatccgaaggaggagcaacacttaggctataagagtatcatgcacatagatcgggataaatcgcctatcatatgtgacaacaatttcatgattaaaagt code for? Which is a pro-election of federal judges argument?A. When judges are elected they can be biased by party politics. B. When judges are elected there they can focus more time on reviewing law.C. Judges are more accountable to the people and what they think is just when they are elected Which statement displays an effect of developing a successful atomic bomb? Question 11 options: A.encouraged private sector employees to not share their discoveries with the government B.was the final time that the government and private sector combined to form any great invention C.served as a model for future government or private research and development labs to create innovationsD.proved that military innovation is always ahead of private innovation the graph shows the percentage of dog breeds affected by elbow dysplasia, which causes dogs to limp. What???s the most likely explanation for the mixed breed???s disease incidence? The probability is 0.2 that a person shopping at a certain store will