During world war ii, the united states and japan engaged in battle in the pacific region. how did the war between both nations come to an end?

Answers

Answer 1
the internment of Japanese Americans in the United States was the forced relocation and incarceration during World War II of between 110,000 and 120,000 people of Japanese ancestry who lived on the Pacific coast in camps in the interior of the country. Sixty-two percent of the internees were United States citizens.kamikaze

Related Questions

Which statement best describes the role of women at the front lines of World War I

Answers

Many women acted as nurses for the wounded in WWI front lines. Most were not allowed to combat, but they could fill roles in other occupations such as the U.S. Army's Signal Corps. and as marine and naval yeomen. 

The women in the First World War were mobilized in an unprecedented number throughout the world. The vast majority of these women were recruited to work in munitions factories, greatly expanding civilian work to replace the recruited men. Thousands served in the armed forces in support roles, for example, as nurses but in Russia some were in combat.

Philosophical political ideas have changed since the founding of our Constitution. Which political party currently reflects the conservative voter's view?

Answers

Final answer:

The modern Republican Party generally aligns with conservative views, advocating limited government, except in military and law enforcement. Over time, political party philosophies shift, reflecting the nation's changing issues and values, but the Republican Party today upholds many principles like those of historical conservative groups.

Explanation:

Throughout American history, political parties have evolved significantly in terms of their political philosophies and policy positions. The early Federalists and Democratic-Republicans were primarily divided over the power scope of the federal government, with Federalists advocating for a stronger central government and Democratic-Republicans favoring more states' rights. Over time, these parties have either transformed or been replaced by new parties as the nation faces different issues and challenges.

The modern Republican Party often reflects the viewpoints of conservative voters, with a general philosophy supporting limited government, especially regarding social programs, while advocating for increased military spending and law enforcement. On the other hand, today's Democrats have generally aligned with more liberal views, favoring broader government involvement in social welfare and programs meant to protect individuals. Similarities can still be drawn between past and present parties, such as the focus on the scope of governmental power, but their specific policy stances and the issues at the forefront have naturally shifted.

The Republican Party currently reflects the conservative voter's view, advocating for limited government, free-market policies, and traditional social values. Historically, these views have evolved from early political groups like the Federalists.

Evolution of Political Parties: In the early years, the Federalists (favoring a strong central government) and Democratic-Republicans (emphasizing states' rights) were the main political groups.Philosophical Shift: Over time, political ideologies evolved, leading to the modern Democratic and Republican parties, with Republicans today advocating for limited government intervention, free-market policies, and traditional social values.Conservative Principles: Modern conservatives focus on fiscal responsibility, reduced taxation, strong national defense, and the protection of individual rights.Public Policy: Conservatism today supports policies like deregulation, tax cuts, and a robust national defense strategy to promote economic growth and national security.

In summary, the Republican Party aligns with the conservative voter's view in today's political landscape.

What was the motivating factor behind Theodore Roosevelt’s conservationist ideas?

Answers

The motivating factor behind Theodore were- Roosevelt’s conservationist ideas
to preserve the health of mankind
to preserve the forests
to conserve water
to recycle plastic

SOS

Answer:

Theodore Roosevelt (at right) understood that it was man's responsibility to care for the environment as it had been Adam's responsibility to care for the Garden.

Hope this helps!!!

[tex]Sofia[/tex]

How were the tinker v. des moines and engel v. vitale cases similar?

Answers

Answer: 

Both cases established limits on public schools' actions based on the First Amendment.

Both cases established limits on public schools' actions based on the First Amendment...Apex

How did the administration of justice act change local government

Answers

If your choices are the following:
A.It limited who could be tried in Massachusetts judicial courts.
B.It stated that British officials must run all meetings.
C.It made gatherings, such as town meetings, illegal.
D.It established the First Continental Congress

The Administration of Justice Act change local government is that it limited who could be tried in Massachusetts judicial courts. I think the answer is A.

A) It limited who could be tried in Massachusetts judicial courts.

Many early 60s dance fad and novelty songs originated in this city:

Answers

Many early 60s dance fad and novelty song originated in Philadelphia 

New York was the city where many early '60s dance fad and novelty songs originated, thanks to its rich cultural scene and the integration of various music and dance styles.

Many early '60s dance fad and novelty songs originated in the city of New York. This was a period when dance cultures and music genres were heavily integrated. The Lindy Hop, a type of Swing Dance, took root in the African American New York dance scene and opened the door for later developments in popular dance and music. New York's diverse cultural scene served as a melting pot for various music styles that influenced the creation and popularity of new dance forms and novelty songs during the early 1960s.

Speaker 1: It is dangerous for any leader to get too powerful. Speaker 2: It is important to choose one strong leader who can rally the people. Speaker 3: It is essential that local leaders resolve their disagreements and work together. Speaker 4: It is impossible to create a government that represents the people. Which speaker would most likely support the government established by the Articles of Confederation?

Answers

Speaker 1 would most likely support the government established by the Articles of Confederation

it's a) speaker 1. i just did it

What ideology influenced the 1917 Russian Revolution? nationalism communism republicanism liberalism

Answers

The correct answer is communism.

The Russian Revolution involved the overthrowing of Czar Nicholas II. The citizens were extremely dissatisfied with Czar Nicholas II, as corruption was a constant part of his reign. Along with this the Czar also frequently disregarded the Duma, the legislative body that is supposed to help him make decisions. These factors all allowed for Vladimir Lenin and the communist party to take overthrow the Russian government and create a new one based on communist principles.

Answer:

communism

Explanation:

in which way were stalins communist state and hitlers fascist state similar

Answers

They were similar because both Hitler and Stalin were dictators that controlled their countries with an iron grip. This is propelled by the fact that one single party ruled both countries, being communism in the Soviet Union and the Nazi party in Germany. Both were also driven by an ideology in each country as well. I hope this helps 

the answer is they both used secret police to enforce there policies

What was the initial reaction to the proposed npt back in the 1970's? select one:
a. it was not signed by anyone
b. it angered the countries with nuclear weapons
c. it was met with skepticism
d. there was some slight dissent from countries that had no nuclear weapons
e. it was widely embraced and accepted?

Answers

The Answer to your question is "B"

What religion was prominent in much of north Africa in the early 1800s

Christianity
Bedouism
Hinduism
Islam

Answers

Answer:

Islam

Explanation:

What tensions between the Allies were revealed at the conferences in Casablanca, Cairo, and Tehran?

Answers

A primary tension between the Allies was tension between the Western partners (the USA, Britain, and France) over against the Eastern powers (the USSR and China) - and there was tension between the USSR and China as well.  There were tensions about how war ends would be pursued.  The USSR under Josef Stalin particularly wanted assurances that the war would be fought until an unconditional surrender by both Germany and Japan. Stalin also wanted a second front to be opened in the war in Europe, to relieve pressure on the Eastern front where Germany was battling the USSR.
Roosevelt, Churchill and DeGaulle (representing the US, Britain, and France) met at Casablanca in January, 1943.  Stalin was invited but did not attend due to the difficult state of the war in the USSR at that time.  They promised to fight on to the Axis Powers' unconditional surrender. They also discussed opening a second front in Western Europe, but did not determine a specific plan.
Roosevelt, Churchill, and Chiang Kai-shek of China met in Cairo in November, 1943, focused particularly on dealing with Japan and the future status of Korea.  Stalin had refused to attend this conference because of China's participation.  (Those two nations were rivals to one another.)
Roosevelt, Churchill and Stalin met in Tehran in November, 1943, just days after the close of the Cairo Conference.  Plans for an invasion into France were discussed, to open up a Western front in the European theater of war.  This would be Operation Overlord, which we now typically refer to as the "D-Day" invasion at Normandy.

Final answer:

The Casablanca, Cairo, and Tehran conferences underscored the tensions among the Allies, chiefly regarding the strategy against the Axis powers, the concept of unconditional surrender, the delay of a second front in Europe, and postwar planning including territorial disputes and the establishment of the United Nations.

Explanation:

The conferences in Casablanca, Cairo, and Tehran during World War II revealed several tensions among the Allied powers, particularly between Churchill, Roosevelt, and Stalin. At Casablanca in January 1943, the major tension arose from Stalin's absence and Roosevelt's declaration of unconditional surrender, which aimed to prevent any separate peace negotiations but also dismayed Stalin due to the delay of a second front in Europe. At Tehran in November 1943, tensions were evident in the differing priorities of the Allied leaders; Stalin prioritized a second front in Europe to relieve pressure on the Soviet Union, while Churchill and Roosevelt had broader postwar visions, including the establishment of the United Nations. This conference showcased the beginnings of postwar planning but also highlighted disagreements over strategies against Japan and the future political landscape in Eastern Europe, particularly the borders of Poland and the establishment of Soviet-friendly governments in the Baltic states.

Suppose you work for government agency that regulates the buying and selling in the country.Which main purpose of government is your agency serving

Answers

Help me unlock my answer
Distribution of resources

Which of the following words describe the North in the early 1800s? Check all of the boxes that apply.

Urban

Agricultural

Antislavery

Proslavery

Industrial
will give 30 pts !!!!!

Answers

Urban, Antislavery, Industrial are the words describe the North in the early 1800s. Hence, option A, C, and E are correct.

What is Antislavery?

opposed to, or designed to stop, slavery He was extremely devout, just like the majority of the anti-slavery men and women. Abolitionist legislation was introduced. In parliament, Wilberforce served as the movement's spokesperson against slavery.

One of the most comprehensive pieces of legislation addressing issues of modern slavery is the UK Modern Slavery Act. In addition to introducing additional preventive measures, support mechanisms, and a regulating body, it consolidates the currently recognized offenses of slavery and human trafficking.

The Abolition Act of 1807 made it illegal to buy enslaved individuals directly from Africa. But until the Slavery Abolition Act of 1833 took effect in the British Caribbean in 1834, the practice of slavery was still lawful there.

Thus, option A, C, and E are correct.

For more information about Antislavery, click here:

https://brainly.com/question/30090904

#SPJ2

Why did Nixon begin the bombing of Cambodia?
A.) to weaken the Communists' ability to fight
B.) to pressure the South Vietnamese to negotiate
C.) to create thousands of Cambodian refugees
D.) to destroy Cambodian territory

Answers

D. To destroy Cambodian territory 
Your answer is destroy Cambodian territory 

In an essay of 400 words, summarize the responsibilities of the three branches of the United States government and the system of checks and balances. What is the purpose of the system of checks and balances?

Answers

There are three branches of government in order to prevent any one sector obtaining complete control. The judicial branch is the Supreme Court, the executive branch is the president and his cabinet, and the legislative branch is Congress and the House of Representatives. Ideally, all three branches work together to make appropriate laws and enforce them. In an overly simplified explanation, the executive branch can propose or enact laws, the legislative branch is to make sure they are fair and necessary, and the judicial branch decides if they are constitutional. This system of checks and balances are to make sure erroneous laws are not passed, and one single person or group cannot seize control of the government. It was set up in this manner because the Founding Fathers wanted to prevent a tyrant or dictator from taking complete control of the country and reverting it back to imperial rule. 

What is the best answer to why long-distance sea voyages were undertaken from 1400 to 1550? Is it “for God, gold, and glory,”

Answers

"Gold, God, and Glory" is a great way to summarize why there were so many voyages to the "New World" during the 15th and 16th century. This was especially true of Spain. They wanted to obtain gold, spread the word of god, and become famous for their overseas endeavors. Other European countries, like Great Britain, had similar reasons for voyaging as well.

according to Saint Augustine, what did god transmit through the sacraments

Answers

Final answer:

Saint Augustine believed that God transmitted grace and the promise of salvation through the sacraments, these being vital acts for Christians to connect with divine grace. Baptism and the Eucharist were especially significant, embedding the idea that grace is a divine gift rather than something earned by human effort.

Explanation:

According to Saint Augustine, God transmitted through the sacraments His grace and the promise of salvation. For Augustine, an early Christian theologian and philosopher, the sacraments were outward signs instituted by Christ to impart grace to the faithful. Through these rituals, believers would be connected to the divine mysteries of Christianity. For instance, in the sacrament of Baptism, which Augustine deemed necessary to purge original sin, believers would be reborn into the Christian faith and cleansed of their original sin. Augustine also emphasized the significance of the Eucharist, where the bread and wine, through the rite of transubstantiation, literally become the body and blood of Christ, serving as a source of spiritual sustenance for the faithful.

Moreover, Augustine argued against heretical teachings such as Pelagianism and Manicheism, affirming that salvation and grace could not be attained through human effort alone, but were gifts freely bestowed by God. His theology on sacraments was vital in reinforcing the role of the Church and the significance of these rites, as they were seen as necessary for salvation and the continual renewal of faith throughout one's life—from birth to death—marked by sacraments like confirmation, marriage, the last rites, and penance.

· Indonesia
· Jordan
· Saudi Arabia
· Turkey
What cultural characteristic do these countries have in common?


A) all share a common history
Eliminate

B) all have democratic governments

C) all are located in desert regions

D) all are majority Islamic countries

Answers

The answer Is D trust me

Answer:

D) all are majority Islamic countries

Explanation:

In the map linked to this answer, Indonesia, Jordan, Saudi Arabia, and Turkey are all colored green, which indicates their population's main religion is Islam. Alternatively, you could view the religions of these countries via the CIA's World Factbook. The statistics on the site claim that Indonesia has 87.2% Muslims, Jordan has 97.1% Muslims, Saudi Arabia has 85-90% Sunni Muslims & 10-12% Shia Muslims, and Turkey has 99.8% Muslims. This clearly proves that these four countries are primarily Islamic countries; therefore, option D is correct.

Note: Muslim is the name given to someone following Islam (similar to Christians being people that follow Christianity). Shia and Sunni are terms used to describe different types of Muslims depending on the branch they follow.

Which example shows the RELIEF component of FDR’s New Deal?

Question 14 options:

Federal Emergency Relief Administration(FERA)—federal money to states for meeting basic needs of homeless


Tennessee Valley Authority(TVA)—provided jobs in Tennessee Valley to build dams, power plants, and work to control flooding and erosion


Public Works Administration(PWA)—created jobs for projects like building roads, bridges, and dams


all of these

Answers

it might  be the pwa im not sure though

Answer;

All the above;

-Federal Emergency Relief Administration(FERA)—federal money to states for meeting basic needs of homeless .

-Tennessee Valley Authority(TVA)—provided jobs in Tennessee Valley to build dams, power plants, and work to control flooding and erosion .

-Public Works Administration(PWA)—created jobs for projects like building roads, bridges, and dams.


Explanation;

The New deal describes president Franklin Roosevelt's relief, recovery, and reform programs designed to restore the economy during the Great Depression.

In it; Direct relief; was part of the FDR's philosophy to get out of the Great Depression; financial assistance to the poor and unemployed.

-Deficit spending ; was the concept in which the FDR's administration was based; It involved stimulating consumer buying power, business enterprise, and ultimately employment by pouring billions of dollars of federal money into the economy even if the government didn't have the funds, and had to borrow money.

presidential Abraham Lincoln's plan for reconstruction

Answers

Abraham Lincoln's plan for reconstruction (Or the ten percent plan) was formally called the Proclamation of Amnesty and Reconstruction. This plan was introduced to society on December 8, 1863.
Hope this helps!:)

PLEASE HELP ASAP!
How were the people of Renaissance different than those of the Middle Ages?
A. They were more interested in exploring the world around them.
B. They tended to be better looking.
C. They were all philosophers
D. They all became priests

Answers

I would say A.) They were more interested in exploring the world around them.

Why did the united states and it's allies use force against Afghanistan following the attacks on September 11,2001

Answers

All the hijackers were from Afghanistan

The invasion of Afghanistan was an attack launched by the United States and its allies, after the 9/11 attack. The main reasons why the United States invaded Afghanistan was that the U.S. recognized that the Al-Qaeda, the leader of a terrorist group had planned and caused the attacks of  9/11. Therefore, the principal objectives of this attack were to destroy Al-Qaeda and to refuse it a protected foundation of methods in Afghanistan. In this mission, the key ally of the U.S. was the United Kingdom.

How did the Union blockade of the southern coast affect the Confederacy during the Civil War?

Answers

Confederate defensive strategy, in turn, evolved with the Union blockade. After the fall of Port Royal, South Carolina, in November 1861, Confederate president Jefferson Davis appointed General Robert E. Lee to reorganize Confederate coastal defenses. Lee quickly realized the impossibility of defending the entire coastline and decided to consolidate limited Confederate forces and materiel at key strategic points. He countered Union naval superiority by ensuring easy reinforcement of Confederate coastal positions along railroad lines. In this way, Lee minimized reliance upon the fledgling Confederate navy and maximized the use of Confederate military forces in coastal areas, including both Georgia's Sea Islands and mainland ports with railroad connections.

the answer is choice B on edge

Which statements best describe how businesses can take advantage of globalization? Check all that apply.

Answers

The businesses can take advantage of globalization based on the following;

-          Communicate more quickly with other countries than the local places

-          The business made use of lower label cost when applied to other countries

-          Resources should be transported quickly throughout distant locations

The statements that best describe how businesses can take advantage of globalization are using lower labor costs in other countries, transporting resources quickly from distant locations, and communicating more quickly with other countries. The correct options are a, c, and e.

Businesses can benefit from globalization by utilizing reduced labor costs in other nations, quickly transferring resources from remote areas, and interacting with other countries. These advantages enable organizations to optimize their cost structure, gain access to resources from diverse areas, and broaden their worldwide reach, resulting in enhanced global competitiveness and growth.

One advantage of globalization is that corporations can take advantage of lower labor costs in other nations. Businesses can reduce expenses and boost profitability by establishing operations or outsourcing production to nations with lower salaries.

Thus the correct options are a, c, and e.

Learn more about globalization, here:

https://brainly.com/question/1346045

#SPJ6

The question was incomplete but the complete question most probably was:

Which statements best describe how businesses can take advantage of globalization? Check all that apply.

a. using lower labor costs in other countries

b. creating higher barriers to trade

c. transporting resources quickly from distant locations

d. limiting trade with other countries

e. communicating more quickly with other countries

What two Mediterranean countries in Europe were first influenced by ideas bought in by traders from the East?

Answers

The two Mediterranean countries in Europe were first influenced by ideas bought in by traders from East Greece and Italy.

What are Traders?

The term "trade" refers to the exchange of goods and services for cash in order to carry out an economic transaction. Trade that occurs beyond international borders is referred to as international trade, and the individuals involved are known as traders.

Greece and Italy are both Mediterranean countries in Europe. Several new arts, commodities, and information and communication from other civilizations are brought to Greece and Italy by traders from the east who traded goods with other countries.

All that like thoughts for architectural designs which help in designing infrastructure, making sculptures, ingredients for traditional food to promote culture, etc. are included in this.

To learn more about the Mediterranean countries, refer to:

brainly.com/question/12142898

#SPJ3

Italy and Greece were the first Mediterranean countries in Europe to be influenced by traders from the East, with Italy's city-states like Venice and Genoa becoming key trade hubs, while the Phoenicians and Greeks established important Mediterranean colonies facilitating cultural exchange.

The two Mediterranean countries in Europe that were first influenced by ideas brought in by traders from the East were Italy and Greece. These countries engaged in extensive trade with eastern civilizations through the Mediterranean Sea, allowing for cultural exchange and the spread of goods, ideas, and technologies. The Phoenicians, originating from the Levant, established Carthage on the North African coast, laying the groundwork for a trade network that connected the Mediterranean world. Greek traders and colonists also participated deeply in Mediterranean commerce, establishing settlements and trading posts that served as conduits for Eastern influences. Italy, via city-states such as Venice and Genoa, became a major hub for goods like spices, silks, and textiles brought by the long-standing trade routes such as the Silk Road, and this trade helped to invest in resources that sparked further cultural and economic growth. The influx of goods and ideas from the East had a profound effect on European societies, contributing to developments like the Italian Renaissance.

PLEASE HELP!!!! WILL GIVE BRAINLYIST

Which two statements describe causes for Egypt’s defeat against the Hyksos?

1. The Hyksos and Assyrians formed an alliance.

2. The Hyksos used horse-drawn chariots with bronze weapons.

3. The Persians betrayed the Egyptians to the Hyksos.

4. The Egyptians fought on foot with copper and stone weapons.

5. The Egyptians were recovering from a famine.

Answers

I think it's 2 and 4 according to the internet. Hope I helped! Tell me if I'm right or not.

Answer:

2 and 4

Explanation:

i have taken the test and its right.

Rlh why did texans declare independence from mexico in 1836? answers

Answers

The Texans did declare Independence from Mexico in 1836. It was because Santa Anna had become a dictator and they were scared he would take their slaves, and then them into slaves as well. 

Good luck :)

4 Questions 1.) What is the purpose of a land grant? A. A land grant protects land for the exclusive use of the government B. A land grant always reserves property for native Americans only C. A land grant gives property to a certain person or group D. A land grant prevents the settlement or development of a certain area of land 2. Which of the following is NOT a type of land grant used in New Mexico? A. Pueblos B.Community grants C.State trust lands D.Colonies

Answers

1. C. A land grant gives property to a certain person or group. 
2. I'm not sure about this one but i'd go with B. Community grants


Final answer:

Land grants give property to a certain person or group for specific uses, such as infrastructure projects or the establishment of universities. The types of land grants used in New Mexico are Pueblos, community grants, and state trust lands, but not colonies. Land grants have played a crucial role in history, development, and cultural practices.

Explanation:

The purpose of a land grant, such as those given by the government, is largely option C - it gives property to a certain person or group for specific uses, often for public benefits. For example, in the 1800s, the federal government donated millions of acres of federal land to states to support infrastructure projects and the establishment of universities. These grants played a huge role in shaping the national transportation system and higher education.

Land grants were also common in horticultural societies. Here, land was held in trust by family heads or village leaders who allocated plots of land to individuals. They had the right to use the land assigned to them, but did not own it nor could sell it, a practice known as usufruct rights. These rights, symbolizing a sense of community and mutual aid, were often passed down through families.

Finally, in the context of New Mexico, Pueblos, community grants, and state trust lands are types of land grants. On the other hand, colonies are not a type of land grant used in New Mexico. Thus, it is important to understand the different forms and roles of land grants, as they play an essential part in history, development, and cultural practices.

Learn more about Land Grants here:

https://brainly.com/question/3104111

#SPJ2

what was distinctive about Gothic Cathedrals?
A. spires
B.steeple
C.Interiors
D. murals

Answers

A. spires
, I think sorry iof its wrong

Answer:

Spires

Explanation:

if you are doing odysseyw

Other Questions
Read this excerpt from "Goodbye to All That" by Joan Didion.We stayed ten days, and then we took an afternoon flight back to Los Angeles, and on the way home from the airport that night I could see the moon on the Pacific and smell jasmine all around and we both knew that there was no longer any point in keeping the apartment we still kept in New York.Which statement best explains how the imagery in the excerpt affects the meaning of the text?It highlights the isolation and loneliness of life in Los Angeles, demonstrating that Didion faces the same problems there that she faced in New York.It captures the beauty and serenity of life in Los Angeles, suggesting why Didion feels more content living there than she did in New York.It provides an unrealistic and idealized impression of Los Angeles, showing that Didion has not changed at all.It depicts the dark and mysterious atmosphere of Los Angeles, indicating why Didion is drawn to this new, exciting city. What is the equation, in slope-intercept form, of the line that is perpendicular to the line y 4 = 2/3(x 6) and passes through the point (2, 2)? y = 2/3x 10/3 y = 2/3x +10/3 y = 3/2x 1 y = 3/2x + 1 Your gross pay on your paycheck is $400. your deductions are as follows: federal income tax - $50.00 state income tax - $20.00 social security tax - $7.00 medicare tax - $3.50 please calculate your net pay (in dollars). question 2 options: Which statement accurately describe the role of decomposers in the carbon cycle? When parking downhill on a road with a curb, you should turn your front wheels __________ .A. parallel to the curbB. towards the curbC. towards the street Which of the following terms describes the primary core of a comet? two cards are drawn without replacement from a standard deck of 52 playing cards. find the probability that both are odd numbers (aces are considered odd because they have a value of 1 or 11). 14) Which BEST describes the way the Fourteenth Amendment affected the states?A)States had to give all citizens, regardless of their race or religion, equal protection under the law.B)States could no longer make any laws that were not approved by the federal government.C)States had to pass laws that gave more rights to freed slaves than to other citizens.D)States could no longer institute poll taxes or tests for citizens before they voted.2) The term "Reconstruction" in United States history refers to the period after what event?A)the Civil WarB)the Revolutionary WarC)the Constitutional ConventionD)the Declaration of Independence The major problem with hydrogen as an alternative source of energy is that none exists on the surface of the earth. a. True b. False Analyze the following statement: Marcus notices that he runs faster in the mornings rather than the evenings. Is the statement an example of correlation or causation? A. Correlation, because time of day doesn't cause a person to run faster or slower B. Causation, because Marcus has noticed this over several trials C. No relationship, because time of day has nothing to do with how fast a person runs D.There is not enough information to make a conclusion Which head glands secrete sucrase, lipase, amylase, and invertase? What is the measure of an angle that turns through 3/4 of a complete circle What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatctcatccagcattctgaaagggtaatgaataattattccgctgagttcatgaggtatccgaaggaggagcaacacttaggctataagagtatcatgcacatagatcgggataaatcgcctatcatatgtgacaacaatttcatgattaaaagt code for? Which is a pro-election of federal judges argument?A. When judges are elected they can be biased by party politics. B. When judges are elected there they can focus more time on reviewing law.C. Judges are more accountable to the people and what they think is just when they are elected Which statement displays an effect of developing a successful atomic bomb? Question 11 options: A.encouraged private sector employees to not share their discoveries with the government B.was the final time that the government and private sector combined to form any great invention C.served as a model for future government or private research and development labs to create innovationsD.proved that military innovation is always ahead of private innovation the graph shows the percentage of dog breeds affected by elbow dysplasia, which causes dogs to limp. What???s the most likely explanation for the mixed breed???s disease incidence? The probability is 0.2 that a person shopping at a certain store will What is the differecne of the following polynomials? (6x^2 - 3x^3) - (2x^3 + 4x^2 -5) Congratulations As you know, the position for which you are applying requires superlative problem-solving skills in a variety of arenas, and the ability to think critically on the fly is essential. To evaluate your ability in this area, the practical portion of the interview process consists of a series of locked-room puzzles. You will need to use all of your ingenuity to find the key to unlocking each room. There are six rooms total; four of the rooms will have individual time limits, while the remaining two rooms will be untimed. You will be observed by the interview team from a remote location, and your progress through the rooms will be recorded. For which type of communication would this paragraph be used?A)casual noteB)informal emailC)formal business If 1495 J of heat is needed to raise the temperature of a 337 g sample of a metal from 55.0C to 66.0C, what is the specific heat capacity of the metal?