An increase in the ____ in(of) a parcel of air will not cause the pressure to rise.

Answers

Answer 1
I think it is THE VOLUME IN/OF A PARCEL...

Related Questions

After the big bang, atoms in gas clouds experienced a greater gravitational pull to each other than atoms in other regions of the universe. Which two statements are scientific facts that explain this phenomenon?

Gravitational pull on an object decreases with a decrease in its temperature.

As the density of an object increases, it becomes immune to gravitational force.

Gravitation between two objects increases when the distance between them decreases.

Gravity doesn’t exist between objects that are less than one light-year apart.

When the mass of an object increases, its gravitational pull also increases.

which 2 are correct?

Answers

Gravitation between two objects increases when the distance between them decreases.

When the mass of an object increases, its gravitational pull also increases.

Answer:

3. & 5. is the most logical way to put things.

What is the most likely cause of the change in population size in year 6 shown in the graph below? a. An increase in the amount of land available b. A decrease in the amount of land available c. A cold spring d. A hot summer

Answers

What is the most likely cause of the change in population size in year 6 shown in the graph below? a. An increase in the amount of land available
Final answer:

The change in population size could be due to changes in available resources, temperature changes that affect food availability, and predation levels.

Explanation:

The change in population size in year 6 on the graph could be due to a number of factors, all of which revolve around the availability of resources, the temperature changes, and predation levels. Option a, an increase in the amount of land available, may allow for more resources and living space resulting in population growth. Option b suggests a decrease in the amount of land available, which could lead to higher competition for resources and possible starvation, in turn decreasing the population. Options c and d, a cold spring and a hot summer respectively, can both affect food availability. Extreme temperatures can influence plant productivity thus affecting the food chain. Depending on whether the species in question is cold-blooded or warm-blooded, environmental temperature can also affect the rate of mortality. Increases in predation by larger mammals or over-hunting by humans can also cause a significant decrease in the population.

Learn more about Population Change here:

https://brainly.com/question/32312771

#SPJ3

Select all that apply. What factors contributed to the westward expansion of the U.S.? decreased immigration the Cold War the desire for land, wealth, and adventure the discovery of gold the Homestead Act increased immigration the Revolutionary War

Answers

The answer above just forgot

"increased immigration"

But The rest are correct

Desire for land, wealth, and adventure

The discovery of gold

The Homestead Act


The Following factors contributed to the westward expansion of the U.S.

the desire for land, wealth, and adventurethe discovery of goldthe Homestead Act increased immigration during the Revolutionary War

The correct options are B, C, and D.

Why did people move westward?

The land was one of the primary reasons people came west. There was plenty of land with suitable farming soil that could be purchased at a low cost. Furthermore, living on the East Coast was quite congested. The population of the United States was rapidly rising.

In the 1810s, a big drive toward North America's west coast began. The belief in manifest destiny, government-enacted Indian removal statutes, and economic promise exacerbated it. Pioneers used a network of trails traveling west to reach Oregon and California.

Thus, the ideal selections are options B, C, and D.

Learn more about the expansion of the west here:

https://brainly.com/question/27822911

#SPJ2

God's presence in the universe is somewhat limited at times. TrueFalse

Answers

unfortunately this is true because of the people that deny Him how can He be there if they dont let Him be. (by my grandmother)

How many microstates are recognized? what do many have in common? list 6 that you can find on a map, and state where they are. (if you can only come up with 3 on your own, you'll have to look up three more!)?

Answers

Final answer:

There are 195 recognized microstates in the world. They are usually small and have limited resources. Examples of microstates include Andorra, Liechtenstein, and San Marino.

Explanation:

There are 195 recognized microstates in the world. Microstates are small and independent countries that have their own government and territory. They are recognized by some or all member states of the United Nations.

These microstates also have some common characteristics. They are usually very small in terms of land area and population. They often have limited natural resources and rely heavily on industries such as tourism and finance.

Andorra: Located in the Pyrenees mountains between France and Spain.Liechtenstein: A landlocked microstate between Switzerland and Austria.San Marino: Situated within Italy, near the Adriatic Sea.Monaco: A city-state located on the French Riviera.Vatican City: An independent city-state enclaved within Rome, Italy.Nauru: A Pacific island country northeast of Australia.

Learn more about Microstates here:

https://brainly.com/question/31326940

#SPJ11

A rhombus has sides 10 cm long and an angle of 60°. Find the diagonals of the rhombus 

Answers

Final answer:

The diagonals of the rhombus are 20 cm and 10√3 cm, using properties of equilateral triangles and 30-60-90 right triangles.

Explanation:

To find the diagonals of a rhombus with sides of 10 cm and one angle of 60°, we can use trigonometry and the properties of a rhombus. Every rhombus has two pairs of congruent triangles when split along its diagonals. Because the rhombus has a 60° angle, when split along one diagonal, it forms two congruent equilateral triangles. The length of this diagonal is twice the side length, so one diagonal (d1) is 20 cm.

For the other diagonal (d2), we split the rhombus along the second diagonal and we get four 30-60-90 right triangles. The side opposite the 60° angle (half of d2) is x, and the side opposite the 30° angle (half the side of the rhombus, or 5 cm) is x/2. Using the properties of 30-60-90 triangles, x is equal to the side length times √3. Therefore, the second diagonal is 10 √3 cm.

is the north china plain east or west of the sichuan basin

Answers

The North China Plain is situated east from the Sichuan Basin. This wast plain is in the eastern part of the country. It is connected with the Sichuan Basin through the Yangtze River and the gorge that it has made, which represents a natural boundary between this two lowlands in China.

The North China Plain is located east of the Sichuan Basin. The North China Plain is in eastern China, whereas the Sichuan Basin is in southwestern China. Thus, the North China Plain is to the east of the Sichuan Basin.

Let's first define the locations of the North China Plain and the Sichuan Basin.

North China Plain: This is a large, flat region located in the eastern part of China. It includes the Yellow River basin and is a significant agricultural area with cities like Beijing and Tianjin located nearby.Sichuan Basin: This is a lowland region located in southwestern China. It is surrounded by mountains and is known for its fertile soil and mild climate, making it another important agricultural zone.

By comparing these two regions, determine their relative locations.

The North China Plain is located in the eastern part of China.The Sichuan Basin is located to the west of the North China Plain.

Therefore, the North China Plain is east of the Sichuan Basin.

orthodox Christians believe that there way is the only right way so other followers of Christianity are

Answers

According to the Orthodox Christians all other Christians are Heretics. This means that they consider them to be nonbelievers, or that they do not believe in the faith in the right way. It's also interesting in the Orthodox Christians that in the biggest part of the believers the Bible doesn't play a big part in their beliefs and very small percentage have actually read it, instead it is more like cultural, traditional trait that they stick to it, and in most ways better then the other large fractions of Christianity indeed.

How does the Israeli-Palestinian conflict over territory also involve a conflict over ideology?

A. Both nations need access to ports on the Mediterranean.
B. Both nations fight over power to govern the territory.
C. One nation is primarily Jewish and the other is primarily Muslim.
D. One nation is a democracy, while the other is a monarchy.

Answers

The Israeli-Palestinian conflict over territory involves conflict in ideology as the war is considered as war of religion. This started mid 20th century and an ongoing struggle between the Israelis as well as Palestinians beginning mid 20th century. This can be trace in Jewish immigration thus answer of this is B. Both nations fight over power to govern the territory.

One nation is primarily Jewish and the other is primarily Muslim.

The East Asian region labeled with the number 1 on the map above is the __________ climate region.


A.

humid subtropical

B.

humid continental

C.

highland

D.

semiarid

Answers

the answer is A.humid subtropical.

Answer:

Answer is A, humid subtropical .

The three main island groups in the Philippines are _____.
-Mindanao
-New Guinea
-Luzon
-Java
-Sumatra
-Visayas

Answers

Luzon, Visayas, And Mindanao. Pretty sure, hope this helps :)
Luzon, Visayans, And Mindanao.

Comets orbit in short, circular paths around the sun.
a. True
b. False

Answers

The statement is b. False.
Comets do not orbit around the Sun in a short, circular paths, but they have very large and elongated, elliptical paths. Their paths are not like those of the planets where the distance between the planet and the Sun is kept in pretty much the same level (it differs throughout the year but not drastically), instead their paths make them go very close to the Sun at one point, and than go very far from the Sun at other point.



1.
2.
3.
4. Gulf of Thailand
5.
6.
7.
8.
9. South China Sea
10. Philippine Sea
11.

(please help me figure out the rest)

Answers

1.China
2.Yellow Sea
3.Himalayas
4.Gulf of Thailand 
5.Beijing
6. Kazahstan
7. Siberia 
8.Yangtze river
9.South China Sea
10.Philippine Sea
11.Sea of Japan (east sea)

This is hard but hopefully these are correct
Hope this helped :)
Have a great day 
1.China
2.Yellow Sea
3.Himalayas
4.Gulf of Thailand 
5.Beijing
6. Kazahstan
7. Siberia 
8.Yangtze river
9.South China Sea
10.Philippine Sea
11.Sea of Japan (east sea)

Does the Middle East produce less than half the food and Agro industry products it consumes

Answers

Yes, the Middle East produces less than half of the food and agro industry products it consumes. The Middle East a region heavily dependent on importing food and agro industry products. This is mainly due to the fact that most of the Middle East is not suitable for food production or farming of plants, even of animals. Big portion of it is a desert, and there's lack of water, so this is the biggest problem that contributes to this. Some parts produce solid amounts of food and agro industry products, but it is shaded by the general situation.

What is the equation for work

Answers

Work (j) = F*D

F=Force (N), D = Distance (m)

Hopefully this helped!! =“)

The equation for work in physics is W = Fd, representing the product of the force applied in the direction of motion and the distance over which it acts. If the force is applied at an angle, the equation becomes W = Fd cos θ. This concept is linked to the work-energy theorem, which relates work to changes in kinetic energy.

The equation for work in physics is a critical concept that connects force, distance, and the energy transfer in a system. When a constant force acts on an object in the direction of its movement over a distance, we calculate the work done using the formula W = Fd, where W represents work, F is the force applied parallel to the direction of motion, and d is the distance over which the force is applied. In the case of a force applied at an angle to the direction of movement, the equation incorporates the cosine of the angle between the force and direction of motion, giving us W = Fd cos θ.

The concept is further explored in the work-energy theorem, which states that the work done on an object results in a change in its kinetic energy. This theorem can be expressed as W = 1/2 mv² - 1/2 mv₀², where m is the mass of the object, v is its final velocity, and v₀ is its initial velocity.

I need some help...

The map shows countries where the British Empire had influence and where English is now the official language.

The information on the map shows

A. how well-liked the Spanish language is in today’s world.
B. how influential the United States is in today’s world.
C. how culture can spread by migration, trade, and conquest.
D. how trade is easier between countries that use the same language.

Answers

i think its c how culture can spread by migration, trade, and conquest

The information given in the map shows the how culture can spread by migration, trade, and conquest. Thus the option (C) is correct.

Who were Britishers?

Britishers were the European traders who came from the Britain to do trade in different parts of the world. as the trading was developed in different parts of the country they started to undertake political powers from the foreign countries.

As the British empire grow in the different parts of the world the culture also spread. They started spreading their culture that is westernization of the clothing, spread of the Christianity and usage of the English language.

They setup various schools and imparted English language in it. Thus this is how the culture can spread by migration, trade and conquest. Thus the option (C) is correct.

Learn more about Christianity here:

https://brainly.com/question/3749222

#SPJ2

Waves begin to "feel bottom" when the depth of water is ________. equal to the wavelength equal to its wave base twice as great as the wavelength three times as great as the wavelength

Answers

Answer:

None of the listed options

Explanation:

None of the listed options is right.

The right answer is

Waves began to feel bottom when the depth of the water is "equal to one half of the wavelength"

This is so because;

The speed of a wave and its variation is dependent on the wavelength.

Wave sails at a faster rate, if the wave sails in deeper water.

At this point, the height it reaches will be lower than if it travels at a reduced speed.

In other words, the more the waves move closer in proximity to shallow water, it gradually changes to breaking waves.

As deep-water wave reaches shore, at the point where the depth of the water is one-half of the wave's length, it begins to "feel" the bottom.

Conclusively, whe water is one half of the wavelength of the wave when it approaches the ocean floor. These waves are referred to as shallow-water waves.

So, none of the options above is correct.

What approaches would you use to place a value on sun microsystems?

Answers

There are three aproaches that can be used to place a value on Sun Microsystems. The first approach would be the adding both market capitalization and the debt of the computer company. Second is through the use of multiple analysis based on similar companies. The last approach is by using the discounted cash flow method

Answer:

The best approach I would like to place on sun micro systems is stand alone value and price of devaluation as a best since company can't sustain without these approaches.

How does the value of sinA change as angle A increase and decrease

Answers

Sin A equals the opposite side divided by the hypotenuse. As A increases, towards 90 degrees, sin increases up to a value of 1. For example, sin 35 degrees is 0.57, sin 65 degrees is 0.90 and sin 89 degrees is 0.9998. The best way to visualize this is to draw these approximate angles on paper within the right triangle and see how the hypotenuse and opposite relative lengths change. 

At 3:15 one afternoon, the temperature over the land reaches its highest value for the day- about 89F. The temperature over the adjacent water is about 72 F. What would the expected weather conditions be at this time?

Answers

Storms could be produced in the future as the hot air moving across the water could carry the water vapor high into the atmosphere. Humidity would also be lower than expected if the hot front wasn’t right along the water.

what is the highest point in Canada

Answers

Answer:

Mount Logan

Explanation:

Canada is a country that is roughly divided into several major geographic zones. Some of them are lowlands, while some are mountain ranges. On the eastern part of the country lies the highest point, that being Mount Logan.

Mount Logan has elevation of 5,959 meters. It is the highest peak of Canada, and the second highest on all of the North American continent. Apart from Mount Logan, there are other ten peaks that are also over 5,000 meters of elevation.

The mountain has two large glaciers on it, as apart from being very high, it is also located on very latitude, so it has perfect conditions for development and existence of glaciers.

Final answer:

Mount Logan is the highest point in Canada, standing at 5,959 meters (19,551 feet) and is located in the Yukon Territory.

Explanation:

Highest Point in Canada

The highest point in Canada is Mount Logan, which is located in the Yukon Territory. Mount Logan is part of the Saint Elias Mountain Range and is known for its extreme elevations. It reaches an impressive 5,959 meters (19,551 feet) above sea level, making it the second-highest peak in North America, after Mount Denali in Alaska. The physical geography of Canada is diverse and includes vast open areas, such as the sparsely populated far north that houses only a small fraction of the population. Most Canadians live in regions like Ontario, Quebec, British Columbia, the Prairies, and the Atlantic coast.

Which of these is a main unifying factor for most people who live in south west Asia

Answers

Answer:

Out of the given options, religious affiliation is the main unifying factor for most people living in southwest Asia.

Explanation:

All the countries of the middle east or southwest Asia are predominantly Muslim countries with the worlds highest concentration of Muslim population. In all the countries of the middle east, Islam is the official religion of the states and is backed and promoted by the governments. In countries like Saudi Arabia, it is mandatory for an individual to be Muslim to officially be a citizen of Saudi Arabia.

Pakistan is home to this major river system.
Ganges
Indus
Mekong
Amu
Darya

Answers

The answer to the question above is Indus River.
The Indus River is one of the longest rivers in Asia, which runs through China, India, and Pakistan. It originates from the Tibetan Plateau and ends into the Arabian Sea. It is the national river of Pakistan.
indus
is le answer
,,,,,,,,,,,,,,,,

Process in which water vapor turns directly to a solid

Answers

The reverse of deposition is sublimation and hence sometimes deposition is called desublimation. One example of deposition is the process by which, in sub-freezing air, water vapor changes directly to ice without first becoming a liquid. ... This causes the water vapor to change directly into a solid.
This process is known as deposition and is the opposite of sublimation, hence why it is sometimes called desublimation

5) Which of these BEST explains why Russia might identify as more European than Asian?

Answers

While most of Russia's geographical lands are located in the Asias, the reason why Russia identifies more as European is because:

1) Greater population is located within the European (western side) of Russia.
2) Russia's capital is located in the Western side of Russia.

hope this helps
Final answer:

Russia identifies as more European than Asian due to geographical location in European Russia, historical influence from Europe, and concentration of population in the western part of the country.

Explanation:

Russia's identification as more European than Asian can be attributed to several reasons:

Geography: The western part of Russia, called "European Russia," lies to the west of the Ural Mountains and has historically been influenced by European culture. Many Russians in this region have looked to Europe for inspiration and share a common outlook with Europeans. Major cities like Moscow and St. Petersburg also feature aspects similar to European cities.Historical Influence: Russian leadership, especially Tsar Peter the Great, promoted European ideals and culture, bringing skilled Europeans to Russia. This historical influence has contributed to Russia's affinity towards Europe.Population Distribution: The majority of Russia's population lives in the western part of the country, which is considered European Russia. This concentration further reinforces the connection with Europe.


The gap between the rich and poor in Mexico is largely a result of the _____.

Mexican government’s system of government

subsistence farming practices favored by ejidos

fact that the majority of Mexicans live in urban areas

hacienda system established in the past

Answers

The gap of the rich as well as the poor in the country Mexico is a result of the gap then between the rich as well as the poor in the country is because of the hierarchy in Mexico or in the option it would be of the hacienda system in the past.

The gap between the rich and poor in Mexico is largely a result of the _____.

  hacienda system established in the past

Plz help will mark brainliest.

Which of the following bescribes how DNA provides evidence to suggest that life changes over time?

A. Some animals exhibit similar structures, possibly due to a comman ancestor.

B. Some animals exhibit similar stages of embryonic development.

C. Some animals exhibit structures that are no longer used for any purpose.

D. Some animals exhibit similar biological proteins.

Answers

i believe the answer is A, but Im not 100% I hope this helps!

Answer:

The statement that best describes how DNA provides evidence to suggest that life changes over time is the one that states some animals exhibit similar biological proteins.

Explanation:

Animals of the different genus possess different biological proteins. Earlier in the past, the various genus of animals and other species that are existent today in large families made up of numerous species in a single genus were small genus families with only a few species in them. Later, these families evolved to have various other species in the genus developed from the already existing species. These species shared similar biological proteins in their DNAs and proved that life changes over time.

Arrange the events involved in nuclear fusion in the correct order.
Tiles
The colliding nuclei fuse to form larger helium atoms having two protons and two neutrons.

Bare nuclei collide with each other due to massive amounts of heat.

The pressure of hydrogen gas increases, and the gas reaches extreme temperatures.

Hydrogen atoms shed their electrons.



Answers

3, 4, 2, 1
________________

Answer:

3 4 2 1

Explanation:

already did it

Where have neandertal skeletal remains not been found?
a. israel
b. france
c. iraq
d. germany
e. java?

Answers

The correct answer is e. Java.
All of the Neanderthal skeletal remains that are found so far are from Europe and the Middle East (Western Asia). Java is an Indonesian island in Southeast Asia, and in here there's no evidence found of Neanderthals living in this part of the world, nor anywhere in close proximity.

The Democratic Republic of the Congo has not become the economic giant that was thought possible because of its _____.

inability to use its natural resources
decades of political and economic trouble
lack of nonrenewable natural resources
lack of a large urban center

Answers


They can maintain a government. They get raided by neighboring countries. They have ridiculous resources... Which is why they were constantly colonized. D is my answer.
decades of political and economic trouble
Other Questions
Predict where the Katydid would hide from danger? Draw a picture of what you predict, help please The Silk Road was discovered by __________. A. Marco Polo B. Genghis Khan C. General Zhang Qian D. Kublai Khan Calcium carbonate reacts with hydrobromic acid to form calcium bromide, carbon dioxide, and water according to the reaction below. what is the molarity of the hydrobromic acid if 250.0 ml of it reacts with 5.64 grams of calcium carbonate? Explain why the equation (x-4)^2-10=15 has two solutions. Then solve the equation to find the solutions. Please show all your work! (30 points) A standard number cube with the numbers 1 through 6 is rolled. Find the probability of rolling a number greater than 5 .1. 1 / 62. 1 / 33. 1 / 44. 2 / 3 If a = 0.3 with a line over 3 and b = 0.5 with a line over 5, what is the value of a + b?8/108/988/10080/99 75 points Write and solve an equation to find the measure of NEP. Make sure you show all work. A ladder leans against a building. The angle of elevation of the ladder is 70. The top of the ladder is 25 ft from the ground. To the nearest tenth of a foot, how far from the building is the base of the ladder?20.5 ft30.5 ft32.3 ft39.5 ft Three positions of praying mentioned in the Old Testament are:kneeling and sittingkneeling, standing, and falling face downstanding and sittingkneeling, sitting, and lying on one's side Andrew drove 55 mph on his trip. Which of the following equations best represents the distance he drove if x stands for the number of hours? Two people start walking at the same time in the same direction. One person walks at 8 mph and the other person walks at 2 mph. In how many hours will they be 4.5 miles apart? Rowland and molina's work showed that ultraviolet light in the stratosphere causes cfcs to release ________ atoms. Why is this cover letter inappropriate? Genetic disorders caused by multiple genes interacting with the environment are called Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? view available hint(s) where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? it would not bind the target dna. ttttagccatttacgattaatcg ttttagccatttacgattaatcg ttttagccatttacgattaatcg? Find the product.y 4 y 6 Identify a management practice most conducive to the traditional personality. Use the net to find the approximate surface area of the cylinder to the nearest square meter Harry is a healthy man who is 30 years of age. using this information, calculate his approximate target heart rate zone for moderate-intensity physical activity. Speciation may occur when two populations become reproductively isolated from each other