Find the domain of the function.

Find The Domain Of The Function.

Answers

Answer 1

Answer:

{y|10 < y}; ○ y > 10

Step-by-step explanation:

Whenever you have a Rational-Radical function, the answer will ALWAYS result in greater than.

I am joyous to assist you anytime.


Related Questions

What is lcm of 5 , 6 and 7

Answers

Answer:

210

Step-by-step explanation:

Since the three numbers have no factors in common, you can get the LCM by multiplying all three numbers.

Use the properties of exponents to complete the equivalent expression.

Answers

Answer:

15

Step-by-step explanation:

We can multiply powers with the same base

x^4⋅x^2=(x⋅x⋅x⋅x)⋅(x⋅x)=x^6

Final answer:

Properties of exponents are rules used to simplify mathematical expressions involving exponents. Examples are Power of a Power which means adding exponents when multiplying two expressions with the same base, and Quotient of Powers which is subtracting exponents when dividing two expressions with the same base.

Explanation:

The question is about the properties of exponents. In mathematics, the properties of exponents refer to the rules that guide how expressions involving exponents are handled. For example, when you multiply two expressions with the same base, you add the exponents (also known as the Power of a Power property). So, an exponent like x^3 * x^2 simplifies to x^(3+2) = x^5.

Another example is the quotient of powers property, where you subtract the exponents when dividing two expressions with the same base. So, an expression like x^5 / x^3 simplifies to x^(5-3) = x^2.

These are just a couple of the basic properties of exponents. Other properties include the power of a product, the power of a quotient, zero exponent, and negative exponent. Each of these properties follows specific rules to simplify the expression involving exponents.

Learn more about the properties of exponents,

https://brainly.com/question/32860606?referrer=searchResults

#SPJ2

Given the function f(x)=x2+2x+1, find:
f( 2a−3/5 )

Answers

Answer:

[tex]f(2a-\frac{3}{5})=4a^2+\frac{8a}{5}+\frac{4}{25}[/tex]

Step-by-step explanation:

we have

[tex]f(x)=x^{2} +2x+1[/tex]

Find [tex]f(2a-\frac{3}{5})[/tex]

That means -----> substitute the value of [tex]x=(2a-\frac{3}{5})[/tex] in the function and evaluate

[tex]f(2a-\frac{3}{5})=(2a-\frac{3}{5})^{2} +2(2a-\frac{3}{5})+1[/tex]

[tex]f(2a-\frac{3}{5})=(4a^2-\frac{12a}{5}+\frac{9}{25})+(4a-\frac{6}{5})+1[/tex]

[tex]f(2a-\frac{3}{5})=4a^2+\frac{8a}{5}-\frac{21}{25}+1[/tex]

[tex]f(2a-\frac{3}{5})=4a^2+\frac{8a}{5}+\frac{4}{25}[/tex]

Which is bigger 0.999 or 1.0?

Answers

Answer:1.0

Step-by-step explanation: 0.999 repeating is not a whole number like 1.0

Answer:

1.0

Step-by-step explanation:

Look at where the numbers are placed, in regards to the decimal point.

If a number is 1 place before a decimal point (For example 5.0) it is in the ones place.

If a number is 1 place after a decimal point (For example 0.1) It is in the tenths place.

Any numbers that are to the right the decimal are smaller than numbers to the left!

If f(x) = 3x2 + 1 find f(6).
109
5/3
325

Answers

Plug in 6 for x. This will give you 3(6)^2+1 which is (3*36)+1 which is 109.

Answer:

The answer is 109.

Do you use the Monarch school program?? Looks just like mine!

Write 10 x 10 x 10 x 10 x 10 x 10 with an exponent. Explain how you decided what exponent to write

Answers

10x10x10x10x10x10=1000000

[tex] {10}^{6} [/tex]

means 10x10x10x10x10x10

as it's basically saying 10 is multiplied by itself 6 times which gives you 1000000

The expression 10 × 10 × 10 × 10 × 10 × 10 can be written with an exponent as [tex]10^{6}[/tex]

What is an exponent?

In Mathematics and Geometry, an exponent can be represented or modeled by this mathematical expression;

[tex]b^n[/tex]

Where:

the variables b and n are numbers (numerical values), letters, or an algebraic expression.n is known as a superscript or power.

Based on the information provided above, we can logically deduce the following expression;

10 × 10 × 10 × 10 × 10 × 10

[tex]10^{1+1+1+1+1+1}=10^{6}[/tex]

Read more on exponent here: brainly.com/question/27858496

#SPJ3

Evaluate the variable expression for x = 5, and enter your answer in the box
below.
7•(x-8)-3

Answers

Answer:

-18

Step-by-step explanation:

I used order of operations. first. you want to go the thing in parentheses. then I times it by 7 and minuses it by 3

Final answer:

The evaluation of the given mathematical expression 7•(x-8)-3 for x = 5 results in -24.

Explanation:

To evaluate the variable expression 7•(x-8)-3 for x = 5, we substitute the value of x into the expression.

This becomes 7•(5-8)-3, which simplifies to 7•(-3)-3, or -21-3. Therefore, the evaluation of the given expression for x = 5 is -24.

Learn more about Variable Expression Evaluation here:

https://brainly.com/question/35471134

#SPJ2

The sides of a triangle are a + 3 ¼, 2a, and 7 ½ - a. If a = 4 1/8, what is the length of each of the three sides? Also, find the perimeter of the triangle showing steps for your work.

Answers

Answer: Side one is 7 3/8

Side two is 8 2/8

Side three is 3 3/8

Perimeter is 19

Step-by-step explanation:

The first side is    a+3 1/4

the second side is  2a

The third side is   7 1/2-a

Plug 4 1/8 in for a

First side   4 1/8+3 1/4

Find the common denomnator which is 8

4 1/8+3 2/8

7 3/8

First side is 7 3/8

Second side  2(4 1/8)=4 1/8 +4 1/8= 8 2/8

Third side is 7 1/2-4 1/8

Find the common denominator which is 8

7 4/8-4 1/8= 3 3/8

Third side is 3 3/8

The perimeter is adding all the three sides together

7 3/8+8 2/8+ 3 3/8=18 8/8

Reduce 18 8/8=18 +1=19

Answer:

Perimeter = 19 units

Step-by-step explanation:

Given a = 4 1/8

[tex]Side1 = a + 3\frac{1}{4}\\Side2 = 2a\\Side3 = 7\frac{1}{2}-a[/tex]

The next step is substituting the a value in the expressions:

[tex]Side1 =  4\frac{1}{8}+ 3\frac{1}{4}\\Side2 = 2*(4\frac{1}{8})\\Side3 = 7\frac{1}{2}-4\frac{1}{8}[/tex]

Then, fractions with different denominators must be converted to the same denominator. Also, the multiplication of a whole number by a mixed number can be done by using distributive law:

[tex]Side1 =  4\frac{1}{8}+ 3\frac{2}{8}\\Side2 = 8\frac{2}{8}\\Side3 = 7\frac{4}{8}-4\frac{1}{8}[/tex]

[tex]Side1 =  7\frac{3}{8}\\Side2 = 8\frac{1}{4}\\Side3 = 3\frac{3}{8}[/tex]

Now, the perimeter is the sum of all the sides. Therefore, the perimeter is:

[tex]Perimeter =  7\frac{3}{8} + 8\frac{1}{4} + 3\frac{3}{8}[/tex]

Which is 19 units.

What is the solution of the following system?

-2x-y=1
-4x-2y=-1

A. infinitely many solutions
B. no solutions
C. (3,8)
D.(-3,-8)

Answers

B

when we multiply the equation and subtract equatio 2 from equation 1 the result is 0=-4 and 0=2

Answer:  The correct option is

(B) no solution.

Step-by-step explanation:  We are given to find the solution of the following system of equations :

[tex]-2x-y=1~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~(i)\\\\-4x-2y=-1~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~(ii)[/tex]

From equation (i), we have

[tex]-2x-y=1\\\\\Rightarrow y=-2x-1~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~(iii)[/tex]

Substituting the value of y from equation (iii) in equation (ii), we get

[tex]-4x-2(-2x-1)=-1\\\\\Rightarrow -4x+4x+2=-1\\\\\Rightarrow 2=-1,[/tex]

which can never be possible.

Thus, the given system of equations have no solution.

Option (B) is CORRECT.

What time is 5 1/4 hours after 7:00 p.m.

Answers

Answer:

9 or 10

Step-by-step explanation:

because you add the hours

(Picture Included) Can someone help me on 5?

Answers

The mean would be 32 (I think)

Answer:

43

Step-by-step explanation:

The price of an item has been reduced by 60%. The original price was $55. What is the price of the item now?

Answers

33
55x.60=33 is the correct answer

Answer:

Step-by-step explanation:

55*.60=$33

SO, 55-33=22THE ITEM IS $22 NOW

Definiton of numerator?

Answers

The numerator is the number above a fraction bar. It indicates how many parts of the whole.

Answer: the part of a fraction that represents how many equal parts are being counted

Step-by-step explanation:

For example

1/6 the one is a numerator

the graph of y= -4×+7 is​

Answers

Answer:

Step-by-step explanation:

The graph of y= -4×+7 is​ a straight line with slope -4 and y-intercept 7.  Please do not use × to represent the independent variable; use x instead.  × represents multiplication.

To graph this function, first plot the y-intercept, b, which is (0, 7).

Next, starting with your pencil point at (0, 7), move the point 1 unit to the right and plot another point (which will be (1, 7) ).  Now move your pencil point 4 units down and plot your third point, which will be (1, 3).

Finally, draw a straight line thru the first and third points, that is, thru (0, 7) and (1, 3).  Notice how this line has the slope -4 and the y-intercept (0, 7).

Your bank offers the Bradys a 30-year mortgage with a rate of 5%. At that rate, the monthly payments for principal and interest on the loan will be $5.37 for every $1,000 financed.

Answers

Answer:

Your answer would be 30a - year

Hope this helped. Please mark brainliest if this helped.

Monthly payment is the principal and interest payment for each year for $1000 financed. he payment of the mortgage is $4639.75

Given information-

The period for which the mortgage offered is 30 years.

The rate for which the mortgage offered is 5 percent.

The interest on the loan is $5.37 for every $1000 financed.

Monthly payment

Monthly payment is the principal and interest payment for each year for $1000 financed.

He has to pay for 30 years. As there is 12 month in one year. Therefore the total months in 30 years,

[tex]n=30\times12\\ n=360[/tex]

Thus the value of n is 360.

The formula for the principal amount can be given as,

[tex]P=a\times\dfrac{r}{n} [/tex]

Put the values

[tex]5.37=a\times \dfrac{0.41667}{360} \\ [/tex]

Solving it for the a

[tex]a=4639.75[/tex]

Thus the payment of the mortgage is $4639.75.

Learn more about the monthly payment here;

https://brainly.com/question/22891559

A rectangle is
7 times as long as it is wide. The perimeter is
48 feet. Find the dimensions.

Answers

Answer:

21 by 3

Step-by-step explanation:

3x7=21

21+21=42

3+3=6

42+6=48

Helppp it’s due today!!

Answers

Answer: 15 + c = 64

Step-by-step explanation:

we need to do 15 + 64

C represents her age, which would be 49, if you needed to know

Therefore the equation is 15 + c

Your bank account balance is −$20.85. You deposit $15.50. What is your new balance?

Answers

Your new balance=$-5.35

Answer:

[tex]-5.35[/tex]  [tex]dollars[/tex]

Step-by-step explanation:

Currently, your bank account balance is [tex]-20.85[/tex]  [tex]dollars[/tex]

You then [tex]deposited^{1}[/tex]  [tex]15.50[/tex]  [tex]dollars[/tex]

This means:

That you added $15.50 into your bank account balance, so:

-$20.85 + $15.50

==> -5.35

FOOTNOTE:

Deposited - put or set down

Which of the following represents the additive identity?
1. ab = ab
2. a x 1 = a
3. a+b = b+a
4. a + 0 = a

Answers

Answer:

4. a + 0 = a

Step-by-step explanation:

The zero means that it is the additive property.

Answer:

a + b = a

Step-by-step explanation:

Additive identity- the number 0; when added to any number, the value of the number does not change.

what is the value of x?

AC= 32

Answers

2x + 6x + 8 = 32

8x + 8 = 32

8x = 32 - 8

8x = 24

x = 24 ÷ 8

x = 3

hope this was helpful!
The answer is x=3
Your welcome:)

Charmaine will run less than 26 miles this week. So far, she has run 18 miles. What are the possible numbers of additional miles she will run? Use t for the number of additional miles she will run. Write your answer as an inequality solved for t

Answers

Answer:

18+t<26

t={1,2,3,4,5,6,7}

Step-by-step explanation:

18+t<26

alright, so you know that she will run less than 26. That means she cannot run 26 or 27 or any more miles than that.

She can run 19, 20, 21, 22, 23, 24, or 25 miles in total from her starting point which is 18.

She already ran 18 miles. If she ran one more it would be 19, if she ran 2 more it could be 20. But she CAN NOT pass 25 miles. (it is not less than OR equal to)

so let me put it like this:

18+1<26 yes because 18+1=19 which is less than 26

18+2<26 yes because 18+2=20 which is less than 26

18+3<26 yes because 18+3=21 which is less than 26

18+4<26 yes because 18+4=22 which is less than 26

18+5<26 yes because 18+5=23 which is less than 26

18+6<26 yes because 18+6=24 which is less than 26

18+7<26 yes because 18+7=25 which is less than 26

18+8<26 NOOO because 18+8=26 which is NOT less than 26 (it's equal, not less than)

I really hoped this help please ask me more ill be happy to help. Also if u understood can I get the brainliest?

7.
A holiday meal cost $12.50 a person plus a delivery fee of $30.
Which equation represents the amount a holiday meal
costs(y), including delivery, for x people?

Answers

Answer:

12.50x+30

Step-by-step explanation:

Answer:

[tex]y = 12.5x + 30[/tex]

Step-by-step explanation:

We are given the following information in the question:

Cost of a holiday meal = $12.50

Delivery fee = $30

Cost(y) represents the amount a holiday meal including delivery for x people.

[tex]cost = (\text{Cost of meal}\times x) + \text{Delivery chareges}[/tex]

Putting all the values,

[tex]y = 12.50\times x + 30\\y = 12.5x + 30[/tex]

The above equation gives the total amount of holiday meal for x people including the delivery charges.

Enter the terms and coeffidents -80+8p-2z

Answers

Step-by-step explanation:

Look at the picture

-80 + 8p - 2z

Terms: -80, 8p, -2z

Coefficients: -80, 8, -2

What is 5.9 rounded to

Answers

Answer:

6

Step-by-step explanation:

It would round to 6, anything higher than 5 will round up anything 4 or lower will be rounded down.


(Assuming it’s rounding to a whole number )

through a point not in a plane are an infinite number of lines parallel to the plane always sometimes never

Answers

Answer:

sometimes

Step-by-step explanation:

i think sometimes

Answer:

ALWAYS!!

Step-by-step explanation:

Anna has the following averages in his math class.
REPORT
CARD
Homework Avg: 95
Quiz Avg: 90
Test Avg: 87
Final Exam: ?
If the teacher weights homework at 20%, Quizzes at 20%
Tests at 40% , and the final exam at 20%, what is the
minimum grade Anna can make on the final so that she
scores a 90 in the class?
a. 86
b. 91
C.
d
94
98

Answers

Answer:

b) 91

Step-by-step explanation:

Step 1: Multiple marks by its weights

Homework average: 95 x 20% = 19

Quiz average: 90 x 20% = 18

Test average: 87 x 40% = 34.8

Final exam: y x 20% = 0.2y

Step 2: Add all weighted averages and find y

19+18+34.8+0.2y = 90

71.8 + 0.2y = 90

y = 18.2/0.2

y = 91

Therefore, Anna needs to score minimum 91 in the final exam so that she can score a 90 in class.

Option b is correct.

!!

A school district purchased 615 new laptops for their mobile labs. Each computer cost $409. What is the total cost for all of the laptops?

Answers

Answer: $251,535 is the total cost for all the laptops.

Step-by-step explanation:

615×409= 251,535

Answer:

[tex]total\ cost=\$251,535[/tex]

Step-by-step explanation:

For this exercise it is important to analize the information provided in the exercise.

According to the exercise, the of cost each computer is:

[tex]cost=\$409[/tex]

You know that the school district purchased 615 new laptops for their mobile labs; therefore, in order to calculate the total cost for all the laptops purchased, you must multiply the cost of one laptop ($409) by 615.

Therefore, you get that the total cost is the following:

[tex]total\ cost=(\$409)(615)\\\\total\ cost=\$251,535[/tex]

Which mixed number is equvilent to thevimproper fraction 23/6

Answers

6 goes into 23 - 3 times

remainder 5 (3 and 5/6)
6 goes into 23, 3 times. Remainder 5 (3 and 5/6)

An article fills 5/8 of a magazine page. A
related photo takes up 1/4 of the article. How
much of the page is taken up by the photo?​

Answers

Answer:

35

Step-by-step explanation:

bundles tundra dismay chard bff dusk m u

Based on the given information,  the photo takes up 5/32 of the page.

How much of the page is taken up by the photo?​

To find out how much of the page is taken up by the photo,  multiply the fraction representing the article's portion of the page (5/8) by the fraction representing the photo's portion of the article (1/4).

First,  calculate the fraction representing the photo's portion of the page:

(5/8) * (1/4) = 5/32

Therefore, the photo takes up 5/32 of the page.

Read on article on https://brainly.com/question/26859358

#SPJ3

What is the base of the triangle when the area is 120ft and the height is 8ft

Answers

The base is 30.

Hopefully I got this correct, not 100%

Answer: 30 ft

Step-by-step explanation:

Area of a triangle= (bh)/2

* multiply both sides by 2

2A=bh

*divide by h

(2A)/h=b

*substitute values

(2x120)/8=b

240/8=30

Other Questions
to create a formula in______, you would first click in one of the cells Dr. Han is studying which brain structure is associated with aggressive behavior among rats. Which part of the brain is she likely to see activated when using neuroimaging techniques? Please i need big helpChoose the adjective clause in the following sentence: The jeans that I want to buy are very expensive.to buyare very expensivethe jeans thatthat I want to buyI want True or false tasks are required activities that need to take place in order to complete a goal Two train whistles have identical frequencies of 175 Hz. When one train is at rest in the station and the other is moving nearby, a commuter standing on the station platform hears beats with a frequency of 4.05 beats/s when the whistles operate together. What are the two possible speeds and directions the moving train can have? slower speed m/s Correct: Your answer is correct. faster speed m/s Changed: Your submitted answer was incorrect. Your current answer has not been submitted. The processivity of a DNA polymerase depends on all of the following actions, EXCEPT for __________. A. association of the DNA polymerase with a sliding clamp (like eukaryotic PCNA) B. interaction between the thumb domain of DNA polymerase and the DNA C. interaction between the minor groove of DNA and the palm domain of the DNA polymerase D. loss of the hydrogen from the 3-OH of the primer due to interaction with a divalent metal ion associated with the palm domain of the DNA polymerase the romans introduced and estabished a common system of written laws why was that important The economy of early villages and cities was based mainly on What is the solution to 4x+5y=12x6y=22 Edouard Daladier became Prime Minister of which country in 1933? A __________ is a wide-mouthed body of water close to shore. Cusic Industries had the following operating results for 2019: sales = $34,621; cost of goods sold = $24,359; depreciation expense = $6,027; interest expense = $2,725; dividends paid = $2,023. At the beginning of the year, net fixed assets were $19,970, current assets were $7,075, and current liabilities were $4,010. At the end of the year, net fixed assets were $24,529, current assets were $8,702, and current liabilities were $4,700. The tax rate was 25 percent. a. What is net income for 2019? (Do not round intermediate calculations.) b. What is the operating cash flow for 2019? (Do not round intermediate calculations.) c. What is the cash flow from assets for 2019? (A negative answer should be indicated by a minus sign. Do not round intermediate calculations.) d-1. If no new debt was issued during the year, what is the cash flow to creditors? (Do not round intermediate calculations.) d-2. If no new debt was issued during the year, what is the cash flow to stockholders? (A negative answer should be indicated by a minus sign. Do not round intermediate calculations.) Evaluate M2/P2 for M = 10, N = -5, and P = -2? A.-5 B.5 C.-25 D.25 Read the sentences. Sentence 1: I hope the dinner comes out perfectly, but even if it doesnt, Im pretty sure theyll know how hard I tried. Sentence 2: Then well have coffee cake for dessert, which I made from scratch. Sentence 3: I am making my sisters favorite: roasted chicken, brown rice, and brussels sprouts. Sentence 4: I cannot wait to cook dinner for my family tonight. What is the most logical sequence for these sentences in a story? 1, 3, 2, 4 4, 1, 3, 2 4, 3, 2, 1 3, 2, 1, 4 An RNA virus that infects plant cells is copied into a DNA molecule after it enters the plant cell. What would be the sequence of bases in the first strand of DNA made complementary to the section of viral RNA shown here? 5' CCCUUGGAACUACAAAGCCGAGAUUAA 3' Reasoning if you multiply two decimals that are less than 1,can you predict whether the product will be less thanor greater than either of the factors? Explain What is the greatest common factor of 19 and 18? What happened as a result of the Sand Creek Massacre? Please select the word from the list that best fits the definition Likes to study with music in the background Which function has the given graph?