Analyze continuity and change in the response of native peoples to imperialism in Sub-Saharan Africa between 1750 and 1900.

Answers

Answer 1
There was a political change when legal slave trade ended last 1807. However, although it has been declared to a stop, Africa still has some companies that trade slaves. It was used in the new imperialism as a labor force for massive production of raw materials needed on industrialization. Still, there is continuity of slave labor force.
Answer 2
Continuity-- warring tribes and leaders of the tribes fought Western influence from entering into their tribes and kingdoms. This continued a tradition of elite men protecting their tribes and ways of life as they would with any other outside threat. 

Change-- Europeans brought in religion and education as well as technology and use their culture to flip the social hierarchy. Those who were low in the tribal social structure were given privilege in the European structure because it didn't' require strength or heredity. Therefore the support for European culture came from lowly people in the tribal structure which created change in the culture of the tribes. Laws were created that stripped the tribal elite of their power leaving them defenseless against the changes. 

Related Questions

What was the name of the man, who led the 1791 revolt in Haiti?
A) Simón Bolívar
B)Toussaint L’Ouverture
C) Miguel Hidalgo
D) P.J. Laborie

Answers

The answers is variant B

B) Toussaint L' Ouverture


The strength and fierce attributes of warrior women in mythology and folklore had an effect on the societies of the ancient greeks, norse, and celts. in fact, viking women (the historical counterparts of the norse mythological figures) were even allowed to divorce their husbands under certain circumstances. what were these circumstances?

Answers

The correct answer is the following.

A Viking woman was allowed to divorce if her husband if he mistreated the wife, if he mistreated his children, if he was not a good provider, and if he insulted her family.

The circumstances under Viking women were allowed to divorce were: A Viking woman was allowed to divorce if her husband if he mistreated the wife, if he mistreated his children, if he was not a good provider, and if he insulted her family.

Viking women were an important member of the family of the Vikings in Norse society. They were the one in charge of the family, the house, the chores, and farming while the husbands were on war. They were strong women that stand by their ferocious Warriors and were a key element in Norse tribes.  

The importance India has placed on gains in labor and service jobs creation is because India can A) compete because fewer people in India need entry level jobs. B) compete with higher wages than wages in nations such as Mexico and Canada. C) ship most of their job to other nations such as China and the United States. D) compete with lower wages than wages in nations such as Canada and the United States.

Answers

Answer:

D) compete with lower wages than wages in nations such as Canada and the United States.

Explanation:

The importance India has placed on gains in labor and service jobs creation is because India can compete with lower wages than wages in nations such as Canada and the United States.

What are  wages?

A wage is money paid to an employee by their employer for labor completed over a certain amount of time.

Wage payments include remunerative payments like rewards and tip payouts as well as compensation payments like the minimum wage, prevailing wage, and annual bonuses.

Wages are a component of the costs associated with operating a business. Regardless of the company's prosperity, it is a duty to the employee.

Payment by wage is in contrast to salaried work, which is paid by the employer an agreed-upon sum at regular intervals regardless of the number of hours worked, commission-based pay, which is contingent on individual performance, and compensation based on the success of the firm as a whole.

Learn more about wages, here

https://brainly.com/question/13847060

#SPJ6

How does ponyboy feel about fighting ? How do the other greasers feel about it

Answers

In the book, it states that the other greasers each have their own reasons for fighting. Either for fun or as an outlet. Ponyboy doesn't seem to enjoy the violence but he doesn't shy away from it. He doesn't take pride or joy from it, while the other greasers do. 
Ponyboy does not have a good reason to fight. Therefore he goes to each of the greasers to ask them their individual reasons for fighting in the rumble. In the end, Ponyboy can only think of one reason for fighting and that is self-defense.

What type of map would you use to find the elevation of an area? climate map physical map political map topographic map

Answers

topographic map to find the elevation of an area

Match these items. 1. negate, destroy Article III of the Constitution 2. guideline document in judicial review statutory construction 3. chosen, appointed president 4. head of Armed Forces U.S. Constitution 5. interprets the meaning of laws and administrative rules and regulations nullify 6. gives power to the judicial system of courts nominated

Answers

1. negate, destroy-----------nullify


Negate is a term that alludes to preventing an activity from being performed effectively or invalidating a card impact. Activities that can be nullified incorporate card and impact enactments, Summons, and assaults.  

While the vast majority of these activities can be ceased from "effectively" happening generally, just an impact that particularly states "negate" will make them be discredited.  

Regardless of whether any of these activities are refuted, the expense, or ideal to re-try it, isn't discounted to the holder of that invalidated activity.  

2. guideline document in judicial review----------U.S. Constitution


A constitution is an arrangement of fundamental standards or built up points of reference as per which a state or other association is represented.  

The Constitution of the United States built up America's national government and crucial laws, and ensured certain essential rights for its subjects. It was marked on September 17, 1787, by agents to the Constitutional Convention in Philadelphia. Under America's first administering report, the Articles of Confederation, the national government was powerless and states worked like autonomous nations.


3. chosen, appointed---------nominated  


Nomination  is a piece of the way toward choosing a candidate for either decision to an open office, or the offering of a respect or honor. An accumulation of chosen people limited from the full rundown of competitors is a short rundown.  

Elected candidate implies hopeful who chosen by decision process or picked by vote. Nominated candidate implies a part who picked by head of state by help and counsel.  


4. head of Armed Forces-------president  


The United States Armed Forces are the military powers of the United States of America. It comprises of the Army, Marine Corps, Navy, Air Force, and Coast Guard. The President of the United States is the Commander-in-Chief of the U.S. Military and structures military strategy with the U.S. Department of Defense (DoD) and U.S. Department of Homeland Security (DHS), both government official divisions, going about as the important organs by which military strategy is completed. Each of the five equipped administrations are among the seven formally dressed administrations of the United States.


5. interprets the meaning of laws and administrative rules and regulations---------statutory construction


Statutory Construction refers to the way toward figuring out what a specific rule implies with the goal that a court may apply it precisely.  

Any inquiry of statutory understanding starts with taking a gander at the plain dialect of the rule to find its unique goal. To find a rule's unique purpose, courts first look to the expressions of the rule and apply their standard and customary implications.  


6. gives power to the judicial system of courts--------Article III of the Constitution


Article Three of the United States Constitution sets up the legal part of the central government. The legal branch contains the Supreme Court of the United States and lower courts as made by Congress.  

Article 3 of the United States Constitution is the area that makes the legal branch in the United States. The Judicial branch is the arrangement of courts that take a gander at the law and applies it to various cases. In the United States, the legal part of the government incorporates the United States Supreme Court and all the lower courts that are made by Congress.

Answer:

1. Negate destroy: nullify

2. Guidline document in judicial review: US Costitution

3. Chosen appointed: Nominated

4. Head of Armed Forces: President

5. Interprets the meaning of laws and administrative rules and regulations

6. nullify:statutory construction

7. gives power to the judicial system of courts: Article III of the Constitution

How did James Monroe and Robert Livingston affect Jefferson's presidency? They ended the attacks of the Barbury pirates. They arranged the purchase of the Louisiana Territory. Both explored the Louisiana Territory.

Answers

The answer is that they arranged the purchase of the Louisiana Territory. The Americans thought that Napoleon might withdraw the offer at any time, preventing the United States from acquiring New Orleans, so they agreed and signed the Louisiana Purchase Treaty on April 30, 1803. Through this deal, it doubled the size of the United States

They arranged the purchase of the Louisiana Territory.

Which of the following was NOT a contribution of ancient Indian civilization?
A. The Vedas
B. The invention of gunpowder
C. Wrought-iron pillars
D. The mathematical value of pi

Answers

B
The invention of gun powder.
The powder was discovered in China.

Answer: B. The invention of gunpowder

Explanation:

Gunpowder was invented in China. It had been used by the Taoists for medicinal practices since the 9th-century, until around 904 AD, when it was first used for warfare.

The Vedas are ancient Indian religious texts written in around 1500 and 1000 BCE.

The Iron Pillar of Delhi was crafted using forge welding and was made of wrought iron.

The exact value of pi was found due to major contributions made by Indian mathematicians Madhava and Aryabhata.

Which of the following accurately summarizes the Cold War?





A

The Great Depression of the 1930s



B

A forty year standoff, arms, and space race between the U.S. and Russia (Soviet Union)



C

World War II was often called the Cold War, because it was fought in cold areas.



D

A two month standoff between Poland and France that never actually results in war

arizes the Cold War?

Answers

your answer is A forty year standoff, arms, and space race between the U.S. and Russia (Soviet Union) 

In order to raise the GDP per capita, the United Arab Emirates (UAE) has been

Answers

Diversifying its economy.

Oil has long been the primary economic engine of the United Arab Emirates economy.  But the UAE has been promoting tourism and developing other industries, in an effort to have a more balanced overall economic picture.

According to Forbes Magazine listings for 2017, the gross domestic product (GDP) per capita of the UAE is $37,600.   This compares to a GDP per capita of $57,500 for the United States.

in what ways did McCarthyism intensify tensions within the United States during the Cold War

Answers

McCarthyism helped increase tension within the US, because during the Cold War, the US (democracy) was fighting against the USSR (communism). The US did not want communists to spread into the US, for fear that they may be infiltrated and defeated that way. McCarthyism came into play when Senator Joseph McCarthy pretended that he had a list of 'well-known' communists or communist supporters inside the government, and that they had to eradicate them from the system. This soon turned to an outbreak of accusation, as many people started to blame each other of helping the communists. This led to the US further developing ways to hinder the spread of Communism, and for them to start to both protect other countries from communism, and to free other countries from the 'unjust government'. This led to an escalation in the war effort, and with this, the arms race grew exponentially.


hope this helps

Answer:

Explanation:

McCarthyism helped increase tension within the US, because during the Cold War, the US (democracy) was fighting against the USSR (communism). The US did not want communists to spread into the US, for fear that they may be infiltrated and defeated that way. McCarthyism came into play when Senator Joseph McCarthy pretended that he had a list of 'well-known' communists or communist supporters inside the government, and that they had to eradicate them from the system. This soon turned to an outbreak of accusation, as many people started to blame each other of helping the communists. This led to the US further developing ways to hinder the spread of Communism, and for them to start to both protect other countries from communism, and to free other countries from the 'unjust government'. This led to an escalation in the war effort, and with this, the arms race grew exponentially.

what did the british north america act accomplish? it divided Canada. Canada became an independent nation. Canada was no longer subject to British rule. Canada became self-governing.

Answers

Why ask the question just to self explain it?

Final answer:

The British North America Act accomplished several things for Canada, including joining the colonies in the Dominion of Canada and establishing self-governance. However, it did not make Canada fully independent from British rule.

Explanation:

The British North America Act, passed in 1867, accomplished several things for Canada. It joined the colonies of Nova Scotia, New Brunswick, and the Province of Canada in the Dominion of Canada, which had the right to govern itself. However, Canada remained within the British Empire with Queen Victoria as its head of state. The act also established Canada as a self-governing country, but it did not make Canada completely independent from British rule.

How is the modern era different from the post classical era ?

Answers

Your answer would be 

A



hope this helps.

Answer: A. In the postclassical era, the world's most powerful states were in in Asia and the Middle East. In the modern era, power shifted to Eurasia.

Explanation:

During the Post-Classical era (600 CE to 1450 CE), areas previously under control of the Empires underwent an economic decline.  The fall of Rome brought new possibilities in the Middle East, and Arabs regain control over areas under Roman rule.

During the Early Modern (1450-1750) and the Modern era (1750-1900), Eurasia had the most powerful states, changing the power distribution.

how are members of congress influenced by outside forces

Answers

Political Parties and Third Parties try to influence congress by expressing their ideas of what should be done for the welfare of whatever they believe in and by choosing a member of the group to run for president to even further expand their success in the belief they hold on to.

Which statement best describes the setting of President Kennedy’s assassination?

Answers

What are the questions?
He was killed during the inauguration

Identify the characteristics of each system that Europeans established in the Americas.

Answers

Final answer:

European colonization led to systems like Spain's Encomienda System and the institution of slavery in the Americas, transforming agricultural practices with crops like tobacco and cotton. The Columbian Exchange brought cultural and economic changes, while European diseases significantly decimated indigenous populations.

Explanation:

The period of European colonization profoundly affected the Americas, which saw the establishment of various systems that shaped the new societies and dictated the interactions between Europeans and Native Americans. Spain's Encomienda System was one such example, wherein indigenous people were subjected to forced labor in exchange for purported protection and Christianization. This system was characterized by exploitation and severe impact on indigenous communities.

As the colonization efforts expanded, European influences became apparent in agriculture, with crops like tobacco and cotton altering the landscape and economy. These changes necessitated a massive labor force, leading to the establishment of slavery as an institution in the Americas. Slavery was racially based, with Africans being brought in large numbers to work on plantations, impacting the social and cultural fabric of the societies.

Interchanges such as the Columbian Exchange altered the culture and economies globally, while European diseases decimated indigenous populations. The spread of European culture and its dominance were also reflected in the arts, where a European influence began to pervade, often at the cost of the erasure of indigenous artistic expressions.

Which of the following was one of President Wilson's intended outcomes of the Great War?
a reduction of arms and weapons by all of the world's countries
new American colonies in Africa
an overthrow of the Communist government in Russia
a revengeful, punishing peace for Germany

Answers

A reduction of arms and weapons by all of the world's countries.

President Wilson's intended outcomes of the Great War was a reduction of arms and weapons by all of the world's countries. The appropriate response is option A.


What were the contributions of
President Wilson?

The Progressive Movement's leader and the 28th President of the United States was Woodrow Wilson. Wilson brought America into the war to "make the world safe for democracy" following a neutral stance at the start of World War I.

He enacted a significant antitrust law, started the current income tax, founded the Federal Reserve, and steered the country to victory in World War I.

Wilson called for the abolishment of secret treaties, a decrease in armaments, an adjustment in colonial claims in the interests of both native peoples and colonists, and freedom of the seas in order to immediately address what he saw to be the causes of the world war.

Hence, Option A is an appropriate response.

To learn more about Woodrow Wilson

https://brainly.com/question/9541519

#SPJ6

Use the diagram to answer the following question:

Roman Government

Senate and assemblies create legislation.
Consuls enact legislation.
Praetors interpret legislation.

What democratic principle does this diagram reflect? (4 points)



All citizens are subject to the law.

Different bodies have separate roles.

Equality in tasks is important in the Republic.

Freedom of speech differed from group to group.

Answers

Correct answer:

Equality in tasks is important in the Republic.

The Roman Senate: the power of the Senate expanded over time as the power of legislative assemblies diminished and, finally, the Senate took a more important role in the creation of civil laws.

Consuls: led the army, convened and presided over the Senate and popular assemblies and executed their decrees, and represented the state in foreign affairs.

Praetors: a judicial officer who had broad authority in cases of equity, was responsible for the production of public games and, in the absence of consuls, exercised broad authority in government.

Answer: I would go with C/ Equality in tasks is important in the Republic.

Explanation: I read about this in my lesson and im taking the test right now so im pretty sure this is answer<3

Hope this helps >_<!!

Conservatives are often considered to be the “left” of the political spectrum, while liberals are considered to be “right” of the political center. Please select the best answer from the choices provided T F

Answers

The correct answer is "false". In most of the cases, most dictionaries and most part of the political analysis of the world, it is considered the opposite. Conservatives are often considered to be the “right” of the political spectrum, while liberals are considered to be “left” of the political center.

Answer:F

Explanation: Hope this helps :D :)

The waterway that was created in Latin America which helped America shorten the transport time from the East to West coast is called the _? a Mexican Canal b Panama Canal c Suez Canal d Erie Canal

Answers

Hi! Your correct answer is,

B) Panama Canal

Hope I helped, tell me if I'm wrong!

1. In a short paragraph, explain why most colonists had a positive attitude toward Britain in 1763. Give at least two reasons. Type your answer here.

Answers

One reason is the policy of salutary neglect. Salutary neglect was a policy of Britain which basically meant that the colonies didn't have to follow all the British laws as long as they didn't cause any problems. People were satisfied with ti because they weren't bothered by Britain. When the French-Indian war ended, the policy of salutary neglect was abandoned and the crown started pressuring people more to obey the laws and this caused mass dissatisfaction.

Another is the political power that they had. Before 1763, they were allowed to purchase land and deal with the natives in such purchases and if they were rich enough they could even start their own colonies as governors or rule their own colony as a company. This was forbidden after 1763 and all governing started belonging to the British crown exclusively.

The reason why most of the colonists had a positive attitude was because of them being British themselves. Also because they had just helped the British win the French and Indian war. yes this is correct change it up though if you are going to use it

1. President of the Confederacy David Farragut 2. killed by one of his own men P.G.T. Beauregard 3. crossed Confederate lines to capture New Orleans "Stonewall" Jackson 4. proposed a compromise that was rejected Jefferson Davis 5. Lincoln's Vice President for his second term General George Meade 6. trained his troops thoroughly Alexander Stephens 7. stationed at Fort Sumter at the beginning of war Andrew Johnson 8. Confederate Vice President Robert Anderson 9. met and defeated Robert E. Lee at the battle of Gettysburg John J. Crittenden 10. Confederate general at first battle of Bull Run George B. McClellan

Answers

1. President of the Confederacy: Jefferson Davis. Jefferson Davis was the first and only president of the Confederate states which attempted to break away from the Union leading to the civil war. He served as Secretary of War under Franklin Pierce prior.

2. Killed by one of his own men: Stonewall Jackson. Jackson served as the commanding Confederate general who earned the nickname Stonewall Jackson after driving back a strong Union assault on a Confederate position. He was accidentally shot by one of his own men in 1863 and died several days later.

3. Crossed Confederate lines to capture New Orleans: David Farragut. Farragut was a Naval officer for the Union assigned to capture New Orleans, which he successfully did in 1862 and helped the Union control the Mississippi River during the Civil War.

4. Proposed a compromise that was rejected: John J. Crittenden. Crittenden was a politician who before the Civil War, unsuccessfully proposed a compromise known as the Crittenden Compromise in 1860 to ease tensions between the North and South by expanding the slave state line all the way to the pacific.

5. Lincoln's vice president for his second term: Andrew Johnson. Andrew Johnson served as Lincoln's vice president before he rose to become president after Lincoln's infamous assassination.

6. Trained his troops thoroughly: Robert E Lee. Robert E Lee was one of the greatest generals in American history, winning most battles against a much larger Union army through successful mobilization and organization of his armies. He often used aggressive approaches to fighting, and unsuccessfully invaded the North twice.

7. Stationed at Fort Sumter at the beginning of the war: Robert Anderson. Anderson was a Union general who commanded Northern forces at Fort Sumter which saw the Confederacy capture the fort and its facilities from the North and lead to the start of the Civil War.

8. Confederate Vice President: Alexander Stephens served as the Vice President to Jefferson Davis in the Confederate states. Stephens was an advocate for expanding slavery into other territories and after the war, served as the Governor of Georgia.

9. Met and defeated Robert E Lee at the battle of Gettysburg: General George Meade. Meade was a commanding officer for the Union who previously served in the Mexican-American war. He earned his reputation after stopping Lee's invasion of the north at Gettysburg which became the bloodiest battle of the Civil War.

10. Confederate general at first battle of Bull Run: P.G.T. Beauregard. Beauregard commanded Confederate soldiers at first battle of Bull Run, successfully driving back Union soldiers were marching to Richmond to try and bring a premature ending the Confederacy at the start of the war.

Answer:

Correct matches below.

Explanation:

Jefferson Davis - Confederate president

"Stonewall" Jackson - killed by one of his own men

David Farragut - crossed Confederate lines to capture New Orleans

John J. (Or Joseph) Crittenden - proposed a compromise that was rejected

Andrew Johnson - Lincoln's vice president for his 2nd term

George McClellan - trained his troops thoroughly

Robert Anderson - stationed at Fort Sumter at the beginning of war

Alexander Stephens - Confederate vice president

George Meade - met & defeated Robert E. Lee at Gettysburg

P.G.T Beauregard - Confederate general at first battle of Bull Run

Hope it helps.

To what extent was industrialization responsible for the deplorable conditions of the cities in the early nineteenth century?

Answers

Because there was a revolution , there was huge gap between the social hierarchy in which there were lots more poor and rich people

Which empire was the largest? Select the best answer to the questions below from the choices provided. The Akkadian Empire The Assyrian Empire The Persian Empire The Babylonian Empire

Answers

The Persian Empire is the largest out of the options. It was larger than any previous empire and included modern day countries such as Iran, Afghanistan, Turkey, Iraq, Syria, Egypt, parts of Greece, and most of the near east. It successfully created a governmental administration by which road systems, organized civil systems, and an highly organized army allowed the civilization to flourish  from 550 BCE until 330 BCE.

The president can influence the supreme court by

Answers

The president has some influence over the supreme court, but only to an extent. As previously stated he nominates people to the supreme court, but this in turn is checked by the legislative function in the government so his influence is small here if anything....

The president can influence the Supreme Court through nominations, the involvement of the Solicitor General, submission of amicus curiae briefs, and public statements, shaping the judiciary long-term.

The president can influence the Supreme Court by several means, ensuring their lasting impact on the judiciary:

Nominations: The president nominates justices to the Supreme Court, subject to Senate approval. These appointments can shape the Court’s decisions for decades, given the lifetime tenure of justices.Solicitor General's involvement: The Solicitor General, representing the federal government, can influence the Court by presenting arguments and perspectives on cases.Amicus curiae briefs: The president can direct the submission of "friend of the court" briefs in cases where the government is not a party, thereby swaying judicial opinions through legal arguments.Public statements and pressure: Presidents may publicly criticize or support specific decisions, potentially influencing public opinion and judicial perspectives.

For instance, President Franklin D. Roosevelt's 1937 "court-packing scheme" aimed to add more justices aligned with his views, though it was never enacted.

explain why Eliza couldn't keep her family together

Answers

because maybe the police or the goverment orderd the policemen to seperate them

What was the name given to the government practice of borrowing money to spend more than is collected in taxes

Answers

The key word to answer this question would be ''deficit spending''.

-Love, live, and watch anime.

deficient spending is your answer

Deficient spending is when the government spends more than they earn (through taxes, bonds, etc.). This leads to a term called "national debt"


hope this helps

Which best describes the type of government England had in the period before Restoration?

theocratic
foreign dictatorship
absolutist
military dictatorship

Answers

D. military dictatorship

correct answer

The best description of the type of government England had in the period before the Restoration (which refers to the period before the English monarchy was restored in 1660 after the English Civil War and the rule of Oliver Cromwell) is Absolutist. The correct option is (C).

During this period, particularly under the rule of the Stuart monarchs (such as James I and Charles I), there were efforts to establish absolute monarchy, where the king had significant, often unchecked, powers and authority. This led to disputes between the monarchy and Parliament, contributing to the tensions that eventually culminated in the English Civil War and the subsequent Restoration. While it was not an absolute monarchy in the same sense as some other European countries, England experienced a struggle between royal absolutism and parliamentary authority during this time

Stuart Monarchs: The Stuart dynasty ruled England during this time, and several of these monarchs sought to centralize power and authority in the monarchy, diminishing the role and influence of Parliament.

Divine Right of Kings: The Stuart monarchs promoted the concept of the divine right of kings, which asserted that the king's authority was granted by God and was not subject to questioning or limitations by any earthly authority, including Parliament.

To learn more about Absolutist:

https://brainly.com/question/35871664

#SPJ12

Nigeria's president elected by "direct election." This means that A) the "electoral college" determines the winner. B) the winner receives a majority of the popular vote. C) the legislative branch has to determine the winner. D) the winning candidate must receive 75% of the vote.

Answers

Answer:

B) the winner receives a majority of the popular vote.

Explanation:

In the United States, the president of the country is chosen in an indirect way. He is chosen based on a combination of popular votes and the electoral vote. However, many other presidential systems do not have an Electoral College. This is the case in Nigeria. In this country, the president is elected by "direct election." This means that the winner of the elections is the person who receives a majority of the popular vote.

What is the question posed in Beloved?

Answers

How is your beloved more than any other beloved, most beautiful among women?

"The question posed in  Beloved  by Toni Morrison is not a single, straightforward question but rather a complex exploration of the enduring psychological and emotional impact of slavery on individuals and communities.

The novel delves into themes such as the nature of love, the trauma of loss, the struggle for identity, and the process of healing. One of the central questions could be framed as: How do individuals and a society cope with the legacy of slavery and the haunting presence of its past?

Set in the post-Civil War era,  Beloved  revolves around the character Sethe, a former slave who is haunted by her past, particularly the decision she made to kill her daughter to prevent her from being returned to a life of slavery. The novel grapples with questions such as:

- What are the moral and ethical implications of Sethe's actions, and can they be understood or forgiven within the context of the horrors she experienced as a slave?

- How does the past continue to affect the present, manifesting in the form of guilt, grief, and trauma?

- In what ways can individuals find redemption and move forward after experiencing such profound pain and loss?

- What does it mean to be truly free, and how can one reclaim a sense of self and humanity after being dehumanized by the institution of slavery?

Through the character of Beloved, who represents both Sethe's deceased daughter and the collective spirit of all those lost to the violence of slavery, the novel asks readers to consider the ways in which the past can be acknowledged, remembered, and perhaps reconciled. The question posed in  Beloved  is ultimately a meditation on the human capacity for resilience and the power of love and memory in the face of unspeakable tragedy."

Other Questions
how does an artist create fine lines in an etchingA. drawing whith a pencilB. soaking carving in an acid bathC. rearranging he movable typeD. using a brayer and ink, which conclusion is best supported by Daniels observations and discoveries What type of conflict describes a struggle between characters? A. Man versus man B. Man versus self C. Man versus society D. Man versus personality which of the following is the best definition of three-dimensional drawing? A.a three-dimensional drawing represents, on a three-dimensional plane, the length and width of a solid figure.B. a three-dimensional drawing uses graph paper to show the length and width of a solid figure in such a way that it looks realistic.C. a three-dimensional drawing represents on a two-dimensional plane the length, width, and depth of a three-dimensional figure.D. a three-dimensional drawing uses at least one vanishing point to create the illusion of width. What happened to American life as a result of new technology in the late twentieth century?A.Americans could purchase cars for the first time.B.Americans could shop at home on the Internet.C.Americans could see movies in theaters.D.Americans could fly on airplanes. The sum of two angles in a triangle totals 117 degrees, what is the measure of the third angle What types of anthropologists explore all aspects of living human culturefrom war and violence to love, sexuality, and child rearingand look at the meanings that people from all over the world place on these things? Read this excerpt from "Goodbye to All That" by Joan Didion.We stayed ten days, and then we took an afternoon flight back to Los Angeles, and on the way home from the airport that night I could see the moon on the Pacific and smell jasmine all around and we both knew that there was no longer any point in keeping the apartment we still kept in New York.Which statement best explains how the imagery in the excerpt affects the meaning of the text?It highlights the isolation and loneliness of life in Los Angeles, demonstrating that Didion faces the same problems there that she faced in New York.It captures the beauty and serenity of life in Los Angeles, suggesting why Didion feels more content living there than she did in New York.It provides an unrealistic and idealized impression of Los Angeles, showing that Didion has not changed at all.It depicts the dark and mysterious atmosphere of Los Angeles, indicating why Didion is drawn to this new, exciting city. What is the equation, in slope-intercept form, of the line that is perpendicular to the line y 4 = 2/3(x 6) and passes through the point (2, 2)? y = 2/3x 10/3 y = 2/3x +10/3 y = 3/2x 1 y = 3/2x + 1 Your gross pay on your paycheck is $400. your deductions are as follows: federal income tax - $50.00 state income tax - $20.00 social security tax - $7.00 medicare tax - $3.50 please calculate your net pay (in dollars). question 2 options: Which statement accurately describe the role of decomposers in the carbon cycle? When parking downhill on a road with a curb, you should turn your front wheels __________ .A. parallel to the curbB. towards the curbC. towards the street Which of the following terms describes the primary core of a comet? two cards are drawn without replacement from a standard deck of 52 playing cards. find the probability that both are odd numbers (aces are considered odd because they have a value of 1 or 11). 14) Which BEST describes the way the Fourteenth Amendment affected the states?A)States had to give all citizens, regardless of their race or religion, equal protection under the law.B)States could no longer make any laws that were not approved by the federal government.C)States had to pass laws that gave more rights to freed slaves than to other citizens.D)States could no longer institute poll taxes or tests for citizens before they voted.2) The term "Reconstruction" in United States history refers to the period after what event?A)the Civil WarB)the Revolutionary WarC)the Constitutional ConventionD)the Declaration of Independence The major problem with hydrogen as an alternative source of energy is that none exists on the surface of the earth. a. True b. False Analyze the following statement: Marcus notices that he runs faster in the mornings rather than the evenings. Is the statement an example of correlation or causation? A. Correlation, because time of day doesn't cause a person to run faster or slower B. Causation, because Marcus has noticed this over several trials C. No relationship, because time of day has nothing to do with how fast a person runs D.There is not enough information to make a conclusion Which head glands secrete sucrase, lipase, amylase, and invertase? What is the measure of an angle that turns through 3/4 of a complete circle What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatctcatccagcattctgaaagggtaatgaataattattccgctgagttcatgaggtatccgaaggaggagcaacacttaggctataagagtatcatgcacatagatcgggataaatcgcctatcatatgtgacaacaatttcatgattaaaagt code for?