Answer:
Explanation:
Alfred Hershey and Martha Chase showed that DNA is the genetic material by their blending experiment. Earlier it was believed that protein is the genetic material. As it is found in a larger amount in the cell.
Hershey and Chase infected the bacteria E coli with the T2 phage virus. In the bacteria, the viral DNA is replicated as the bacterial DNA. They prepare 2 culture media one contains radiolabeled phosphorus (32P) and another has radiolabeled (35 S)sulfur. Then he cultures the bacteria in separate culture medium and infected with many T2 phages.
After the infection, they isolated the infected cell and centrifuge the cells. When they tested separate supernatant of 2 culture mediums, they found the virus of radiolabeled phosphorus doesn't show any radioactivity. But the virus in the radiolabeled sulfur contains the radiolabeled.
The viruses have 2 biomolecules one is protein and the other is DNA/RNA. When they have centrifuged the cells which are the palette, the phosphorus is found there and it also degrades. But the sulfur which is present in the supernatant is present in the newly replicated viruses.
He also treated the virus with both the culture medium but newly infected cells show radiolabeled sulfur, not the phosphorus. Thus they concluded DNA is the genetic material.
A stack of thylakoids are known as
a. Thylakoid discs
b. Grama
c. thylakoid lumen
d. Stroma
A stack of thylakoids in a chloroplast is called a granum, which is the correct answer to the question.
Explanation:A stack of thylakoids within a chloroplast is known as a granum (plural = grana). Thylakoids are disc-shaped, membrane-bound structures where the light-dependent reactions of photosynthesis take place. Each thylakoid disc contains chlorophyll, which is responsible for the initial interaction between light and plant material. The inner membrane space that surrounds the grana is termed the stroma. Therefore, the correct answer to the question is 'b. Grama'. Thylakoids are disc-shaped, membrane-bound structures where the light-dependent reactions of photosynthesis occur.
Which of the following BEST describes transcriptional regulation of the lac operon in E. coli?
a. On in the presence of lactose
b. On in the presence of lactose and presence of glucose
c. Off in the presence of glucose
d. On in the absence of lactose and presence of glucose
e. On in the presence of lactose and absence of glucose
Answer:
E. On in the presence of lactose and absence of glucose
Explanation:
Expression of lac operon synthesizes the enzymes required for catabolism of lactose sugar. When both glucose and lactose are available, glucose is preferred as a nutrient and the lac operon is not expressed.
Lac operon is expressed only when glucose is absent in the medium and lactose is present. If any of the two conditions deviate, the operon is not expressed.
In the absence of glucose and the presence of lactose, the repressor is rendered inactive to bind to the operator. RNA polymerase enzyme is free to bind to the promoter and continue the process of transcription.
The reduced levels of glucose increase the cAMP levels which in turn bind to the Catabolite activator protein (CAP). CAP is a positive regulator that binds to the promoter to facilitate the transcription of the operon by RNA polymerase.
The lac operon in E. coli is 'on' in the presence of lactose and the absence of glucose, allowing the bacteria to respond efficiently to changes in the nutritional environment.
Explanation:The transcriptional regulation of the lac operon in E. coli is a complex process. 'e. On in the presence of lactose and absence of glucose' best describes this regulation. The lac operon is activated, or 'turned on', in the presence of lactose when glucose is not present. If glucose is available, the bacteria preferentially use glucose, and the lac operon is turned off. The lac operon system thus helps the bacteria efficiently respond to changes in the nutritional environment.
Learn more about lac operon here:https://brainly.com/question/33360857
#SPJ3
A column on the periodic table is called a group. Which statement would not support the conclusion that two elements are in the same group?? A) The two elements both have similar atomic radii B) The two elements both have very high melting points C) The two elements both are highly reactive in oxygen D) The two elements both bonds with chlorine to form a salt in a 1 to one ratio
Answer: Option (A) is the correct answer.
Explanation:
A group in a periodic table is represented by a column. And, when we move down a group then there occurs an increase in atomic size or atomic radii of the elements.
This is because number of electrons add into new shells which leads to increase in atomic radii of the element.
Therefore, if we say that two elements in a group have similar atomic radii then it is false.
Whereas the two elements of a group might have a high melting point.
Also the statements, the two elements both are highly reactive in oxygen and the two elements both bonds with chlorine to form a salt in a 1 to one ratio can be true for elements of the same group.
Thus, we can conclude that the statement two elements both have similar atomic radii would not support the conclusion that two elements are in the same group.
The statement that would not support the conclusion that two elements are in the same group is B) The two elements both have very high melting points.
Explanation:The statement that would not support the conclusion that two elements are in the same group is B) The two elements both have very high melting points. Grouping elements in the same group is based on their similar chemical properties, not on their physical properties such as melting points. For example, elements in the same group may have different melting points due to varying atomic structures and bonding.
How many membranes does the chlorplast have?
a. 1
b. 2
c. 3
d. 4
Answer:
B
Explanation:
Chloroplasts have two membranes: external and internal membrane. These membranes contain 60% of lipids and 40% of proteins, just like the typical cell membranes. The inner or internal membrane is virtually non-permeable to any substances but it has transport proteins, on the other hand, the outer or external membrane is permeable to most of the small molecules
Luteinizing hormone is bound to transport proteins in the plasma.
a. True
b. False
Answer:
FALSE
Explanation:
Luteinizing hormone, also known as the lutropin, is a heterodimeric glycoprotein produced by the gonadotropic cells of the anterior pituitary gland.
The function of the luteinizing hormone in males is the secretion of the progesterone hormone. Whereas, in females, the acute rise of this hormone triggers ovulation, maintains the corpus luteum and is also responsible for the secretion of progesterone hormone.
A nucleosome forms hydrogen bonds with what part of the DNA? A nucleosome forms hydrogen bonds with what part of the DNA? only with bases via the major groove with the phosphodiester backbone and with bases via the minor groove only with bases via the minor groove with the phosphodiester backbone and with bases via the major groove
Answer:
A nucleosome forms hydrogen bonds with the phosphodiester backbone and with the bases through the minor groove. The histone-fold hydrogen bonds with both the A: T enriched bases and the phosphodiester backbone. The histone-fold domains' association with the minor groove is responsible for the majority of the associations in the nucleosome.
Final answer:
A nucleosome forms hydrogen bonds primarily with the phosphodiester backbone of DNA, facilitated by interactions at the L1-L2 loops and αl helices, including minor groove entry by arginine side chains from histone folds. These arrangements enable efficient DNA packaging and sequence-independent binding necessary for nucleosome function.
Explanation:
A nucleosome forms hydrogen bonds with the phosphodiester backbone of DNA. These interactions are fundamental for DNA packaging within the nucleus, ensuring DNA is wrapped around histone proteins to form nucleosomes. The L1-L2 loops at the ends of each histone dimer and the αl helices at the center of the DNA binding site are primary contact points, where hydrogen bonds are formed between amino acids of the histones and the phosphate backbone of DNA. Additionally, arginine side chains from histone folds enter the minor groove of DNA, influencing the DNA's structural dynamics within the nucleosome.
These interactions allow nucleosomes to bind to DNA in a non-sequence-specific manner, which is crucial for their role in DNA packaging and regulation. The presence of water-mediated interactions and the flexibility in binding accommodate the DNA's varying sequences and structures, enabling nucleosomes to organize DNA efficiently within the cell nucleus.
What are the advantages of being a respiratory parasite (the tongue worms) over one in the digestive system (if any)?
Answer:
Explanation:
The parasites living at the respiratory system or tongue worms will hide under the soft tissues of the oral cavity, beneath the tongue and even beneath the throat or esophagus. These worms remain undetected during diagnosis. These worms are not subjected to the treatment of acids which worms in the digestive system are exposed to. Thus these worm parasites in the respiratory system or tongue survive comparatively for long as compared to the worms in the digestive system.
Would you expect a shrub or dandelion (dispersed by wind-blown seed) to be a more likely pioneer plant species? why? Thank you so much for helping! means a lot !
Answer:
Dandelions may appear quicker after harsh conditions and reproduce at a faster rate. However, both dandelions and shrubs are considered fast-growing plant species that can be categorized as pioneer species.
Explanation:
Secondary succession refers to the changes that take place in a disturbed habitat. Pioneer plant species are those that colonize new habitats after harsh climate conditions and that tend to reproduce at a fast rate.
According to researcher J.W. Darlling (2008), pioneer herbs and shrubs are species that tend to grow faster in comparison to other species, making them excellent pioneer species.
This occurs thanks to plants that are wind-pollinated, such as dandelions, have a higher chance to appear because, as it is a disturbed environment, there are no insects or other fauna present. In addition, shrubs are persistent species that are able to reproduce fast with limited soil availability but a bit slower in comparison to dandelions.
A dandelion (dispersed by wind-blown seed) would be a more likely pioneer plant species because wind-dispersed seeds enable rapid colonization of disturbed or barren environments, while shrubs may take longer to establish.
I would expect a dandelion (dispersed by wind-blown seed) to be a more likely pioneer plant species. Pioneer plant species typically need to colonize disturbed or barren environments quickly, and wind-dispersed seeds like those of dandelions have the advantage of being able to spread over long distances and establish themselves rapidly in new areas.
Additionally, dandelions are known for their ability to grow in a variety of soil conditions and climates, making them well-suited to colonize and stabilize the soil in harsh or unpredictable environments. In contrast, shrubs might take longer to establish themselves and may not have the same capacity for rapid colonization as plants with wind-dispersed seeds.
The bases of one of the strands of DNA in a region where DNA replication begins are shown here. What is the sequence of the primer that is synthesized complementary to the bases in bold? (Indicate the 5' and 3' ends of the sequence.) 5' AGGCCTCGAATTCGTATAGCTTTCAGAAA 3'
Answer:
Complementary primer- 3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'
Explanation:
The synthesized primer will have base pair complementary to the given strand and also the leading and lagging ends will be opposite to the given strand.
As per the base pair rule for DNA
Guanine binds to cytosine & vice versa
Adenine always binds to thymine & vice versa
Given Sequence - 5' AGGCCTCGAATTCGTATAGCTTTCAGAAA 3'
Complementary primer- 3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'
Identify and describe the portals through which pathogens invade the human body.
Answer:
Contamination signifies the possible existence of microbes in or on the body. Infection is considered as the successful invasion of the pathogen in the body. The pathogens can acquire access or can invade the body of a human being with the help of portals, like via the skin, placenta, and mucous membranes.
The parenteral route is not precisely considered as a portal, however, it is a way of circumventing the general portals.
Where would you find a Riboswitch?
Answer:
The correct answer will be- in the 5' untranslated region of prokaryotic mRNA.
Explanation:
Riboswitches are the cis-regulatory RNA elements present in the non-coding segment of the mRNA.The riboswitches are common in prokaryotes but research showed that they are also present in the few eukaryotes. They are located in the non-coding 5' untranslated region of prokaryotic mRNA.
The riboswitches are usually made of 35 to 200 nucleotides which can bind to co-enzymes, small molecules and metabolites and change their conformation to regulated gene expression.
Thus, in the 5' untranslated region of prokaryotic mRNA is the correct answer.
Cystic fibrosis is a genetic disorder caused by a recessive allele. If two parents each carry an allele for the disorder but have normal phenotypes, indicate what percentage of their children will be phenotypically normal and what percentage will have cystic fibrosis.
Answer: 75% normal phenotype, 25% cystic fibrosis.
Explanation:
Since cystic fibrosis is caused by a recessive allele, then it needs both affected alleles to develop. If the parents have normal phenotyps but they carry one allele for the disorder, then their genotypes will be Cc for both (they are heterozygous).
C is the dominant allele that codes for the trait, and c is the affected allele.
They only have one copy of the affected allele, thereby they will not develop cystic fibrosis.
The next step is to find out the genotypes of the gametes.
Gametes are sex cells, sperm or eggs produced by the parents. Those cells only have one allele of the gene, that means the gametes produced by them can be either C or c. Those gametes are used in the punnett square as shown in the picture.
There we can see 50% of the offspring is Cc, 25% is cc and 25% is CC.
As it was stated before, individuals who are cc will develop cystic fribrosis. Then, 25% of them will have it. And 75% of them (25% of CC + 50% of Cc) will not.
Which of the following combinations is most likely to result in digestion?
a. pepsin, protein, water, body temperature
b. pepsi, protein, water, body temperature, HCl (hydrochloric acid)
Explain.
Answer:
Option (b).
Explanation:
Digestion may be defined as the process of break down of large food particles into simpler substances that be absorbed by the body. Specific enzymes are required for the breakdown of specific chemicals.
The combination that contains protein, water, HCl (hydrochloric acid), temperature and pepsin result in digestion. HCl (hydrochloric acid) activates the enzyme pepsinogen into pepsin. The pepsin than digest the proteinsat the body temperature in presence of water. Proteins are broken down into simple amino acids that can be seen as a result of digestion.
Thus, the correct answer is option (b).
1. Plants carry out chemical reactions that make sugars, which contain carbon, hydrogen, and oxygen, from carbon dioxide (CO2) and water (H2O). Researchers want to know whether the oxygen atoms in sugar come from the carbon dioxide or the water. How could they use radioactive tracers to find out? Design an experiment that investigates this question. Be sure to include the following elements in your experimental design: hypothesis, procedure, control group, experimental group.
Answer:
Radioactive labeling is a procedure used to monitor the path followed by a chemical element within a biological system to demonstrate the source.
Hypothesis:
The free oxygen produced during photosynthesis comes from water.
Procedure.
Single-celled algae were placed in four petri dishes containing carbon dioxide, glucose dissolved in Water.
In each box the oxygen was radioactively marked.
1 petri dish with CO2 marked. Experimental groups
2 petri dish with H2O marked. Experimental groups
3 petri dish with Glucose marked. Experimental groups (control)
4 petri dish with CO2 + H2O + Glucose, all marked. (control).
In maize (corn) plants, a dominant allele I inhibits kernel color, while the recessive allele i permits color when homozygous. At a different locus, the dominant allele P causes purple kernel color, while the homozygous recessive genotype pp causes red kernels. If plants heterozygous at both loci are crossed, what will be the genotypic and phenotypic ratios of the offspring?
Answer:
Phenotype ratio= 12 colorless : 3 purple : 1 red
Genotype ratio= 1:2:1:2:4:2:1:2:1
Explanation:
According to the given information, the dominant allele "I" is epistatic to P and p alleles and presence of "I" inhibits the expression of both "P" and "p" alleles.
A cross between two heterozygous plants for both locus would give the F2 progeny in 12 colorless: 3 purple: 1 red ratio.
Here, the F2 genotype with "I-G" and "I-gg" would produce colorless kernels while the ones with "ii-G-" would exhibit purple colored kernels. The F2 genotype "iigg" would beak red kernels.
Hence, the phenotype ratio= 12 colorless : 3 purple : 1 red
Genotype ratio would be same as for the mendelian dihybrid cross= 1 IIPP: 2 IIPp :1 IIpp: 2 IiPP :4 IiPp: 2 Iipp: 1 iiPP :2 iiPp: 1 iipp
When heterozygous maize plants are crossed, the genotypic ratio of the offspring will be 1IIpp:2Iipp:1iipp. The phenotypic ratio will be 1 purple:2 yellow:1 red.
Explanation:In the given scenario, the maize plants have two different gene loci: one for kernel color and the other for kernel color. The genotype for kernel color is represented by the alleles I (dominant, inhibits color) and i (recessive, allows color). The genotype for kernel color is represented by the alleles P (dominant, purple) and pp (recessive, red). When plants heterozygous at both loci are crossed, the genotypic ratio of the offspring will be 1IIpp:2Iipp:1iipp. The phenotypic ratio will be 1 purple:2 yellow:1 red.
Learn more about Mendel's experiments here:https://brainly.com/question/35864275
#SPJ3
Which of the following explains what happens to oxygen produced by the light-dependent reactions?
A) It is used in the Calvin cycle
B) It is released into the atmosphere.
C) It combines with NADPH to produce water.
D) It is recycled as a reactant in another light-dependent reaction
Answer:
The correct answer is option B.
Explanation:
The light-dependent reactions in the process of photosynthesis utilize Sun's light energy to dissociate water, known as photolysis. Water after getting dissociated produces hydrogen, oxygen, and electrons. The electrons move through the compositions in the chloroplasts and by the process of chemiosmosis, produce ATP.
The hydrogen gets transformed into NADPH, which is further utilized in the light-independent reactions. While oxygen diffuses out of the plant as a waste component of photosynthesis into the atmosphere. All this takes place in the grana thylakoids of the chloroplasts.
Explain how human cells compensate for the X-Iinked gene dosage difference in XX and XY nuclei.
Answer:
Dosage compensation in human includes inactivation of one X chromosome in all the cells of human females.
Explanation:
Human females have two copies of X chromosomes while the human males have only one X chromosome. To balance the X linked genes among human males and females, one of the two X chromosomes in the human females is inactivated randomly during early embryonic development.
The inactivated X chromosome is present in the form of a dark spot of chromatin near the nuclear envelope in each cell of human females. This inactivated X chromosome is called the Barr body.
Inactivation of one X chromosome in human females balances the total number of X linked genes between human males and females.
Explain how genetic information is stored in DNA and how this information is used to make functional proteins.
Answer:
The correct answer will be- codons and each codon specific for amino acids.
Explanation:
Deoxyribose nucleic acid is the genetic material of the organism which provides instructions for the organism. DNA is made up of nucleotide monomers which are composed of five-carbon sugar deoxyribose, a phosphate group and four types of nitrogenous bases (adenine, guanine, cytosine and thymine).
It is the arrangement of these nitrogenous bases which provide codes to the organism as it forms mRNA molecule through transcription. The sequence of the nitrogenous bases in mRNA is read by the ribosome during translation.
The ribosome reads the bases in triplets called "codon" which code for a specific amino acid. If the sequence of the base changes, therefore, the amino acid also changes. These amino acids bond to each other by peptide bond and form a protein molecule.
All of the following are products or intermediaries in glycolysis except
A) ATP.
B) NADH
C) FADH2.
D) pyruvate.
E) phosphoenolpyruvate.
Answer:
The correct answer for this is C, because the Fadh2 is only involved at the redox reactions.
Explanation:
ATP is just a product from glycolysis. Remember that when you break the glucose, energy is been free as an ATP molecule. NADH2 is a substratum, you need it, to get NAD at the fermentation process in the cytoplasmic matrix. Pyruvate and phosphoenolpyruvate are also products at the glycolysis.
Which of the following statements about the basic structural features of DNA are true? Select all true statements. Select all true statements. The major and minor grooves prevent DNA binding proteins from making contact with nucleotides. In a DNA macromolecule, the two strands are complementary and antiparallel. The twisting of the DNA double helix is attributed to the tight packing of DNA bases and base-stacking. The major and minor grooves form in the DNA helix because the DNA strands are antiparallel.
Answer:
Option (2) and (3).
Explanation:
DNA is the genetic material of all organisms except some viruses. DNA is composed of the nitrogenous base, pentose sugar and the phosphate group. DNA strands are complimentary to each other.
The DNA strands run in the opposite direction, one strand in 5' to 3' direction and other strand in 3' to 5' direction thus they are anti parallel with each other. The DNA strand can twist with each other which result in the tight packing of DNA base and base stacking. DNA consists of major and minor grooves.
Thus, the correct answer is option (2) and (3).
The true statements about the basic structural features of DNA include the complementary and antiparallel nature of the two strands, the twisting of the double helix due to base packing, and the formation of major and minor grooves.
Explanation:The true statements about the basic structural features of DNA are:
1. In a DNA macromolecule, the two strands are complementary and antiparallel. This means that one strand of DNA runs in the 3' to 5' direction, while the other strand runs in the 5' to 3' direction.
2. The twisting of the DNA double helix is attributed to the tight packing of DNA bases and base-stacking. The hydrogen bonds between the nitrogenous bases hold the two strands together and contribute to the helical structure of DNA.
3. The major and minor grooves form in the DNA helix because the DNA strands are antiparallel. These grooves are binding sites for DNA binding proteins during processes such as transcription and replication.
Of the 64 possible nucleotide codon triplets, how many specify polypeptide chain termination?
a. 61
b. 1
c. 2
d. 3
e. 64
Of the 64 possible mRNA codons, three are designated for polypeptide chain termination, also known as stop codons. The correct answer to the multiple choice question is d. 3.
In the universal genetic code, of the 64 possible mRNA codons, which are triplet combinations of the nucleotide bases Adenine (A), Uracil (U), Guanine (G), and Cytosine (C), a total of three specify polypeptide chain termination. These are often referred to as stop codons or termination codons. They include the codons UAA, UAG, and UGA, with UGA sometimes serving a dual function to encode selenocysteine—a rare 21st amino acid—given the presence of a SECIS element. The remaining 61 codons correspond to the addition of amino acids to the growing polypeptide chain during translation, with the codon AUG also doubling as the start codon for initiation of translation.
To answer the multiple choice question: Of the 64 possible nucleotide codon triplets, three specify polypeptide chain termination. So, the correct answer is d. 3.
Griffith, in his 1928 experiments, demonstrated that bacterial strains could be genetically transformed. The evidence that DNA was the "transforming principle" responsible for this phenomenon came later. What was the key experiment that Avery, MacCleod, and McCarty performed to prove that DNA was responsible for the genetic change from rough cells into smooth cells?
Griffith's experiment worked with two types of pneumococcal bacteria (a rough type and a smooth type) and identified that a "transforming principle" could transform them from one type to another.
At first, bacteriologists suspected the transforming factor was a protein. The "transforming principle" could be precipitated with alcohol, which showed that it was not a carbohydrate. But Avery and McCarty observed that proteases (enzymes that degrade proteins) did not destroy the transforming principle. Neither did lipases (enzymes that digest lipids). Later they found that the transforming substance was made of nucleic acids but ribonuclease (which digests RNA) did not inactivate the substance. By this method, they were able to obtain small amounts of highly purified transforming principle, which they could then analyze through other tests to determine its identity, which corresponded to DNA.
Final answer:
The key experiment by Avery, MacLeod, and McCarty that demonstrated DNA as the transforming principle involved degrading specific cellular components and observing that only when DNA was degraded did the transformation of R strain to S strain fail to occur.
Explanation:
Avery-MacLeod-McCarty Experiment
The pivotal experiment that proved that DNA was responsible for the genetic change from rough cells into smooth cells was performed by scientists Oswald Avery, Colin MacLeod, and Maclyn McCarty in 1944. Their experiment built upon Frederick Griffith's transformation experiments with Streptococcus pneumoniae, where he observed the transformation of nonpathogenic rough (R) strain into a pathogenic smooth (S) strain.
Avery, MacLeod, and McCarty systematically used enzymes to degrade specific components (proteins, RNA, and DNA) and observed the ability to transform the R strain. When DNA was destroyed, the transformation did not occur, leading them to the conclusion that DNA was the transforming principle. Thus, it was DNA that carried the hereditary information necessary for the transformation.
Which of the following statements about DNA structure is true? View Available Hint(s) Which of the following statements about DNA structure is true? The nucleic acid strands in a DNA molecule are oriented antiparallel to each other, meaning they run in opposite directions. Hydrogen bonds formed between the sugar‑phosphate backbones of the two DNA chains help to stabilize DNA structure. Nucleic acids are formed through phosphodiester bonds that link nucleosides together. The pentose sugar in DNA is ribose.
Answer:
The correct answer will be option- the nucleic acid strands in a DNA molecule are oriented antiparallel to each other, meaning they run in opposite directions.
Explanation:
Deoxyribose nucleic acid or DNA is the molecule which acts as the genetic material of the organisms.
The structure of DNA suggests that DNA molecule is made of two strands of nucleotides which are oriented in the opposite direction with respect to each other.
Each nucleotide is composed of a five-carbon sugar called deoxyribose bonded with a phosphate group via ester bond and four types of nitrogenous bases bonded to complementary bases via hydrogen bond.
The sugar-phosphate backbone runs in the opposite direction with a free 5' carbon atom of phosphate group end a 3' OH group of sugar. The orientation of strands is that one strand run from 5' to 3' direction while another runs from 3' to 5' direction.
Thus, the selected option is the correct answer.
DNA consists of two antiparallel strands forming a double-helix structure. Each strand is made of nucleotides linked with phosphodiester bonds, and the pentose sugar in DNA is deoxyribose.
Explanation:The correct statement about the structure of DNA is that the nucleic acid strands in a DNA molecule are oriented antiparallel to each other, meaning they run in opposite directions. DNA is composed of two strands that are twisted to form a double helix; each strand composed of nucleotides that include a nitrogenous base, a five-carbon sugar (deoxyribose), and a phosphate group. The two DNA strands are antiparallel, such that the 3' end of one strand faces the 5' end of the other, resulting in the nitrogenous bases of each strand facing inward and forming hydrogen bonds, which stabilizes the double helix structure. Nucleic acids are indeed formed through phosphodiester bonds that link nucleotides together, but the pentose sugar in DNA is not ribose, but deoxyribose.
Learn more about DNA Structure here:https://brainly.com/question/36469737
#SPJ11
Which of the following statements about eating disorders is false?
a. Demineralization of teeth tfrom exposure to stomach acid is a health issue associated with purging
b. Prolonged anorexia often leads to a reduced metabolic rate due to underproduction of thyroid hormones
c. Prevention of eating disorders involves weighing often.
d. The primary goal of nutrition therapy in anorexia nervosa is to have the patient slowy increase oral food intake
e. Bulimia most commonly occurs in adolescent and college age individuals
The correct answer is C. Prevention of eating disorders involves weighing often.
Explanation:
Eating disorders include multiple disorders that involve unhealthy eating habits as well as thoughts and emotions related to them. Individuals who suffer from these disorders constantly worry about their weight and appearance or have an unhealthy relationship with food, for example, individuals with anorexia or bulimia tend to believe they are "fat" even if they had low weight.
Due to this, weighing often is not a way of preventing eating disorders as this behavior just supports an unhealthy obsession with weight and appearance that can lead to eating disorders, instead, a balanced diet should be promoted and risk factors such as depression, anxiety, low self-esteem, etc should be addressed. Thus, the false statement is "Prevention of eating disorders involves weighing often".
How many different types of genotypes are possible when working various pea seed color problems?
a. 3
b. 4
c. 5
d. 6
e. 2
Answer:
Option A, 3
Explanation:
Primarily all pea seeds have two colors one is yellow and other is green.
Let green color allele be represented by "G" and yellow color allele be represented by "g".
When we start working on pea seed color problem, there can be following possible genotypes -
a) Heterozygous green color - Gg
b) Homozygous yellow color - gg
c) Homozygous green color - GG
Hence, option A is correct.
Distinguish between sister chromatids and non-sister chromatids.
Answer:
Sister chromatids:
The chromatids of replicated chromosome that are joined through a centromere is known as sister chromatids. These chromatids are identical to each other. They contains the same allele at similar loci. They are formed at the synthesis phase of cell cycle.
Non-sister chromatids:
The chromatids of the different homologous chromosomes are known as non-sister chromatids. These chromatids are non- identical to each other. They contains the different allele at similar loci. They are formed at the prophase I of phase of meiosis.
How might a protein kinase select the correct residues
tophosphorylate given the availability of serine and
threonineresidues on the surface of globular proteins?
Answer:
The flanking residues facilitate recognition and specificity.
Explanation:
The kinase is able to to specifically phosphorylate serine and threonine due to the recognition of the flanking residues. Altogether, these form a consensus sequence across the substrate.
is the transport of potassiun ions into the cell endergonic
orexergonic and why?
Answer: Endergonic
Explanation:
The sodium-potassium pump (Na+/K+ pump) moves sodium and potassium ions against its concentration gradient, which means in opposite directions through the membrane. Two potassium ions are imported into the cell while three sodium ions are exported.
This pump uses the energy derived from exergonic ATP hydrolysis. This means, ATP releases energy that will be used by the pump. Thereby the use of energy by the pump is an endergonic reaction, because it requires the absorption of energy to function.
So, when ATP is hydrolyzed, it donates free energy to the pump which goes under a conformational change, allowing it to move the ions.
What are some symptoms you might expect an individual suffering from anemia to exhibit?
Answer:
Anaemia is the major blood related disease whose symptoms can include the following.
1- weakness
2- tiredness
3- pale coloured skin
4- cold extremities
5- irritation
Explanation:
Anaemia is defined as the condition which arises due to lack of red blood cells. Red blood cells contain protein, haemoglobin, whose major constituent is iron. Human body uses iron to produce red blood cells in the bone marrow.
This haemoglobin helps red blood cells to transport oxygen to all the parts of human body. Oxygen gets attached to the haemoglobin and is carried all over the body. This oxygen is necessary for the cells of human body to function properly and survive.
Anaemia can be said to occur due to the lack of iron in human body. Lack of iron results in lack of red blood cells which results in decrease in oxygen supply to all the parts of the body.
Lack of oxygen hampers the normal functioning of human body as described below.
1- Capacity to work reduces and causes easy tiredness.
2- Weakness increases due to lack of iron.
3- The skin changes its colour, loses its shine and becomes yellowish showing lack of red blood cells.
4- The body temperature is also affected due to lack of oxygen. Hands and legs become cold.
5- Irritation increases. The patient becomes irritated easily due to weakness and fatigue.
Reasons for risk of anaemia
1- Disorder of intestine affects intake of nutrients by the small intestine. This increases chances of anaemia.
2- Menstrual cycle results in loss of blood. This also increases the chances of getting anaemia.
3- Anaemia can be hereditary. It can be genetically acquired.
4- Improper diet including heavy intake of coffee and tea also leads to Anaemia.
The severity of anaemia can vary from mild to severe. Treatment can be in the form of supplements for mild anaemia to medical procedures in case of severe anaemia.
Which of the following is
true aboutimprinting?
It may betriggered by visual or chemical
stimuli.
It happens tomany adult animals, but not to their
young.
It is a type oflearning that does not involve
innate behavior.
It results inbehaviors that cease after the
critical period.
Answer: It may be triggered by visual or chemical stimuli
Explanation:
Imprinting in pyschobiology is a phenomena of learning in animals. In this the young animals are exposed to one object or stimulus that can be visual, tactile, auditory and later on experience the other object or stimulus. This is tested on some birds such as chickens, geese, ducks also in some fishes, mammals and insects.