Describe how the population of the Earth increase if the number of children being born is less?

Answers

Answer 1

Answer:

As this ratio of land and man was given by demographer Thomas Malthus who said population on grew in an arithmetic and earth production in a geometric fashion.

Explanation:

The population or the production capacity of the earth will double and increase as long as it's kept stable i.e no interference from the outside world or human world. Even when there are lower birth and population is still decreasing the earth still will produce less as comparatively due to the slow growth of resources. This population may increase due to the number of medical aid facilities provided or may increase due to the population reaches its maturity and gets fixed or stabilized. Population and growth in resource distribution are always linked to the demographic changes in the population distribution around the world. \As the country of Africa has large scale childbirth and is next after Asia in terms of the population even after several years when its population stabilizes there still going to be pressure on the natural resources as these are finite in numbers.

Related Questions

DNA has a charge associated with it. What functional group that carries a charge is included in DNA, and how do we use the charge to our advantage while doing gel electrophoresis? How does this relate to using the phrase "run to the red" while performing gel electrolysis?

Answers

Answer:

DNA is made up of sugar-phosphate backbone and the phosphate in the DNA contains the negative charge, therefore, DNA is a negatively charged molecule present in the nucleus.

This negative charge is very important in separating the DNA according to their charge and size during gel electrophoresis. During gel electrophoresis DNA of different size is run on an agarose gel in the presence of current and DNA fragments move toward positive charge due to negative in nature.  

Small size DNA moves fast through the gel large size DNA moves slow towards negative pole, therefore, separating the DNA according to their size. In gel electrophoresis, red pole is positive pole and the black pole is negative so runs to the red phrase is signifying that the DNA is always run towards the red pole.

pH can be regulated in the collecting duct.
a. True
b. False

Answers

Answer:

a. True

Explanation:

pH can be regulated by the collecting duct of the kidney. Collecting duct play an important role in the maintenance of pH and ionic balance of the blood by the selective secretion of hydrogen ions (protons) and potassium ions. Collecting duct is long duct which extends from the cortex of the kidney to the inner part of the medulla. In the collecting duct, a large amount of water reabsorption occurs.

In photosynthesis, ATP and electrons from light reactions are used in ___________
a. glycolysis
b. krebs cycle
c. oxidative phosphorylation
d. calvin cycle

Answers

Answer:

d. Calvin cycle

Explanation:

During the light reactions or photochemical reactions of photosynthesis, chlorophyll molecules absorb sunlight and convert light energy into assimilatory power in the form of the electron carrier molecule nicotinamide adenine dinucleotide phosphate (NADPH) and the ATP.

The ATP and NADPH used as a source of energy to fix or reduce carbon dioxide into glucose.

The reduction of carbon dioxide to glucose occurs in the stroma of the chloroplast. The reactions of the conversions are called the Calvin cycle.  

Which sequence best describes the passage of sperm? 1. Seminiferous tubules. 2. Vas deference. 3. Epididymis 4. Ejaculatory duct 5. Urethra.

A. 3,1,2,4,5
B. 1,3,2,4,5
C. 5,4.2,3,1
D. 1,3,4,2,5
E. 3,1,4,2,5

Answers

b, 13245 is the correct path

After the DNA is unwound, what protein keeps the strands from reannealing?
a. DNA primase
b. Sliding clamp
c. Helicase
d. SSB protein

Answers

Answer:

SSB protein.

Explanation:

DNA replication may be defined as the process of formation of daughter RNA molecule from the template DNA. The process of DNA replication occur in 5' to 3' direction.

The DNA strand must be unwound to initiate the DNA replication. The DNA strands must not reanneal for the replication process. Single stranded binding protein (SSB) bounds to the DNA strands and prevent them from re anneal.

Thus, the correct answer is option (d).

Final answer:

The protein that keeps unwound DNA strands from reannealing is the single-strand DNA binding protein (SSB protein), not DNA primase, sliding clamp, or helicase. In eukaryotes, DNA is organized around histones.

Explanation:

After the DNA is unwound during replication, the protein that keeps the DNA strands from reannealing is the single-strand DNA binding protein (SSB protein). These proteins bind to the separated strands of DNA, thereby ensuring that these strands remain single-stranded and accessible for the next steps in DNA replication. This prevents the DNA strands from spontaneously forming double-stranded DNA again.

In eukaryotes, DNA is wrapped around proteins called histones, not single-stranded binding proteins or sliding clamps. The attachment of DNA to histones helps in compacting the large eukaryotic genomes so that they fit within the cell nucleus, and also plays a role in the regulation of gene expression.

Predict the change in leukocyte count in a patient suffering from leukemia (cancer involving leukocytes)

Answers

Answer:

Leukemia may be defined as the cancer of the blood cells especially white blood cells. The leukemia may occur due to mutation or may also occur due to the biological agents.

Leukemia causes the abnormal and uncontrolled growth of the blood cells. These white blood cells are unable to fight with infections and causes the bone marrow to produce impair formation of blood cells. The patient shows abnormal growth and large count of leukocytes.

During mRNA processing, what is put on the 3' end of a primary mRNA transcript?
a. a poly-A tail
b. a cap
c. an exon
d. an intron

Answers

Answer:

A poly-A tail.

Explanation:

Transcription may be defined as the process of formation of the RNA molecules from the DNA template. Eukaryotic RNA undergoes the process of mRNA processing.

The mRNA processing involves the post translation modification of RNA. The poly A (adenine) tail is added to the 3' end of the RNA transcript after the elongation. This poly A tail protects the RNA from the degradation and helps to export the RNA into the cytoplasm.

Thus, the correct answer is option (a).

List three ways by which eukaryotes process mRNA after transcription.

Answers

Answer:

The post transcription modification include three ways i.e., capping, polyadenylation and splicing.

1. 5' Capping- mRNA capping is catalyzed by capping enzyme which is associated with RNA polymerase II. This enzyme adds the guanosin residue to 5' end of mRNA then methyl transferase adds methyl group to N⁷ position this guanine. Capping protects mRNA from degradation by enzymes presents in the cell.

2. Polyadenylation: In polyadenylation many adenosine residue is added at 3'end of mRNA by poly(A) polymerase. This poly A tail helps in exporting mRNA out of nucleus and binding of translational factors.

3. Splicing: In splicing process the non coding introns are removed from RNA so that only coding region i.e., exons are left in mRNA. It is important to remove unwanted sequence like introns which hinders in protein formation.

How can mutations change the gene pool of a population?

Answers

Answer:

Explanation:

The changes in the gene pool occurs from the one generation to another this process is called as the microevolution. The allele frequencies in the gene pool change due to many processes such as gene flow, natural selection, genetic drift, and mutation. In mutation the genetic variations occurs in the genome of the organisms due to change in the genetic makeup of the organisms new traits are produced which are passed on to the new generation and this brings change in diversity of genes in the gene pool.

Which of the following statements is not true?
a. Archaea and bacteria have different membrane lipids.
b. The cell walls of archaea lack peptidoglycan.
c. Only bacteria have histones associated with DNA.
d. Only some archaea use CO2 to oxidize H2, releasing methane.

Answers

Answer:

c. False

This statement is incorrect because the DNA of bacteria is circular without histones.

Explanation:

a. True

Some archaea have very specific lipids in their membrane. Differently of the bacterias that have usual lipids in their membranes.

b. True

Archaebacteria do not have peptidoglycans in their cell wall

d. True

Methanogenic archaeobacteria are those that use carbon dioxide and hydrogen to produce methane. They are found in the digestive system of ruminants, sewers and swamps.

Final answer:

The incorrect statement is that only bacteria have histones associated with DNA because both archaea and eukaryotes have histones, highlighting a common misconception about cellular biology. Option c

Explanation:

The statement that is not true among the given options is c. Only bacteria have histones associated with DNA. This is because both archaea and eukaryotes have histones associated with their DNA, which is contrary to what the statement implies. Let's clarify the true statements:

Archaea and bacteria have different membrane lipids: Indeed, archaea have membrane lipids that are ether-linked with branches (phytanyl), whereas bacteria have ester-linked fatty acids.

The cell walls of archaea lack peptidoglycan: Correct, archaea typically do not have peptidoglycan in their cell walls, which is a major component in the cell walls of bacteria.

Only some archaea use CO₂ to oxidize H₂, releasing methane: True, this is a process known as methanogenesis and is specific to certain archaea known as methanogens.

Therefore, the myth about histones being exclusive to bacteria is debunked, showcasing that archaea share this characteristic with eukaryotes, not bacteria. Option c

Cancer is often the result of activation of ________to ________ and the inactivation of _______ genes.
A) oncogenes, tumor-suppressor genes, proto-oncogenes
B) oncogenes, proto-oncogenes, tumor-suppressor genes
C) proto-oncogenes, oncogenes, tumor-suppressor genes
D) proto-suppressor genes, suppressors, oncogenes

Answers

Answer:

Option (C).

Explanation:

Cancer may be defined as the phenomena of the uncontrolled growth of the cell division and the cells require less nutrient medium to grow. Two main types of tumor are benign tumor and malignant tumor.

Proto- oncogenes generally regulates the growth and metabolism. The mutation may leads to the formation of proto-oncogenes to the oncogenes. These oncogenes are responsible for the formation of cancer. The main function of tumor suppressor gene is the suppressor inactivates the tumor genes. There suppression may result in the formation of tumor.

Thus, the correct answer is option (C).

Final answer:

Cancer development involves the mutation of proto-oncogenes into oncogenes, resulting in uncontrolled cell growth, and the inactivation of tumor-suppressor genes, which fail to put the necessary checks on this growth. The correct answer to the question is C) proto-oncogenes, oncogenes, tumor-suppressor genes.

Explanation:

Cancer is often the result of activation of proto-oncogenes to oncogenes and the inactivation of tumor-suppressor genes. Therefore, the correct answer is C) proto-oncogenes, oncogenes, tumor-suppressor genes.

Proto-oncogenes are genes that normally help cells grow. When these genes are mutated, they can become oncogenes, which may cause cells to grow out of control. Oncogenes can be thought of as a car's accelerator stuck in the 'on' position. On the other hand, tumor-suppressor genes are like the brakes of a car; when these genes are turned off or inactivated, cells can multiply uncontrollably because there's nothing to stop them.

In summary, cancer development can be compared to a failing car's cruise control, where there is an overactive accelerator (due to oncogenes) and malfunctioning brakes (due to inactivated tumor-suppressor genes).

What causes a heart attack?
A. A blockage in the aorta
B. genetics
C. A blockage in the carotid arteries
D. A blockage in an artery in the brain
E. A blockage in an artery anywhere in the body

Answers

Answer: A. A blockage in the aorta

Explanation:

A heart attack happens when one or more aorta or coronary arteries get blocked. With the passage of time, the coronary artery becomes narrow that is because of the deposition of various substances such as fat, cholesterol and other reserves. This restricts the smooth circulation of blood hence results in heart attack or heart stroke.

Final answer:

A heart attack is usually caused by a blockage in a coronary artery due to atherosclerosis, with genetics and lifestyle factors influencing the risk.

Explanation:

The cause of a heart attack, also known as myocardial infarction, is usually a blockage in a coronary artery, which supplies blood to the heart muscle. This blockage is often a result of atherosclerosis, a condition where cholesterol plaque builds up in the arteries and can rupture, forming a clot. This clot obstructs the flow of blood, depriving the heart muscle of oxygen and nutrients, leading to damage or death of the heart muscle cells. Genetics and lifestyle choices such as diet, exercise, and smoking can contribute to the risk of heart attack. A blockage in an artery in the brain or carotid artery can lead to a stroke, not a heart attack.

Learn more about heart attack here:

https://brainly.com/question/38036797

#SPJ12

What is the difference between a disk-diffusion test and a kirby-Bauer test? Why is Mueller-hinton agar used in the kirby-bauer test?

Answers

Answer:

The Kirby-Bauer test and disk diffusion are the same.

Explanation:

Kirby-Bauer antibiotic disk diffusion is used for bacterial susceptibility testing. Mueller-hinton (MH) agar is used as it is the best medium for daily antibiotic testing as it supports growth of non-fastidious organisms. Furthermore, MH controls the rate of antibiotic diffusion through the agar.

Which is considered to be a process by which electrons aregenerally
removed frombiomolecules catabolism or anabolism?
You must spell out the answercorrectly to receive credit.

Answers

Answer:

Catabolism

Explanation:

Catabolism refers to the metabolic pathways to break down the complex biomolecules into simpler substances and release the energy stored in their chemical bonds.

The catabolic reactions are oxidizing reactions and remove the electrons from the substances.

For example, cellular respiration is a catabolic pathway for glucose as it oxidizes glucose into CO2 and H2O. During aerobic cellular respiration, molecular oxygen serves as the terminal electron acceptor and is reduced into water.

The Suillus lakei mushroom is commonly found
growingaround the bas of conifers, especially the Douglas fir.
Offer apossible explanation of this association of a fungus and
plant.

Answers

Answer:

Suillus lakei mushroom refers to a mycorrhizal fungus, which grows in company with Douglas fir, and can be witnessed in the locations where this tree is found.  

This association illustrates a symbiotic relationship, known as mycorrhizae, which is produced between the plant and the fungi. The fungi colonize the root system of the host plant, in this case, Douglas fir, and provide enhanced nutrient and water absorption tendencies, while the plant offers the fungus with carbohydrates produced from the process of photosynthesis.  

Final answer:

The Suillus lakei mushroom's preference for growing around conifers, particularly the Douglas fir, can be a result of a mycorrhizal association. This symbiotic relationship allows the fungus to draw nutrients from the tree, while also offering benefits to the plant such as increased nutrient and water uptake.

Explanation:

The Suillus lakei mushroom, commonly associated with conifers like the Douglas fir, is a perfect example of a symbiotic relationship known as mycorrhizal association. In this mutually beneficial relationship, the mushroom obtains nutrients from the tree's root system, particularly the sugars produced through photosynthesis.

In return, the fungus helps the tree by increasing its water and nutrient absorption capacity from the soil, as fungal mycelium forms a vast network that can reach sources of nutrients and water far beyond the tree roots' range. Thus, the mushroom's habitat preference can be driven by a combination of nutritional need and a unique ability to form productive symbiotic relationships with some specific trees like the Douglas fir.

Learn more about Mycorrhizal association here:

https://brainly.com/question/9127068

#SPJ11

What is the significance of the industrial practice of waiting for cultures to enter the stationary phase of growth before harvest?
a. An optimal combination of primary and secondary metabolites is being produced.
b. Secondary metabolites are often the desired product, and are only produced in stationary phase.
c. The desired primary metabolites are produced in stationary phase.
d. The cells are at peak metabolic activity.
e. Potential toxins from log phase growth have been depleted

Answers

Answer: b. Secondary metabolites are often the desired product, and are only produced in stationary phase.

Explanation:

The secondary metabolites are the organic compounds that are produced by the microbes such as bacteria, fungi and even by the plants. These are not involved in the growth, development and reproduction of the organisms. But they can provide a advantage for the survival. It helps in plant defense against the process of herbivory and other interspecies defense. Humans take the secondary metabolites from these organisms in the form of medicines, pigments, and recreational drugs.  

The secondary metabolites are produced only in the stationary phase of growth. Thus it is significant for the collection of these secondary metabolites in the stationary phase.

The largest unit within which gene flow can readily occur is a
a. population c. genus.
b. species d. hybrid.

Answers

Answer:

a. population

Explanation:

Gene flow cannot occur in hybrids because 99.9% of the time hybrids offspring are not fertile.

At genus level is not possible either because a hybrid is a cross breed at the genus level (horse-donkey).

A population is a group of species of 1 kind. A population of donkeys.

The outer layer of a virus is called a capsid and is made of protein.
a. True
b. False

Answers

Answer:

a. True

Explanation:

Viruses are nor living nor non-living things. They do not metabolize, and only consist of nucleic acid in the inside of a protein cover which protects it. This proteinous layer is known with the term capsid, and is usually formed by units of certain proteins called capsomeres. Besides protection, these proteins serve as the structures that actually allows viruses contact and adhere to host cells during infection, that's why they are key components for the viruses success.

Which of these occurs first?
a. Helicase unwinds DNA
b. Sliding clamp binds around DNA
c. DnaA binds at the origin of replication
d. DNA pol III copies DNA

Answers

Answer:

The correct answer is a.  Helicase unwinds DNA

Explanation:

DNA replication is a process in which DNA make it's own copy. There are several enzymes and factors which access the DNA replication process like helicase, primase, SSB protein, DNA polymerase etc.

The first step in DNA replication is the unwinding of double stranded DNA which is accomplished by an enzyme called Helicase. Helicase opens up the double stranded DNA at replication fork by breaking the hydrogen bond between the nucleotides of complementary strands.

This provides a single stranded template for DNA polymerase to form a new complementary strand. In E. coli Dna B is the primary helicase and in humans the primary helicase is MCM( minichromosome maintenance protein complex).

Which of the following is NOT a function of Sertoli cells?
A. Synthesis of inhibin.
B. Removal of damaged germ cells.
C. Production of seminiferous tubular fluid.
D. Production of primary spermatocytes.
E. Formation of Blood-testis barrier

Answers

Sertoli cells do not produce primary spermatocytes (option D); instead, they support spermatogenesis, create a blood-testis barrier, produce tubular fluid, remove damaged germ cells, and secrete inhibin.

The function that is NOT a function of Sertoli cells is D. Production of primary spermatocytes. Sertoli cells, also known as sustentacular cells or sustentocytes, indeed have several important roles in sperm production within the seminiferous tubules of the testes. They also form the blood-testis barrier, produce substances such as inhibin that regulate spermatogenesis through a negative feedback mechanism, create, seminiferous tubular fluid, and remove damaged germ cells. However, the production of primary spermatocytes is not one of their functions. Primary spermatocytes are derived from germ cells and undergo meiosis to form spermatids, which are then transformed into mature spermatozoa. The Sertoli cells support this process but do not produce the spermatocytes themselves.

Which of the following are phagocytic?
a. neutrophils only
b. lymphocytes only
c. monocytes and macrophages
d. all of these cells are phagocytic
e. macrophages only
f. monocytes, macrophages and neutrophils
g. monocytes only

Answers

Answer:

The correct answer is option F. monocytes, macrophages and neutrophils.

Explanation:

Phagocytic cells are the cells that engulf harmful substances or foreign particles,  bacteria and other dead cells. These cells destroy them by engulfing the foreign particles and degrade them by chemical releases.

The phagocytic cells include - monocytes, macrophages, neutrophils, and dendritic cells. All these three types of cells are further divided. The neutrophils are the first cell to appear at the site of the infection or injury.

Thus, the correct answer is option F. monocytes, macrophages and neutrophils.

Genetic variation in bacterial populations cannot result from

a.transduction c.mutation

b.conjugation d.meiosis.

Answers

Answer:

d. meiosis

Explanation:

Bacterial cells don't go through meiosis, it is unique to the eukaryotic cells.

Final answer:

Genetic variation in bacterial populations cannot result from meiosis, but it can occur through other mechanisms such as a. transduction, c. mutation, and b. conjugation.

Explanation:

Genetic variation in bacterial populations cannot result from meiosis because meiosis is a process that only occurs in eukaryotic cells, not in prokaryotic bacteria. However, genetic variation in bacterial populations can occur through other mechanisms such as transduction, mutation, and also conjugation.

In addition to this, the process of transduction involves the transfer of genetic material between bacterial cells by viruses. Mutation is the spontaneous change in the DNA sequence, which can result in new genetic variations. Conjugation is a process where bacteria directly exchange genetic material, usually plasmids, with other bacteria.

What is fever and explain why it is considered to be a nonspecific immune response?

Answers

Answer:

Body of an organisms have a range of the normal temperature that is maintained by the body by homeostasis. When the range of the body temperature rise above that range it it known as fever. The normal temperature of human body is normally 36-37 degree centigrade. Mild fever is not need any assistance to bring it back to normal range it is doe by the body to fight against infection or change takes place. Fever can be measured in mouth, rectum, and underarms.

It is considered as nonspecific response mechanism as it is take place due to different type of reasons and its affect or mechanisms is same for all, not specific as the cell mediated or antibody mediated responses of specific defense mechanism.

In binomial nomenclature, the more general of the two names comes second.
a. True
b. False

Answers

Answer:

False

Explanation:

As one moves from species to kingdom in a taxonomic hierarchy, the categories become more general. This is due to the grouping of distantly related organisms in a higher category as compared to the evolutionary relationships between the organisms of a lower category.

In binomial nomenclature, the name of the genus is written first followed by the name of the species.

Since the genus is a "more general category" than a species, the more general category is mentioned first in binomial nomenclature.

Passive expiration is preceded by the:
a. recoil of the lungs
b. contraction of the internal intercostals muscles.
c. contraction of the diaphragm.
d. increase in atmospheric pressure.
e. increase in CO2 in the blood

Answers

Answer:

The correct answer is option a. "recoil of the lungs".

Explanation:

Normal respiration is passive, which means that no energy is needed to release the air from the lungs. Passive respiration is preceded by the recoil of the lungs that happens without any effort because of the elasticity of the lungs tissue. After inspiration, the diaphragm and intercostal muscles relax and the thoracic cavity and lungs decrease in volume. This causes that the interpulmonary pressure rises above atmospheric pressure, creating an air pressure gradient that put the air out of the lungs without the need of energy.

Which of the following processes is activated by insulin?
A. Triacylglycerol breakdown
B. Gluconeogenesis
C. Glycogenolysis
D. Fatty acid synthesis
E. Adenylate cyclase activity

Answers

Answer: Gluconeogenesis

Explanation:

Gluconeogenesis is a pathway that is used by the body to create glucose from the other molecules. It is an important pathway that allows the body to store energy for brain in the form of glucose.

This process is regulated by insulin, which helps in this process of storing energy. Insulin inhibits the secretion of glycogen which is a activator of gluconeogenesis.

This hormone helps in maintaining a significant amount of glucose in the blood and rest of the glucose is stored for the vital organs of the body.

How does a mutation in the RAS gene lead to uncontrolled cellular division?
A. The RAS protein becomes stuck in the "on" position.
B. The RAS protein can no longer act as a tumor suppressor.
C. The RAS protein becomes stuck in the "off" position.
D. The RAS protein gets stuck in the plasma membrane.
E. The RAS protein can no longer act to repair DNA damage.

Answers

Answer: I would think A but get a second opinion to be 100% sure, okay.

If the question were why can’t a mutated RAS gene stop uncontrolled cellular division/cancer I could easily answer the question. So if you also need that answered I could just saying.

The correct answer is A. The mutation in the RAS gene leads to uncontrolled cellular division because the RAS protein becomes stuck in the on position.

RAS genes encode for proteins that are involved in the transmission of signals within cells. These signals are critical for the regulation of cell division. Normally, RAS proteins function as molecular switches that cycle between an on state, where they are active and can transmit signals, and an off state, where they are inactive. This cycling is tightly regulated by the binding and hydrolysis of GTP (guanosine triphosphate) to GDP (guanosine diphosphate). When a mutation occurs in the RAS gene, the RAS protein can lose its ability to hydrolyze GTP to GDP, which means it can become stuck in the on position. As a result, the RAS protein continues to transmit signals for cell growth and division even in the absence of external growth factors. This leads to uncontrolled cellular proliferation, which is a hallmark of cancer. To clarify the other options: B. The RAS protein can no longer act as a tumor suppressor. - This option is incorrect because RAS is not a tumor suppressor; it is a proto-oncogene. When mutated, it can become an oncogene that promotes cancer. C. The RAS protein becomes stuck in the off position. - This option is incorrect because it is the on position that leads to continuous signaling for cell division. D. The RAS protein gets stuck in the plasma membrane. - While it is true that RAS proteins are located in the plasma membrane to function properly, simply being stuck in the membrane is not what leads to uncontrolled cell division. It is the inability to turn off the signal due to the mutation that causes the problem. E. The RAS protein can no longer act to repair DNA damage. - This option is incorrect because RAS is not directly involved in DNA repair. Its primary role is in signal transduction pathways that control cell growth and division.

Name the three essential active site residues of chymotrypsin and describe how each is involved in the catalytic mechanism.

Answers

Answer:

The active site residues include Serine, Histidine and Aspartatic acid

Explanation:

The catalytic triad at the active site of Chymotrypsin includes Ser-105 (Serine), His-57 (Histidine) and Asp-102 (Aspartic acid).

His-57: Deprotonates and polarizes Ser-105 so that it is able to react with substrate.

Asp-102: The carboxyl group of Asp-102 hydrogen bonds with the R-group of the His-57 which facilitates the deprotonation of Ser-105.

Ser-105: The strong nucleophile of serine attacks the substrate leading to hydrolysis.

What are the monomers of nucleic acids called?
a. amino acids
b. monosaccharides
c. carbon
d. nucleotides

Answers

Answer:

Nucleotides.

Explanation:

Two types of nucleic acids are DNA and RNA. DNA is present as the genetic material in all the living organisms except some viruses. RNA is present as genetic material in some viruses only.

DNA is made of the polymers of nucleotides. The nucleotides consists of the nitrogenous bases (adenine, guanine, thymine and cytosine), deoxyribose pentose sugar and phosphate group. The RNA consists of oxyribose sugar and uracil instead of thymine.

Thus, the correct answer is option (d).

Name one enzymatic step of the TCA cycle wherein a universal electron carrier (in its reduced form) is a product of the reaction: ____________

Answers

Answer:

Oxidation of Malate to Oxaloacetate by Malate Dehydogenase

Explanation:

An electron carrier is able to accept and donate electrons in a reaction. The most popular is NADH. NADH in its oxidized form is NAD+. NAD+ received two (2) electrons and an H+ to be reduced to NADH. Other electron carriers are NADPH & FADH₂

There are several steps in the TCA where NAD+ is reduced to NADH by accepting an electron. One of this step is the last step where malate is oxidized and is converted back to oxaloacetate the beginning  molecule of the cycle.

Other Questions
to create a formula in______, you would first click in one of the cells Dr. Han is studying which brain structure is associated with aggressive behavior among rats. Which part of the brain is she likely to see activated when using neuroimaging techniques? Please i need big helpChoose the adjective clause in the following sentence: The jeans that I want to buy are very expensive.to buyare very expensivethe jeans thatthat I want to buyI want True or false tasks are required activities that need to take place in order to complete a goal Two train whistles have identical frequencies of 175 Hz. When one train is at rest in the station and the other is moving nearby, a commuter standing on the station platform hears beats with a frequency of 4.05 beats/s when the whistles operate together. What are the two possible speeds and directions the moving train can have? slower speed m/s Correct: Your answer is correct. faster speed m/s Changed: Your submitted answer was incorrect. Your current answer has not been submitted. The processivity of a DNA polymerase depends on all of the following actions, EXCEPT for __________. A. association of the DNA polymerase with a sliding clamp (like eukaryotic PCNA) B. interaction between the thumb domain of DNA polymerase and the DNA C. interaction between the minor groove of DNA and the palm domain of the DNA polymerase D. loss of the hydrogen from the 3-OH of the primer due to interaction with a divalent metal ion associated with the palm domain of the DNA polymerase the romans introduced and estabished a common system of written laws why was that important The economy of early villages and cities was based mainly on What is the solution to 4x+5y=12x6y=22 Edouard Daladier became Prime Minister of which country in 1933? A __________ is a wide-mouthed body of water close to shore. Cusic Industries had the following operating results for 2019: sales = $34,621; cost of goods sold = $24,359; depreciation expense = $6,027; interest expense = $2,725; dividends paid = $2,023. At the beginning of the year, net fixed assets were $19,970, current assets were $7,075, and current liabilities were $4,010. At the end of the year, net fixed assets were $24,529, current assets were $8,702, and current liabilities were $4,700. The tax rate was 25 percent. a. What is net income for 2019? (Do not round intermediate calculations.) b. What is the operating cash flow for 2019? (Do not round intermediate calculations.) c. What is the cash flow from assets for 2019? (A negative answer should be indicated by a minus sign. Do not round intermediate calculations.) d-1. If no new debt was issued during the year, what is the cash flow to creditors? (Do not round intermediate calculations.) d-2. If no new debt was issued during the year, what is the cash flow to stockholders? (A negative answer should be indicated by a minus sign. Do not round intermediate calculations.) Evaluate M2/P2 for M = 10, N = -5, and P = -2? A.-5 B.5 C.-25 D.25 Read the sentences. Sentence 1: I hope the dinner comes out perfectly, but even if it doesnt, Im pretty sure theyll know how hard I tried. Sentence 2: Then well have coffee cake for dessert, which I made from scratch. Sentence 3: I am making my sisters favorite: roasted chicken, brown rice, and brussels sprouts. Sentence 4: I cannot wait to cook dinner for my family tonight. What is the most logical sequence for these sentences in a story? 1, 3, 2, 4 4, 1, 3, 2 4, 3, 2, 1 3, 2, 1, 4 An RNA virus that infects plant cells is copied into a DNA molecule after it enters the plant cell. What would be the sequence of bases in the first strand of DNA made complementary to the section of viral RNA shown here? 5' CCCUUGGAACUACAAAGCCGAGAUUAA 3' Reasoning if you multiply two decimals that are less than 1,can you predict whether the product will be less thanor greater than either of the factors? Explain What is the greatest common factor of 19 and 18? What happened as a result of the Sand Creek Massacre? Please select the word from the list that best fits the definition Likes to study with music in the background Which function has the given graph?