Because plants don’t have interior or exterior skeletons they rely on their cells walls to give them support . Did you see evidence of the cells structure in plants ? How was it different from animal cells

Answers

Answer 1

Answer:

Plant cells have cell walls and this is how they differ from animal cells because animal cells do not have cell walls. Animals don't need cell walls because they have skeletons that help stabilize their bodies. The cell wall provides structure and strength to the cell. I saw evidence once when I was in a biology class.

Answer 2

I did see evidence of the cell structure in plants. Plant cells have a cell wall, which is a rigid structure that surrounds the cell membrane.

How are plant and animal cells different ?

The cell wall is made up of cellulose, a complex carbohydrate that gives plants their strength and rigidity. Animal cells do not have cell walls. The cell wall provides support and protection for the cell.

Plant cells have chloroplasts, which are organelles that contain chlorophyll. Chlorophyll is a green pigment that helps plants to photosynthesize. Animal cells do not have chloroplasts. Plant cells have a large central vacuole, which stores water and other nutrients. Animal cells do not have a central vacuole.

Find out more on animal cells at https://brainly.com/question/913732

#SPJ3


Related Questions

Which of the following processes enables cells to stay within the limited range of conditions in which they function best? a biodiversity b metabolism c adaptation d homeostasis

Answers

Answer:

D. Homeostasis

Explanation:

Homeostasis is the internal equilibrium maintained by the cells. If the homeostasis gets disturbed than diseases might occur. The cells maintain its equilibrium throughout the body. With the change in the external environment, the cells also adjusts itself to maintain its stability inside the body.

For example - at higher altitude, the oxygen concentration of the environment is less and to compensate the low oxygen content in the atmosphere, the number of red blood cell inside the body increases.

2. Which of the following is NOT a clue that a chemical change has occurred? (1 point)

change in color

production of a gas

formation of a precipitate

change in shape

Answers

Answer:

D. Change in shape

Explanation:

Change in shape is the physical property of the substance. Chemical change of the compound is observed during a chemical reaction. Change in colour, production of the gas, formation of a precipitate are the examples of chemical change and can be sensed easily.

Vapour pressure, boiling point, density and shape are the examples of physical properties of compounds. Chemical change also leads to change in texture of the compound. A compound has both physical and chemical properties and its chemical reaction is enhanced by the catalyst.

Why is wafting chemicals important?

Answers

It is very important to not inhale chemicals because when strong acids and bases get into your lungs, they mix with the water in your lungs and can cause burns. Your lungs are sensitive to many chemicals because the alveoli sacs are on one cell layer thick.

Even though they say you can waft, it is really not good to even do that if it has any toxicity. Carcinogenic means something that can give you cancer, but it does not harm you right away, same thing with chemicals.

Lead for example is sweet, but toxic. The Romans used to flavor their food with lead compounds. If there is any doubt read a Material Safety Data Sheet! It will tell how it is toxic and what is is safe for.

Answer:

It is very important to not inhale chemicals because when strong acids and bases get into your lungs, they mix with the water in your lungs and can cause burns. Your lungs are sensitive to many chemicals because the alveoli sacs are on one cell layer thick.

What is the difference between ecosystem Services and natural resources​

Answers

Ecosystem services are the flows of benefits which people gain from natural ecosystems

Natural Resources are materials or substances that occur in nature and can be used for economic gain.

Final answer:

Natural resources are physical substances or objects in nature that we find useful in their raw form, like water or minerals. Ecosystem services, on the other hand, are benefits humans directly and indirectly receive from ecosystems, focusing more on the functions that support life and well-being.

Explanation:

The difference between ecosystem services and natural resources largely lies in how they are used and perceived in regard to human benefit. Natural resources refer to substances or objects in nature that humans find useful in its raw form. This includes things like water, soil, minerals, and trees.

On the other hand, ecosystem services refer to the benefits that humans receive from ecosystems directly or indirectly. They are usually categorized into four main types: provisioning services (such as the production of food and water), regulating services (like control of climate and disease), supporting services (like nutrient cycles and crop pollination), and cultural services (such recreational and spiritual benefits).

Therefore, while natural resources focus more on the physical products we can extract and use, ecosystem services place emphasis on the functions of ecosystems that support life and human well-being.

Learn more about Ecosystem Services vs Natural Resources here:

https://brainly.com/question/17362413

#SPJ6

An enzyme is a protein that____

Answers

Final answer:

An enzyme is a protein that accelerates a specific chemical reaction within a cell by reducing the activation energy. Each enzyme is specific to certain substrates and doesn't alter the free energy of the reactants or products, but merely makes the bond breaking and forming processes happen more readily.

Explanation:

An enzyme is a protein that substantially speeds up the rate of a specific chemical reaction within the cell by lowering the activation energy. Each enzyme is highly specific, only acting on certain substrates to either break them down (catabolic enzymes), build more complex molecules (anabolic enzymes), or affect the rate of reaction (catalytic enzymes). These enzymes, which are composed of amino acid chains, bind to these substrates and hold them in a certain way to make the process of breaking and forming bonds happen more readily. However, it is crucial to note that enzymes do not alter the free energy of the reactants or products, nor do they change whether a reaction is exergonic (spontaneous) or endergonic.

An example of an enzyme is salivary amylase that is involved in the breakdown of amylose, which is an element of starch.

Learn more about Enzymes here:

https://brainly.com/question/31561117

#SPJ6

Draw the Lewis Dot Structure for NaCl
as an ionic bond.

Answers

Can you please give me a better idea of what to do?

Which of the following is an organic molecule
A. Iron oxide
B.Oxygen gas
C.Water
D.Sucrose

Answers

Answer:

c water (h2o)

Explanation:

Sucrose cause water does not include carbon so C is wrong

Proteins do all of the following things in the body, except which of the following

Answers

Final answer:

Proteins in the human body have diverse functions including structural support, enzyme catalysis, muscle movement, oxygen transport, and immune response. However, their primary function is not to serve as a significant energy source, as proteins are typically not stored or metabolized for energy under normal circumstances.

Explanation:Functions of Proteins

Proteins in the human body are essential for a multitude of physiological functions. They serve critical roles such as providing structural support, enabling mobility, acting as catalysts in the form of enzymes, and transporting molecules and ions across the body. For example, structural proteins like collagen and keratin provide support to tissues, while contractile proteins in muscles facilitate movement. Hemoglobin, another type of protein, is vital in transporting oxygen from the lungs to the rest of the body. Proteins also play a key role in the immune response as antibodies, detecting and targeting foreign substances like bacteria. Regulatory proteins, including hormones, mediate various bodily functions.

However, one function that proteins do not serve is acting as a primary energy source. Unlike carbohydrates and fats, proteins are not stored for later use to be converted into glucose or triglycerides for energy. Instead, they are metabolized for energy only when other sources are insufficient.

Learn more about Protein Functions here:

https://brainly.com/question/29776206

#SPJ12

Is bread cell organization a living or non living

Answers

Living. Because yeast cells are present in bread, and they contain millions of living organisms that can only be seen microscopically.
Final answer:

Bread cell organization is a non-living structure created by yeast cells during the fermentation process when making bread.

Explanation:

Bread cell organization is a non-living structure. Bread is composed of cells, but these cells are not living because the bread itself is a product of cellular organization by yeast. Yeast is a single-celled fungus that undergoes fermentation to produce carbon dioxide gas, which causes bread to rise. Once the fermentation process is complete and the bread is baked, the yeast dies, and the cells become non-living.

Learn more about Bread cell organization here:

https://brainly.com/question/33922218

#SPJ2

The idea that all living things are made up of cells is considered scientific law. This means the idea

is an emerging scientific idea that has a logical explanation.

has been tested with similar results at least twice.

is supported by scientific consensus and a large amount of evidence.

has been rejected only once by the scientific community.

Answers

Answer:

The answer is C. This means the idea is supported by scientific consensus and a large amount of evidence.

Answer:

The Answer is C

Explanation:

This picture showes


A. Weathering

B.erosion

C. Deposition

D.all of the above

Answers

Answer: No Picture Included

Explanation:

which best describes the structure of a DNA molecule!
A. Two strands of RNA linked together

B. Two strands of amino acids linked together
O
c. A strand of DNA linked to a strand of RNA
D. Two strands of DNA linked together

Answers

Answer:

D. two strands of DNA linked together

Explanation:

What are the subatomic parts of the atom and what is their charge ?

Answers

The subatomic parts of an atom are the protons, neutrons, and electrons. Protons have a positive charge, neutrons have a neutral(no) charge, and electrons have a negative charge.

What is the difference between science and technology? How do science and technology affect each other? Give full detail

Answers

Answer:

The science is the knowledge of research while technology is the application of scientific research.

Explanation:

The science and technology are the two inseparable things. They are influencing each other. Technology is the application of science. By using technologies many products like different machines, objects are made. Technology helps in making a comfortable life for humans.

On the other hand, science is the knowledge of various fields - nature, physical world, matters. etc. Science is based on research and finding the truth behind any natural phenomena. Then the result of the scientific invention is produced in theory.

This scientific theory helps in developing new technologies. These have a symbiotic relationship. They can not go separately. The microscope was invented due to technical skills, but by using it many biological phenomena were revealed. They always go in a parallel way.

Which of the following is an example of a producer? Tree Hawk Rabbit Mushroom

Answers

Tree produces oxygen

Answer:

Tree

Explanation:

Producers are plants. Mushroom is fungi, not plant

in what way do prevailing winds affect precipitation an in region

Answers

Final answer:

Prevailing winds affect precipitation patterns by carrying moisture from oceans to continents, where it can condense and fall as precipitation. Seasonal shifts in wind and pressure systems, and geographic features like mountain ranges, also contribute to these patterns.

Explanation:

Prevailing winds play a significant role in shaping the precipitation patterns in a region. These winds can carry moisture from the oceans and release it as precipitation upon encountering landforms such as mountain ranges. Regions influenced by winds flowing from warm oceans, such as the westerlies in California, can receive rainfall due to the air's ability to pick up moisture over the water and then cool and condense over land. Moreover, seasonal variations in global pressure systems driven by Earth's heating cause shifts in precipitation, as can be seen with the Intertropical Convergence Zone (ITCZ) and the monsoon effects in Asia. The local precipitation effects, such as the lake-effect precipitation or the drought conditions linked to the subtropical high, further demonstrate the intricate relationship between prevailing winds and precipitation.

How were Redi’s and Pasteur’s experiments different? Redi studied broth, but Pasteur tested meat. Pasteur studied flies, but Redi tested meat. Pasteur tested for microorganisms, but Redi studied larger organisms. Redi tested for microorganisms, but Pasteur studied larger organisms.

Answers

Answer: C. Pasteur tested for microorganisms, but Redi studied larger organisms.

Explanation:

Redi had conducted experiment with spoiling meat; Pasteur experimented with broth. Redi discredited spontaneous generation for huge life forms by delineating that the maggots emerged from meat just when flies laid eggs in the meat.  

Pasteur utilized his celebrated swan-neck flask experiment, to part of the discussion. On his experiment  air is permitted to contact the broth. Microorganisms present in the residue were not ready to explore the convoluted curves in the neck of the flask.

(B.) Redi experimented with rotting meat; Pasteur experimented with broth.

if you begin cutting a piece of copper in half and continued cutting it in half until you had the smallest piece you would end up with

A anew substance
B an atom
c a molecule

Answers

Answer:

B: an atom

Explanation:

An atom is the smallest substance that can exist in isolation.

Hence, if a piece of copper is continually divided, eventually the smallest particle you would get in an atom.

Which would prevent a plant from growing?

A. Too much water
B. Lack of sunlight
C. No supply of lithium
D. Too many monosaccharides

Answers

Hey!

-------------------------------------------------

Answer:

B. Lack of sunlight

-------------------------------------------------

Explanation:

A plant can't grow without sunlight because a plant uses the sun to create food using photosynthesis. Too much water won't hurt the plant. Lithium is absorbed by the plant which is a kind of food it isn't very important if it does contain it. Monosaccharides is a kind of sugar that plants can take as food as well but it isn't as important as the food they receive from photosynthesis.

-------------------------------------------------

Hope This Helped! Good Luck!

Hmmm I believe B? Because the plants leaves need sunlight. Aka photosynthesis

Miguel lives near Miami, Florida. His home receives electricity from the Turkey Point power plant which uses nuclear energy to provide electricity to homes and businesses. What is used to provide energy in a nuclear power plant?

A.
chemical reactions
B.
nuclear fission reactions
C.
nuclear fusion reactions
D.
physical change

Answers

Final answer:

The energy in a nuclear power plant, such as the Turkey Point facility, is generated through nuclear fission reactions, where heavy atom nuclei split and release heat, facilitating electricity production.

Explanation:

The Turkey Point power plant in Miami, Florida, which provides electricity to Miguel's home, uses nuclear fission reactions to generate energy. In a nuclear fission reaction, the nucleus of a heavy atom, such as uranium or plutonium, splits into two smaller nuclei. This reaction releases a large amount of heat energy, which is used to produce steam. The steam then drives a turbine connected to a generator, which in turn, produces electricity.

Learn more about Nuclear fission in power plants here:

https://brainly.com/question/14332149

#SPJ3

which molecule do plants use to store extra glucoses

Answers

Answer:

starch

Explanation:

does this help you?

Final answer:

Plants store extra glucose in the form of starch, a complex carbohydrate. This stored glucose can be broken down when needed for energy, such as at night when photosynthesis cannot occur.

Explanation:

Plants store extra glucose in the form of a molecule called starch. Starch is a complex carbohydrate, made up of many glucose units linked together. Plants make glucose through the process of photosynthesis, but they can't use all the glucose they produce right away.

So, to store this extra glucose for later use, plants will link many glucose molecules together to form starch. This starch can then be broken back down into glucose when the plant needs more energy. For example, at night, when the plant can't perform photosynthesis, it may break down its stored starch into glucose to continue its metabolic functions.

Learn more about Starch here:

https://brainly.com/question/35193316

#SPJ12

why are formulas used to describe substances

Answers

Answer:

Chemical formulas are used to describe the types of atoms and their numbers in an element or compound. ... When more than one atom of a specific element is found in a molecule, a subscript is used to indicate this in the chemical formula.

Why do organs need a constant supply of blood?

a. To continually clean the organs, blood must constantly pass through them.

b. To continually help the cells within the organs change into new types of cells

c. To continually produce energy, your organs need oxygen and the oxygen is
carried in your red blood cells.

d. None of the above

please only answer if you know the actually answer

Answers

Answer:

to continually produce energy,your organs need oxygen and the oxygen  is carried in your red blood cells.

To continually produce energy, your organs need oxygen, and the oxygen is carried in your red blood cells, option C is correct.

The constant supply of blood is vital for maintaining the proper functioning of organs due to the oxygen they require to generate energy through cellular respiration. Hemoglobin in red blood cells binds to oxygen in the lungs, and this oxygen-rich blood is pumped by the heart to organs through an intricate network of blood vessels.
Cells extract oxygen from the blood, facilitating the production of adenosine triphosphate (ATP), the energy currency of cells. Additionally, blood carries nutrients and removes waste products, contributing to organ health. Thus, the continual circulation of blood ensures the delivery of oxygen and nutrients necessary for energy production and overall cellular activities in organs, option C is correct.

To learn more about blood follow the link:

https://brainly.com/question/32777865

#SPJ3

A marine biologist measures the density of oyster larvae, in number of larvae per liter of seawater, at four different sites in a coastal habitat over three days. The table below shows her results. Population Density Site W Site X Site Y Site Z Day 1 40 22 0 7 Day 2 3 1 14 26 Day 3 2 6 3 1 Which distribution pattern do the oyster larvae exhibit? A. uniform B. random C. clumped D. stationary

Answers

Answer:

Oyster larvae exhibit a random pattern of distribution (C).

Explanation:

If you look at the values of density in the different sites, you will see that densities are different between sites and that those densities varyied day by day. So, the most suitable distribution is at random.

Larvae exhibit random pattern of  distribution. Thus, option B is correct.

What is marine biology?

The branch of biology that deals with study of marine life, and organisms in the sea, is called as marine biology. This includes study of all phyla, families, and genera in marine ecosystem.

Ocean is a large ecosystem, where huge proportion of life on earth lives. coastal and open ocean are two types of habitats that found in marine habitat. The area from shoreline to continental shelf is included in coastal habitat. The habitats which are found in deep oceans are called open ocean habitat. Basically, it is environmental conditions and resources are consistent.

So the habitats which have constant environment conditions and abundant resources are suitable for random distribution.

Therefore, option B is correct.

Learn more about marine biology, here:

https://brainly.com/question/11679506

#SPJ7

What happens when nutrient levels become too concentrated in rivers, lakes, and oceans?
When nutrient levels get too high, water quality degrades and oxygen levels are depleted through a process known as

Answers

Answer:

Eutrophication is what happens when nutrient levels become too concentrated in rivers, lakes, and oceans. Eutrophication is when the levels of nutrients and minerals in a body of water become too concentrated. It is usually induced by the release of nitrate or phosphate-containing substances into a water body.

Explanation:

Match the different levels of protein organization with their definition.

Levels of organization:
1. Primary structure
2. Secondary structure
3. Tertiary structure
4. Quaternary structure

Definitions:
A. Linear sequence of amino acids in the polypeptide chain
B. Three-dimensional structure of a polypeptide
C. Highly regular local sub-structures such as α-helix and β-pleated sheet structures
D. Three-dimensional structure of a multi-subunit protein

Select one:
a. 1-C, 2-D, 3-B, 4-A
b. 1-A, 2-C, 3-B, 4-D
c. 1-D, 2-A, 3-B, 4-C
d. 1-A, 2-B, 3-D, 4-C
e. 1-C, 2-D, 3-A, 4-B

Answers

Answer: b.
Primary - sequence of amino acids with peptide bonds
Secondary - a-helix and b-pleated sheets with hydrogen bonds
Tertiary- 3D structure held together by R-group (most proteins only go to this level)
Quaternary- multiple sequences of amino acid chains

In Protein Structure, the primary structure is a sequence of amino acids, the secondary structure involves local arrangements like α-helix and β-pleated sheet structures, tertiary structure details the larger 3D shape of a single polypeptide chain, and quaternary structure outlines the arrangements of multiple polypeptides in a protein.

The four levels of protein structure organization match with their definitions as follows:

Primary structure - A. Linear sequence of amino acids in the polypeptide chain

Secondary structure - C. Highly regular local sub-structures such as α-helix and β-pleated sheet structures

Tertiary structure - B. Three-dimensional structure of a polypeptide

Quaternary structure - D. Three-dimensional structure of a multi-subunit protein

Hence, the correct answer is option B.

The primary structure is determined by the sequence of amino acids that forms the polypeptide chain.

The secondary structure consists of local arrangements in the polypeptide chain such as α-helix and β-pleated sheet structures.

The tertiary structure represents the larger scale, three-dimensional arrangement of a single polypeptide chain.

Lastly, the quaternary structure is the arrangement of multiple polypeptides, or subunits, in a protein that has more than one polypeptide chain.

Learn more about Protein Structure here:

https://brainly.com/question/33651793

#SPJ6

Why is the structure of a dna molecule sometimes referred to as having the the shape of a spiral staircase

Answers

dna molecules have have nitrogenous base pairs that compliment with each other. ex: guanine, adenine, thymine and cytosine. A:T, G:C. since each has a pair, they form a ladder as the dna molecule develops. this is why it's similar to the shape of a spiral staircase. hope i helped ^__^

Final answer:

The DNA molecule's double helix shape is compared to a spiral staircase, with two polynucleotide chains forming the edges and complementary bases forming steps through hydrogen bonds.

Explanation:

The structure of a DNA molecule is often compared to a spiral staircase because of its distinctive double helix shape. This comparison helps visualize how the molecule is constructed. Two polynucleotide chains run antiparallel, forming the outer edges of the staircase, much like the handrails. These chains consist of a backbone made of sugar and phosphate groups. Connecting these backbones are the 'steps' of the staircase, which are actually pairs of complementary bases (adenine with thymine and guanine with cytosine) forming hydrogen bonds between the two strands.

The arrangement of these bases is like the steps of a spiral staircase because they are aligned in a manner that reflects the twisting shape of the double helix. The strong structure not only visually resembles a staircase but is essential for the stability of the DNA molecule, enabling it to carry genetic information effectively.

valence electrons are important because

A) They form chemical bonds with other atoms

B) They tell which period the element is in

C) They take isotopes

D) They identify the element

Answers

Answer:

A) They form chemical bonds with other atoms

Explanation:

In chemistry, a valence electron is an outer shell electron that is associated with an atom, and that can participate in the formation of a chemical bond if the outer shell is not closed; in a single covalent bond, both atoms in the bond contribute one valence electron in order to form a shared pair.

The tilting or folding of horizontal layers must occur _____. A. after the layers have formed B. before the layers have formed C. during the formation of the layers

Answers

Answer: A

YYYYYYYEEEEEETTTT

Answer:

Option (A)

Explanation:

The layers that creates folding or tilting are found in the sedimentary rocks. These rocks are formed due to the compaction and lithification of sediments. For example, sandstone, shale and mudstone.

This rocks when deposited over one another, it forms layers. These layers are then subjected to folding or tilting due to the compressional stress (tectonic forces).

Before forming the layers, if the rock is subjected to compressional stress, then the sediments will not form layers and there occurs no folding. Whereas it will shatter the rock.

Thus, the correct answer is option (A).

How do population cycles impact trophic levels?

Answers

Answer: Top predators, or tertiary consumers can also be keystone species. ... Without their predator, the populations of these herbivores grows out of control as they eat all their food source, the producers. Like changes in other trophic levels, without the producers, the entire ecosystem can collapse.

Explanation: Food webs illustrate energy flow from primary producers to primary consumers (herbivores), and from primary consumers to secondary consumers (carnivores). ... Under top-down control, the abundance or biomass of lower trophic levels depends on effects from consumers at higher trophic levels. So yeah!

Answer:

If one’s trophic level increases or decreases too much, it can impact the number of producers. This in turn depletes the energy in the food web, which can disrupt homeostasis.

Explanation:

coursehero

Other Questions
Cusic Industries had the following operating results for 2019: sales = $34,621; cost of goods sold = $24,359; depreciation expense = $6,027; interest expense = $2,725; dividends paid = $2,023. At the beginning of the year, net fixed assets were $19,970, current assets were $7,075, and current liabilities were $4,010. At the end of the year, net fixed assets were $24,529, current assets were $8,702, and current liabilities were $4,700. The tax rate was 25 percent. a. What is net income for 2019? (Do not round intermediate calculations.) b. What is the operating cash flow for 2019? (Do not round intermediate calculations.) c. What is the cash flow from assets for 2019? (A negative answer should be indicated by a minus sign. Do not round intermediate calculations.) d-1. If no new debt was issued during the year, what is the cash flow to creditors? (Do not round intermediate calculations.) d-2. If no new debt was issued during the year, what is the cash flow to stockholders? (A negative answer should be indicated by a minus sign. Do not round intermediate calculations.) Evaluate M2/P2 for M = 10, N = -5, and P = -2? A.-5 B.5 C.-25 D.25 Read the sentences. Sentence 1: I hope the dinner comes out perfectly, but even if it doesnt, Im pretty sure theyll know how hard I tried. Sentence 2: Then well have coffee cake for dessert, which I made from scratch. Sentence 3: I am making my sisters favorite: roasted chicken, brown rice, and brussels sprouts. Sentence 4: I cannot wait to cook dinner for my family tonight. What is the most logical sequence for these sentences in a story? 1, 3, 2, 4 4, 1, 3, 2 4, 3, 2, 1 3, 2, 1, 4 An RNA virus that infects plant cells is copied into a DNA molecule after it enters the plant cell. What would be the sequence of bases in the first strand of DNA made complementary to the section of viral RNA shown here? 5' CCCUUGGAACUACAAAGCCGAGAUUAA 3' Reasoning if you multiply two decimals that are less than 1,can you predict whether the product will be less thanor greater than either of the factors? Explain What is the greatest common factor of 19 and 18? What happened as a result of the Sand Creek Massacre? Please select the word from the list that best fits the definition Likes to study with music in the background Which function has the given graph? Consider a river flowing toward a lake at an average velocity of 3 m/s at a rate of 500m3/sat a location 90 m above the lake surface. Determine the total mechanical energy of the river water per unit mass and the power generation potential of the entire river at that location. Angelo made the decision to outsource the software components of his consulting company so he could focus on the companys ________, which are sources of competitive advantage, make a contribution to perceived customer benefits, have application in a wide variety of markets, and are difficult to imitate. Food web starting with sun and pointing to grasshopper and squirrel; Grasshopper pointing to squirrel, wolf, and snake; squirrel pointing to wolf, snake, and bird; wolf pointing to decomposition with worms and mushrooms; snake pointing to wolf and decomposition with worms and mushrooms; bird pointing to decomposition with worms and mushrooms; decomposition pointing to the sun stating soil nutrients.If we removed the decomposers from this food web, how would it affect the balance of the ecosystem? There would be an increase in dead matter and a lack of nutrients in the soil. There would be a decrease in dead matter and a lack of nutrients in the soil. There would be an increase in dead matter and an increase in nutrients in the soil. There would be a decrease in dead matter and an increase in nutrients in the soil. Which of the following would NOT be considered an investment in human capital?Aobtaining a college degreeBpurchasing a new computerCattending a first-aid classDpaying for cooking lessons For a class Foo, one difference between a variable declared Foo * and a variable declared Foo & is that only the variable declared Foo & can potentially have the value NULL.Select one:a. FALSEb. TRUE how do chemicals affect our lives? what is the region of very calm seas and little to no wind on either side of equator? Which was not one of the major disagreements that the framers faced at the Constitutional Convention?The process for adding future states to the union.Balancing the power of the large and small states.Balancing the power between the state governments and the federal government.What should be done about slavery. A construction company has built 30 houses so far this year at a total cost to the company of $7.5 million. If the company builds a 31st house, its total cost will increase to $7.76 million. Which of the following statements is correct?a. For the first 30 houses, the average cost per house was $250,000.b. The marginal cost of the 31st house, if it is built, will be $260,000.c. If the company can experience a marginal benefit of $275,000 by building the 31st house, then the company should build it.d. All of the above are correct. Adriana is a member of a culture that does not believe in birth control, but she recognizes that another culture has the right to decide about birth control because they are different. What is this an example of? At what distance from a long straight wire carrying acurrentof 5.0A is the magnitude of the magnetic field due to thewireequal to the strength of the Earth's magnetic field of about5.0 x10^-5 T?