¿Cuáles son las ciudades capitales de Bolivia?
Uyuni
Sucre
Cochabamba
La Paz

Answers

Answer 1
¿Cuáles son las ciudades capitales de Bolivia?
Sucre
La Paz
Answer 2
La respuesta es LA PAZ

Related Questions

SPANISH HELP PLEASE!!!

Answers

C) Toalla.

Happy to help! :)
The answer would be toalla because you need a towel to get you dry after the pool or being wet.
IT'S TOALLA

Progressiva paiolla arde a cabeca na hora do procedimento ?

Answers

Knife-type weapon that can stab and slice. A Progressive Knife (often called "Prog Knife" for short) is a combat knife stored in the left shoulder pylon of an Evangelion which uses it, and is one of the Evas' basic armaments. The blade of the knife vibrates at an extremely high frequency[1], increasing its cutting sharpness to the point that it can cleave the matter of a target object at a molecular level.


plural (ustedes) correcto para el verbo siguiente.

tener

Question 37 options:

A)

tengan


B)

tienen


C)

tiena


D)

ten

Answers

plural (ustedes) correcto para el verbo siguiente.

tener

Question 37 options:

B) 

tienen

Tienen is the correct answer. 

Plz give me branliest

La respuesta es B, tienen

Lee las frases e identifica si cada una es subjuntiva o indicativa. Después, escoge la opción que refleja el modo correcto. Read the sentences and identify if the sentence is subjunctive or indicative. Then choose the option that reflects the correct mood for each sentence.
1. My mom wishes I would not drive in the rain.
2. It's obvious they are going to drive to the airport.
3. It's certain that we will all fit in the van.
4. My grandfather hopes that we will come to the party.

Answers

The subjunctive mood is used to talk about desires, doubts, wishes, conjectures, and possibilities.  For example

1. My mom wishes I would not drive in the rain

4. My grandfather hopes that we will come to the party

The indicative mood is used to talk about facts and other statements that are believed to be true and concrete. For example

2. It's obvious they are going to drive to the airport

3. It's certain that we will all fit in the van.

Lee las frases e identifica si cada una es subjuntiva o indicativa. Después, escoge la opción que refleja el modo correcto. Read the sentences and identify if the sentence is subjunctive or indicative. Then choose the option that reflects the correct mood for each sentence.

Answers:

Explanation : The indicative mood expresses something that is considered true, whereas the subjunctive mood expresses desires or possibilities for something to happen.

Subjunctive Mood:

These sentences express desires or possibilities.

1. My mom wishes I would not drive in the rain.

Translation 1: Mi madre desea que yo no conduzca bajo la lluvia.

4. My grandfather hopes that we will come to the party.

Translation 4: Mi abuelo espera que nosotros vayamos a la fiesta.

Indicative Mood:

These sentences express something that is considered true.

2. It's obvious they are going to drive to the airport.

Translation 2: Es obvio que van a conducir al aeropuerto.

3. It's certain that we will all fit in the van.

Translation 3: Es cierto que todos cabremos en la furgoneta.

[tex]\textit{\textbf{Spymore}}[/tex]​

Pq o militares se meteram no governo de d pedro segundo?

Answers

Era un hombre muy poderoso y unos le tenían miedo.

Resposta do enigma na igreja a 5 velas entra 3 ladrao e 2 ladra cada ladrão leva 1 vela

Answers

I think its 2 remaining candles.

Costa Ricas national palo verde park is home to the largest concentration of _____ in Central America

leather back turtles
Birds
Monkeys
Vampire Bats

In _____ Many people have Spanish surnames because of an old Spanish law requiring the people to use Spanish surnames.

The Philippians
Belize
Western Sahara
Equatorial Guinea

Answers

1. The answer is "birds".


Costa Ricas national palo verde park is home to the largest concentration of "birds" in Central America .



Palo Verde National Park is situated on the banks of the Tempisque River, in the Nicoya Peninsula. It is extraordinary compared to other parks for Bird Watching and watching an entire cluster of untamed life and tropical fauna. It is the gathering region of the biggest grouping of oceanic and transitory winged animals of the Central American Pacific Coast. The swamps are secured by slopes and waterways and the entire zone is changed into gigantic wetlands amid the blustery season. There are such a large number of flying creatures that on occasion it is relatively overpowering! This is the birdwatchers' heaven.


2. The answer is "The Philippians".



In "The Philippians" Many people have Spanish surnames because of an old Spanish law requiring the people to use Spanish surnames.


Filipinos are transcendently of Malay descent, much of the time with Chinese and some of the time American or Spanish lineage. Numerous Filipinos have Spanish names as a result of a nineteenth century Spanish announcement that expected them to utilize Spanish surnames, or last names. Parents frequently name their kids after the holy person whose devour day was upon the arrival of their introduction to the world.

Complete the sentence with the correct verb form.
Tú y él _____ sus nombres en la tarea.

escribimos

escribe

escriben

Answers

Ans:- 2nd option. (escribe)


Tú y él escribe sus nombres en la tarea.

Espero que esto ayude!

the answer is escribe

Como podemos conocer la cantidad que representa un por ciento en una grafica circulat?

Answers

A pesar de esto aparentemente sencilloenfoque, el Área de Circulación a menudo se subestima.Foros, planificadores de instalaciones,diseñadores, arquitectos y bienes raíceslos profesionales han ajustado la circulaciónMultiplicador para alcanzar un objetivoÁrea utilizable, en lugar de reducir el espaciorequisitos para espacios individuales y de apoyo.Sin embargo, la circulación es un componente necesariode un programa espacial. Si la cantidad de áreadedicado a la circulación se subestima, elEl área utilizable programable puede no reflejar elcantidad necesaria para acomodar adecuadamenteel nuevo lugar de trabajo.

Escoge las frases ciertas. Las casas de Puerto Rico tienen sótanos. Las casas de Puerto Rico tienen garajes que se llaman marquesinas. Las casas de Puerto Rico se construyen de cemento. Las casas de Puerto Rico son exactamente iguales a las casas de los Estados Unidos.

Answers

Las casas de Puerto Rico tienen grarajes que se llaman marquesinas. Las casas de Puerto Rico se construyen de cemento.

Answer:

Las casas de Puerto Rico tienen garajes que se llaman marquesinas.

Las casas de Puerto Rico se construyen de cemento.

Explanation: We must choose the sentences that are true:

1) Las casas de Puerto Rico tienen sótanos. (The houses of Puerto Rico have basements.)  

This is not really common to see, so this is no really true.

2) Las casas de Puerto Rico tienen garajes que se llaman marquesinas. (The houses of Puerto Rico have garages called canopies. )

So yes, most garajes are constructed in the form of marquesinas, that are like rooms, sometimes with no door, where you can put your car, this is true.

3) Las casas de Puerto Rico se construyen de cemento. (The houses of Puerto Rico are constructed of cement.)

This is mostly true, is an efficient and durable material, so it is used in most houses, in recent times the market of prefabricated houses raised, so you can see some houses that are of other materials, but is not the common case, the sentence is true.

4) Las casas de Puerto Rico son exactamente iguales a las casas de los Estados Unidos. (The houses of Puerto Rico are exactly the same as the houses of the United States.)

This would be false, the necessities are different, the recurses are different, and the cultures are different, of course, every house has like a kitchen, a bathroom, etc, but there are differences in other things, so the houses in Puerto Rico are not exactly equal to the houses in the US

Piden por agua.

Correct

Incorrect

Answers

Incorrect:

The sentence Piden por agua is incorrect. Why? The preposition por can be used here, so the correct sentence is piden agua. So let's analyze the correct sentence:

Piden is the conjugation of the verb pedir for the third person singular in the simple present.

Agua is a masculine noun that means water

Answer:

incorrect

Explanation:

it is incorrect

Necesito un mapa para la clase de ____________. a. matemáticas b. ciencias c. geografía.

Answers

 necesitas un mapa paraC
tu respuesta es c


the answer would be C.geografia. the sentence says i need a map for the class of geography. hope this helps! 

Choose the correct future form of hablar. Yo _____ con la maestra. hablaré hablarás hablaremos hablarán

Answers

Yo hablaré con la maestra.

The correct option to fill the sentence in Spanish, using the conjugation of the verb in Future Tense is: "hablaré."

How is the Future Tense of a verb in Spanish?

The conjugation of the verb "hablar" in future tense, taking into account the personal pronouns is:

Yo: hablaréTú: hablarásUsted: hablaráÉl: hablaráElla: hablaráEllo: hablaráNosotros / Nosotras: hablaremosUstedes: hablaránEllos / Ellas: hablarán

To identify the appropriate conjugation in each sentence, you must identify the noun in the sentence, replace it with the appropriate personal pronoun, and finally use the corresponding conjugation with the help of the guide above.

If you want to learn more about Future Tense in Spanish, you can visit the following link: https://brainly.com/question/17171997

#SPJ2

Please select the word from the list that best fits the definition

La ola
La grafas de sol
La planca de vela
El traje de baño
La piscina
La playa
La creama protectora
La requeta

Answers

La palabra de la lista que mejor se ajusta a la definición es la piscina.

Ans:- La piscina

Hope this helps!
Answer = La piscina
That means pool

Se nao deixar uma cachorra parir/ ela pode adoecer?

Answers

Not sure what language you want this in but if you want it in English the here it is "If you do not let a dog give birth,can get sick"

Define q es la integracion de estados y cual o cuales son sus intencionalidades

Answers

it says Define q is the integration of states and which or what are their intentions

Decide whether the sentence is correct or incorrect as written. Salgo con mis amigos.
Correct
Incorrect

Answers

This sentence is correct


Salgo con mis amigos means I go out with my friends. Although  the pronoun that must match this sentence is not being used, the sentence is correct. The reason is that, in Spanish, often it not necessary to include the pronoun in sentences because the conjugation of the verb and the context of the sentence tells us to whom  this is addressed.  

the asnwer is its correct

¿Cómo se llaman las ruinas que están cerca del lago Titicaca?
Machu Picchu
Salar
Guayaquil
Tiahuanacu

Answers

Tiahuanacu is the correct answer

What are some influences salsa music has?

A. Spanish, Dutch

B. African, Samoan

C. English, Chinese

D. African, Cuban, Puerto Rican and Jazz

Answers

I think is d isn't sure


El arte tiene un papel importante en Punta del Este, en Uruguay. True False

Answers

This is True, It has the 1st of 5 Ralli Museums

Answer:

The correct answer of the affirmation: "El arte tiene un papel importante en Punta del Este, en Uruguay" is:

- True.

Explanation:

Punta del Este is a peninsular city that has many artistic activities how Punta del Este International Film Festival where is presented the productions of the newest directors and the best museums, places that could be interesting for foreign as Ralli museum, Sea museum, War Gallery, Casapueblo and Francisco Mazzoni museum.

1.) No estoy ___ bromas, o ___ lo menos no quiero desperdiciar tiempo.

a.) por/para
b.) para/por
c.) para/para
d.) por/por

2.) Escoge la mejor traduccion para la siguiente oracion. They need me to dance.

a.) Ellos necestian que yo baile.
b.) Ellos necesitan bailar.
c.) Ellos necesitan que yo baila.
d.) Ellos necesitan que yo bailo.

3.) Decide si la siguiente oracion es CORRECTA o INCORRECTA.
Ojala llueve manana.
(The second "a" has an accent and the first "n" has a squiggle over it)

a.) Incorrecto
b.) Correcto

3.) Escoge la conjugacion en el tiempo condicional del verbo entre parentesis.
Nosotros (poder) ir a tu casa.

a.) podremos
b.) podriamos
c.) podemos
d.) hemos podido

4.)Escoge la conjugacion en el tiempo condicional del verbo entre parentesis.
Nosotros (querer) salir este fin de semana.

a.) queríamos
b.) querríamos
c.) querremos
d.) queremos

5.) Escoge la conjugacion en el tiempo condicional del verbo entre parentesis.
Cuando ella (Ser) niña, no comía mucho.


a.) fue
b.) era
c.) es
d.) será

Answers

1) b 
2) a
3) c
4) d
5) b
I hope it helped

Selecciona la mejor respuesta. (Choose the best answer.) Pongo mi ropa en __________ .

A la escalera

B la sala

C las cortinas

D el armario

Answers

Hello:
Selecciona la mejor respuesta. (Choose the best answer.) Pongo mi ropa en __armario________ . 

D el armario

The tranlation of this sentence is: I put my close in the         .

And the translation of Armario is closet. 

So i would think that you would put your clothes in the closet. 

Plz branliest

¿Cuáles son las plantas más importantes para Cuba?

Answers


Las probabilidades por tema de la entrega de la asignación a tiempo y la llegada a tiempo a la clase se dan en la tabla. ¿Cuál es la probabilidad de que el sujeto sea física si una tarea se envía a tiempo? Asunto: Asignación puntual:
 A.) 82.3% B.) 88.5% C.) 89.7% D.) datos insuficientes

 D.) datos insuficientes es la respuesta


Quien puede sacar un certificado de nacimiento

Answers

Who can get a birth certification
Todos podemos sacar uno

Which of the following sentences means "You say good-bye" in Spanish?
A. Te vas
B. Te acuestas
C. Te pones
D. Te despides

Answers

I think it is A.te vas
no its D te despides
A Te vas-u go
B Te acuestas-u go lay down/go to sleep
C Te pones-u put
D You say good bye
next time save ur points darling and go to google translate

Please help me with this
thank u

Answers

como te va es la repuesta


Last option I think . They're all weird

Soñar con bebe recien nacido muerto

Answers

dream with baby born which is dead
Hmmm creo que necesitas buscar eso en un libro de sueńos aunque eso de muerto se supone que es micha vida.

Use the information below to tell when everyone is coming to the school dance tonight. Use the correct form of the verb venir in each response.

Marisol (7:30)

Answers

Answer:

Marisol vendrá al baile a las siete y media de la noche.

Explanation:

Since the dace is at night we assume it's 7:30 pm. And since it hasn't occurred yet we should use future tense. Venir is an irregular verb so the future tense form does't follow standard conjugation, and the correct form is "vendrá" for the third person.

Choose the Spanish equivalent to the command in parentheses. _____________ (eat) la manzana. Question 8 options: Come Como Comer Comas

Answers

u can used Come and como
It would be "come" because you are going to eat the apple.

translate En nuestro viaje, vamos de Miami ¿adónde?

Answers

It actually means "On our trip, we're going from Miami to where?"

En nuestro viaje (on our trip), vamos de Miami (we're going from Miami) adonde (to where?)?

Other Questions
How to do this Im lost How do web based applications and websites differ? Describe the effects of Eastern Europes economic problems and ethnic and religious tensions What term refers to the coldest and densest zone, deep below the surface of a lake? Tyree is a skilled cyclist. when practicing on a stationary bike, his coach finds that when the women's cycling team enters the gym, his speed seems to increase significantly. tyree's increase in speed illustrates What factors are associated with recent intimate partner violence? findings from the who multi-country study on women's health and domestic violence? BY THE PRESIDENT OF THE UNITED STATES OF AMERICA. A PROCLAMATION. I, ABRAHAM LINCOLN, President of the United States of America, and Commander-in-Chief of the Army and Navy thereof, do hereby proclaim and declare that hereafter, as heretofore, the war will be prosecuted for the object of practically restoring the constitutional relation between the United States, and each of the States, and the people thereof, in which States that relation is, or may be, suspended or disturbed. That it is my purpose, upon the next meeting of Congress to again recommend the adoption of a practical measure tendering pecuniary aid to the free acceptance or rejection of all slave States, so called, the people whereof may not then be in rebellion against the United States and which States may then have voluntarily adopted, or thereafter may voluntarily adopt, immediate or gradual abolishment of slavery within their respective limits; and that the effort to colonize persons of African descent, with their consent, upon this continent, or elsewhere, with the previously obtained consent of the Governments existing there, will be continued. That on the first day of January in the year of our Lord, one thousand eight hundred and sixty-three, all persons held as slaves within any State, or designated part of a State, the people whereof shall then be in rebellion against the United States shall be then, thenceforward, and forever free; and the executive government of the United States, including the military and naval authority thereof, will recognize and maintain the freedom of such persons, and will do no act or acts to repress such persons, or any of them, in any efforts they may make for their actual freedom. That the executive will, on the first day of January aforesaid, by proclamation, designate the States, and part of States, if any, in which the people thereof respectively, shall then be in rebellion against the United States; and the fact that any State, or the people thereof shall, on that day be, in good faith represented in the Congress of the United States, by members chosen thereto, at elections wherein a majority of the qualified voters of such State shall have participated, shall, in the absence of strong countervailing testimony, be deemed conclusive evidence that such State and the people thereof, are not then in rebellion against the United States. That attention is hereby called to an Act of Congress entitled "An Act to make an additional Article of War" approved March 13, 1862, and which act is in the words and figure following: Be it enacted by the Senate and House of Representatives of the United States of America in Congress assembled, That hereafter the following shall be promulgated as an additional article of war for the government of the army of the United States, and shall be obeyed and observed as such: Article . All officers or persons in the military or naval service of the United States are prohibited from employing any of the forces under their respective commands for the purpose of returning fugitives from service or labor, who may have escaped from any persons to whom such service or labor is claimed to be due, and any officer who shall be found guilty by a court-martial of violating this article shall be dismissed from the service. SEC. 2. And be it further enacted, That this act shall take effect from and after its passage." What is the effect of the following passage on the U.S. government? ...and the executive government of the United States, including the military and naval authority thereof, will recognize and maintain the freedom of such persons, and will do no act or acts to repress such persons, or any of them, in any efforts they may make for their actual freedom.A) It intends to conscript former slaves into the military.B) It intends to prosecute former slave owners.C) It will not stop any slave from moving toward freedom.D) It will use its military and naval authority to stop the war. Which of the following words has the same root as the word biology? a zoology b geology c bibliography d biograph Which expression is equivalent to (2x^5+7x^3)-(5x^2-4x^3) What is the length of chord JK? Who was the first northern democrat elected to the presidency since 1968? determine the qotient of 7,684 and 78 Choose the sentence that best describes the history of Guatemala's capital city.The capital has always been Guatemala City.The capital has always been Antigua.The capital used to be Antigua, but is now Guatemala City.The capital used to be Guatemala City, but is now Antigua. As a healthier alternative to french fries, some fast food outlets offer pre-sliced, bagged apples as a side option. the ingredients list often reads, "apples and ascorbic acid." ascorbic acid is another name for vitaminc. what role does the ascorbic acid play in the product? ascorbic acid is a sequestrant that binds free metal ions and reduces the rancidity of fat in the apples. ascorbic acid is an antioxidant that prevents discoloration when the apples are cut and exposed to oxygen. ascorbic acid is a curing agent that prevents the growth of clostridium botulinum. ascorbic acid is a color additive that makes the color of the apples appear more vibrant. What are the causes of problems the milers and other Native American groups face in Guatemala how are people trying to solve these problems Which diagram shows the most useful positioning of a rectangle in the first quadrant of a coordinate plane? Answers are in the pictures. In an attempt to stem the rising tide of illegitimacy rates and single-parent families among the poor, which act mandated two-parent coverage for all state afdc programs? the family support act in 1988 the supplemental security income the affordable care act temporary assistance to needy families Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? view available hint(s) where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? it would not bind the target dna. ttttagccatttacgattaatcg ttttagccatttacgattaatcg ttttagccatttacgattaatcg? For the electric field shown, which of the following statements describes an increase in voltage?A) A negative charge crosses an equipotential line toward the source charge.B) You cannot tell from the information given.C) A positive charge crosses an equipotential line toward the source charge.D) A positive charge moves along an equipotential line.UPDATE: ANSWER IS C Which organisms are both secondary and tertiary consumers in the food web