For each bottle of wine that Italy produces, it gives up the opportunity to make 10 pounds of cheese. France can produce 1 bottle of wine for every 25 pounds of cheese it produces. Which of the following is true about the comparative advantage between the two countries?

Italy has the comparative advantage in cheese.
France has the comparative advantage in wine.
France has the comparative advantage in wine and cheese.
Italy has the comparative advantage in wine.


Answers

Answer 1

Answer:

The correct answer is: Italy has the comparative advantage in wine.

Explanation:

Comparative advantage can be defined as the ability to produce at a lower opportunity cost.  

Here, we see that the opportunity cost of making a bottle of wine for Italy is 10 pounds of cheese.  

While the opportunity cost of producing one bottle of wine for France is 25 pounds of cheese.

This implies that Italy has a lower opportunity cost for producing a bottle of wine. So we can say that it has a comparative advantage in producing wine.


Related Questions

You have moved to another state and wish to work as an EMT. In your previous state of employment, EMTs were allowed to administer a select number of drugs. To determine if EMTs can administer drugs in your new state of residence, you should check the:

Answers

Answer:

State Emergency Medical Technicians Scope of Practice.

Explanation:

To determine if EMTs can administer drugs in your new state, check the state's regulations and protocols related to EMS, typically outlined by the Department of Health. Review the EMS guidelines, and contact the state EMS office if needed. Regulations can vary by state, so ensuring compliance with the new state's rules is essential. thus the correct answer is a.

To determine if EMTs can administer drugs in your new state of residence, you should check the state's regulations and protocols related to emergency medical services (EMS). These regulations are typically outlined by the state's Department of Health or equivalent governing body, and they define the scope of practice for EMTs, including the specific medications they are authorized to administer.

Usually, the steps to follow include:

Consult the official website of your new state's Department of Health.Review the EMS guidelines and protocols provided by the department.Contact the state EMS office if you need further clarification.

In your previous state, EMTs were allowed to administer certain medications like oxygen and epinephrine for specific conditions. Since regulations can vary from state to state, it's essential to verify your new state's rules to ensure compliance.

corrected answer 2) You have moved to another state and wish to work as an EMT. In your previous state of employment, EMTs were allowed to administer a select number of drugs. To determine if EMTs can administer drugs in your new state of residence, you should check the:

A) State Emergency Medical Technicians Scope of Practice. B) Emergency Medical Technician-Basic: National Standard Curriculum.

C) National Highway and Transpiration Safety Agency: National Curriculum Standards. D) Emergency Medical Services

Sonia says she prefers two theater tickets and one bottle of French wine to three games of bowling and one pitcher of draft beer. In this example, Sonia is demonstrating the _____ assumption of consumer behavior.

Answers

Answer:

completeness and rankability

Explanation:

Here Sonia is very precise about the set of choices she is having.

She has determined the finite amount of choices she wants. Thus, this demonstrates the completeness

Also, she has set the priority for the preferences she is having.

Hence, this demonstrates the rankability.

The history of intercollegiate athletics illustrates that, from the beginning, which of the following was true?a. Marketing and sponsorship were important.b. An enthusiastic and supportive group of faculty were involved.c. Cheating is endemic in college sport.d. A problem existed with facilities.

Answers

Answer:

a. Marketing and sponsorship were important.

Explanation:

Intercollegiate Athletics is an event where lot of different colleges participate in Athletics sports event for colleges.It's history illustrates that marketing and sponsorship are very important because without marketing there will be no colleges to participate in the collegiate athletics event and without sponsorship there will be not enough funds to make the event happen.

Dr. Kid is studying the effects of sleep on a child's reading speed. She initially takes a measure of each child's reading speed. Next, she varies the amount of sleep different children get. Finally, she re-measures their reading speed. What is the independent variable in her study?

Answers

Answer:

Sleep time.

Explanation:

Independent variables are usually time or age. Usually the dependent variable is that variable that is being measure. In this example, the child's reading speed. The dependent variables is attached or "depends" on the amount of time a child needs to sleep.

Joe rarely takes any work home, preferring to leave his work worries at the office. He is not ambitious and likes to have a lot of leisure time when it is possible. He is also easygoing and doesn’t lose his temper often, preferring to avoid conflict. Which of the following statements about Joe is most likely TRUE?
a. Joe is a Type A personality.
b. Joe is o Type B personality.
c. Joe is a Type C personality.
d. Joe's risk of coronary heart disease is high.

Answers

Answer:b. Joe is a Type B personality

Explanation:

Type B personality individuals are more relaxed , easy going and tolerant .

They don't restrain themselves, if they get the opportunity to have fun they will grab it with both hands irrespective of how much work they may have to face afterwards.

Unlike type A personality individuals who are always worried about time due to their sense of urgency they don't see a need to be having fun when there is a lot of work that still need to be done and they stress a lot due to their aggressive nature .They always want to get ahead of everyone , life is a competition to them.

In the above text Joe leaves his work at work because he is a type B personality they treasure their relaxation time and always want to use it to the maximum.

They don't real take life as competition or see a need to get ahead of everyone which can be seen in non ambitious Joe above .

People with Type B personality tend to be more tolerant of others than Type A individuals because they are not competitors but they are more reflective, experience lower levels of anxiety and display a higher level of imagination and creativity.

When Dan was growing up, his mother very often ordered him to "do this" and "don't do that," which angered him. Now as an adult, Dan has a female boss who occasionally checks up with him by asking him if he remembered to "do this/that." According to the Transactional Analysis theory, one would most expect Dan to​
a. appreciate his boss's concem.
b. be conscious of his emotiomal response and its relationship with his childhood experiences.
c. interpret his boss's questions as badgering and feel angry.
d. react with guilt and self-doubt, regardless of his boss's gender.

Answers

Answer:c. interpret his boss's questions as badgering and feel angry.

Explanation:

This whole incident or situation will remind him of what his mom used to do badgering on him at all times checking up on him.

This will feel like a repetition of something that he has been through before which will trigger his anger .

He may forget that his boss is checking him on the professional level just because this happened repeatedly when he grew up and he ended up hating this kind of behaviour.

In 1961, the executive director of the Planned Parenthood League of Connecticut was arrested and convicted of providing contraceptive information and materials to married people in violation of state law. The director appealed her conviction, and the United States Supreme Court found that the law violated a constitutional right to privacy. The Constitution never mentions privacy, but the justices found that the right is embedded in several amendments. Which of the following is NOT one of those amendments?
a. Third
b. First
c. Fifth
d. Eighth

Answers

Answer:

d. Eighth

Explanation:

The Eighth Amendment to the Constitution is part of the Bill of Rights of the United States, which prohibits the federal government from imposing excessive bonds or unusual or cruel punishments. The United States Supreme Court has determined that the section on unusual and cruel punishments be applied to the states. The phrases used are originals of the English Bill of Rights of 1689.

Which of the following terms describes the idea that capitalists are driven to push down the wages of workers, which is in direct conflict with the goals of workers, who seek to secure higher wages?
a. class struggle
b. social solidarity
c. structural functionalism
d. conflict theory

Answers

Answer:

a. class struggle

Explanation:

According to my research on different political agendas, I can say that based on the information provided within the question the term being described is called a Class Struggle. Like mentioned in the question this is the conflict of interests between the workers and the upper economic class in a capitalist society. This type of conflict usually ends in violence, as seen throughout history.

I hope this answered your question. If you have any more questions feel free to ask away at Brainly.

Answer:

A. Class struggle

May I have brainliest please? :)

Spontaneous statements uttered by a suspect at the time of a crime, concerning and closely related to actions involved in the crime, are referred to as what type of statements?​ a. uttering​ b. exculpatory​ c. res gestae​ d. ​ in flagrante delict

Answers

Answer:

C) res gestae

Explanation:

Final answer:

The spontaneous statements made by a suspect closely related to the crime at the time it is committed are referred to as res gestae statements, which are part of the spontaneous reaction and may provide insights into the suspect's mindset.

Explanation:

Spontaneous statements uttered by a suspect at the time of a crime, concerning and closely related to actions involved in the crime, are referred to as res gestae statements. These are statements that are considered to be part of the spontaneous reaction to the event, often providing insights into the suspect’s mindset and circumstances surrounding the criminal act. This concept is distinct from an accusatory statement made while one is caught in flagrante delicto (in the act of committing an offense), or from exculpatory statements that aim to clear someone from blamed.

After the economic recession, the boating industry suffered from a decline in sales. However, recent sales forecasts indicate that the upcoming season will produce a strong demand for boats and boating equipment. Based on this, Les has decided to ramp up production this winter of both his bass fishing boats and speed boats, keep them in storage until the boating sales season officially resumes, and hope that customers will buy them. This is an example of a:

Answers

Answer:

Push strategy          

Explanation:

The push marketing strategy is also known as the push promotional strategy.

It refers to a plan or strategy in which a business firm tries to take or push its products or articles to consumers. This marketing strategy is generally used to obtain product exposure. The push marketing strategy attempts to sell products directly to the consumers,

A push strategy tries to sell directly to the consumer, bypassing other supplying channels.

______________ reports allow users to enter several variables​ (i.e., region and​ date) to produce a​ decision-making report. A. Integrated B. ​Drill-down C. Predictive D. Inductive E. Parameterized

Answers

Answer: Option (E) is correct.

Explanation:

Parameterized report are known to use input values in order to complete data processing or report. Under a parameterized report, one can vary or alter the output of the report that is based on values that are mostly set or equated before running the process. These reports are frequently utilized for linked reports, drill-through reports and sub-reports with related data.

In the area of economics and big business, what are three things that President Wilson accomplished?
a. raising tariffs to avoid competition
b. passage of the Federal Trade Act
c. signing the Clayton Antitrust Act
d. repealing the Sherman Antitrust Act
e. lowering tariffs for more competition
f. beginning the Interstate Commerce Commission

Answers

Answer:

b. passage of the Federal Trade Act  

c. signing the Clayton Antitrust Act

e. lowering tariffs for more competition

Explanation:

The Federal Trade Commission Act (1914) that founded the Federal Trade Commission, was signed by Woodrow Wilson to forbid unlawful means of competition or practices related to commerce.

The Clayton Antitrust Act (1914) was an amendment to the Sherman Antitrust Act of 1890, and focused on price discrimination, price-fixing, and unlawful business practices.

Wilson also signed the Revenue Act (1913) that considerably lowered tariff rates.

Which of the following are true of citizenship in the United States? Check all that apply.
a. Included among the legal obligations of U.S. citizenship are the requirements to obey the law, pay taxes, and serve on juries.
b. In their role as citizens of the United States, men and women have exactly the same rights and obligations.
c. Naturalized citizens obtain the same rights and responsibilities as citizens born in the United States.
d. Since the presidency of Jimmy Carter, it has been a requirement of citizenship for women to register with the selective service

Answers

Answer:b. In their role as citizens of the United States, men and women have exactly the same rights and obligations.

c. Naturalized citizens obtain the same rights and responsibilities as citizens born in the United States.

Explanation:Naturalized citizens which are foreign citizens that have been granted citizenship in America have to follow all the rules and regulations stated by the law in America with no exceptions and also they can have the same access to the resources because they are now the actual citizens of American even if it's not by birth .

Final answer:

Statements b, and c about U.S. citizenship are true: men and women have equal rights and obligations, and naturalized citizens share equal rights and responsibilities with those born in the U.S. Option d is incorrect as women do not have to register with the Selective Service.

Explanation:

Among the options provided regarding citizenship in the United States, the true statements are:

(b) In their role as citizens of the United States, men and women have exactly the same rights and obligations.

(c) Naturalized citizens obtain the same rights and responsibilities as citizens born in the United States.

It is important to note that option (a) and (d) is not correct. Women have not been required to register with Selective Service at any time since Jimmy Carter's presidency. Additionally, responsibilities such as paying taxes and obeying the law apply to both citizens and non-citizens living in the U.S. Rights and responsibilities such as voting and serving on juries, however, are specific to citizens. In summary, only b and c are correct statements about U.S. citizenship.

At Cadmia Services, the cashier collects checks and cash from customers, and the junior accountant records the transactions in the journal. The controller approves the journal entries and bank reconciliations. The treasurer signs checks and approves contracts. Which internal control procedure is exemplified in the above situation?

Answers

Answer:

Separation of Duties

Explanation:

According to my research on different internal control procedures, I can say that based on the information provided within the question the above situation exemplifies the procedure known as Separation of Duties. This is when more than one person is involved with completing a single task, which in this case is the check retrieval to approval process. This concept focuses on giving each person involved in the completion of a task, a small duty within that task in order to prevent error and fraud.

I hope this answered your question. If you have any more questions feel free to ask away at Brainly.

Darlene is trying to remember the name of a woman sitting next to her on the bus. She knows she met her at a party, and she is trying to remember which one. Darlene is able to imagine where the woman was seated at the party, as well as what she was eating. Darlene is using _____ to remember the woman's name.

Answers

Answer:

retrieval cues

Explanation:

According to my research on studies conducted by various psychologists, I can say that based on the information provided within the question Darlene is using retrieval cues to remember the woman's name. These are different stimuli that help an individual recall a certain memory. In Darlene's case these stimuli are the woman's location at the party as well what she was eating.

I hope this answered your question. If you have any more questions feel free to ask away at Brainly.

Final answer:

Darlene is using a technique called elaborative rehearsal to recall the woman's name by associating different details from the party to the woman's identity. Other memory-enhancing strategies include the use of mnemonic devices and chunking.

Explanation:

In this scenario, Darlene is using a memory-enhancing strategy known as elaborative rehearsal to recall the name of the woman sitting next to her on the bus. Elaborative rehearsal is a technique that involves thinking about the meaning of the new information and its relation to knowledge already stored in your memory. In this case, Darlene is associating the woman with details from the party where they met, like where the woman was seated and what she was eating, further linking the information to the woman's name.

Learn more about Memory Enhancement Techniques here:

https://brainly.com/question/34798367

#SPJ3

In the months following her graduation from college, Amber has grappled with feelings of hopelessness, worthlessness, and despair. In the last several weeks, these feelings have intensified, and Amber has withdrawn from all interaction with her friends and family. Based on this short description, it would appear that Amber is:a. Experiencing major depressive disorder.b. On the verge of a schizophrenic episode.c. Experiencing the classic symptoms of posttraumatic stress disorder.d. Experiencing a type of dissociative fugue.

Answers

Answer:

I believe that it is A: a major depression disorder

Explanation:

those are all common symptoms associated with depression

Final answer:

Amber appears to be exhibiting signs of major depressive disorder as she's shown symptoms such as profound sadness, feelings of worthlessness and hopelessness, decrease in social activity and enjoyment loss in earlier liked activities. A professional diagnosis is, however, recommended as this analysis is based on a short description only. Other psychological disorders mentioned as alternatives do not fit well with her described condition.

Explanation:

Based on the given information, it seems that Amber may be experiencing major depressive disorder. According to DSM-5 descriptions, major depressive disorder is characterized by episodes of profound sadness, feelings of worthlessness, hopelessness, and a decrease in social interaction and the enjoyment of activities that one used to like. It's important to note that a clinical diagnosis should be made by a mental health professional, as they can accurately diagnose and recommend treatment options based on personal examination and interview.

In comparison, the other options such as schizophrenia, posttraumatic stress disorder (PTSD), and dissociative fugue, describe different sets of symptoms and behaviors. Schizophrenia, for example, typically involves symptoms such as hallucinations and delusions, which are not mentioned in Amber's case. PTSD is usually linked to traumatic events, with symptoms like flashback and irritability. Meanwhile, dissociative fugue involves a person suddenly wandering away from home and experiencing confusion about their identity.

Following graduation, adjustment to a new phase of life can be challenging and might contribute to such feelings, which Amber has grappled with. However, without professional opinion, it would not be advisable to conclusively diagnose Amber's condition based on the provided information.

Learn more about Major Depressive Disorder here:

https://brainly.com/question/17293944

#SPJ2

What is an independent agency?
A) An agency that was not created by a law passed by Congress.
B) An agency whose budget comes from outside funding.
C) An agency that is not part of any Cabinet department.
D) An agency that is not part of the government.
E) An agency entirely created by the president, independent of congressional action.

Answers

Answer:

Option C.

Explanation:

An agency that is not part of any Cabinet department, is the right answer.

Those agencies of the federal government of the  United States that exist outside the national executive departments (those supervised by a Cabinet administrator) and  President's Executive Office, are known as the Independent agencies. In simple terms, this is a term used to describe those agencies that while legally portion of the executive branch, are autonomous of presidential authority, usually because the power of the president to remove the agency leader or a member is restricted.

What hypothesis suggests that when the evidence is uncertain, jurors are "liberated" from the constraints imposed by the law and therefore feel free to take legally irrelevant factors into consideration?

Answers

Answer:  The correct answer is :  liberation hypothesis

Explanation:   An explanation for research findings suggesting legally irrelevant factors (eg, the race or gender of the defendant and victim, the bx of the victim at the time of the crime) come into play primarily in cases where the evidence is ambiguous and the outcome is therefore less predictable.

A student is conducting a research project that involves using a survey. The survey asks participants about their highest level of education, political affiliation, and views on various social issues. No identifiable information will be collected. This study would be categorized as which type of review?a.Not Human Subjectsb.Exempt Reviewc.Full Board Reviewd.Expedited Review

Answers

Answer:

b. Exempt Review

Explanation:

Exempt review is a term used in academic studies that represents a situation in which a research or study may be approved by the institutional review committee (IRB), even with minimal risk. This type of research does not require much protocol by the IRB and can be approved for publication even without the need to convene this committee.

Answer:

b. Exempt Review

Explanation:

A student is conducting a research project that involves using a survey. The survey asks participants about their highest level of education, political affiliation, and views on various social issues. No identifiable information will be collected. Therefore, the study would be categorized as an Exempt Review.

Mariah works in the public relations department of New Trends Sales Company. Her job includes portraying New Trends's activities in their best light. In this context, ethics consist ofa. a different set of principles from those that apply to other activities.b. the same moral principles that apply to non-business activities.c. those principles that produce the most favorable financial outcome.d. whatever saves New Trends's "face."

Answers

Answer: b. the same moral principles that apply to non-business activities.

Explanation:

Moral principles are a set of rules imposed by society that indicate what is accepted, not accepted, and what should be punished. Ethics is the science that studies moral behavior, its relationship with human behavior, and its implications with society.

The moral principles that govern all activities are the same; their change is not justifiable only by the activity being carried out. Therefore, Mariah must follow the same moral principles of her community to do the work in New Trends.

I hope this information can help you.

Think about the criticisms of society made in harrison bergeron . what aspects of todays society seem open to vonnegut's criticisms

Answers

Answer:

The criticisms of society made by Harrison Bergeron is about the divergence between the government and the freedom for individuality.  The government demands him to be something that he is not, and he insists  on his personality, so he is killed by the government.

We can still face in our modern society the government trying to shape the individual, they use rules and lows to force people to follow the model.

Final answer:

Aspects in today's society open to Vonnegut's criticisms as reflected in 'Harrison Bergeron' might include areas of over-regulation, excessive conformity, and extreme pursuit of equality which can stifle individuality and freedom.

Explanation:

In Harrison Bergeron, Kurt Vonnegut presents a future society where everyone is forced to become equal in every way through physical restrictions. Therefore, areas in today's society open to Vonnegut's criticisms could include that of over-regulation and conformity. One could argue that excessive governmental controls, such as an overreliance on standardized testing in education, are analogs to the handicaps used in the story. Also, the pursuit of equality, when taken to the extreme, can stifle individuality and freedom, an issue projected in Bergeron's world and pertinent in debates about political correctness today.

Learn more about Harrison Bergeron here:

https://brainly.com/question/30103485

#SPJ6

The principle of popular sovereignty is best demonstrated in A. the political bipartisanship needed to pass the Kansas-Nebraska Act. B. the ability of abolitionists to hold public protests advocating for an end to slavery. C. the proposal that the Nebraska Territory would decide for itself whether to allow slavery. D. the right of slaves such as Dred Scott to petition the court system for their freedom.

Answers

Answer: C. the proposal that the Nebraska Territory would decide for itself whether to allow slavery.

Explanation:

The concept of popular sovereignty states that only the residents of the territory can choose whether or not slavery is allowed.

The Kansas-Nebraska Act (1854), proposed by Stephen A. Douglas, stated popular sovereignty to recognize the settlers´ right to make that decision within the new state. This act raised rather than reduced sectional conflicts, leading to Bleeding Kansas, a period of violence foregoing the American Civil War.

Darley and Latané observed that most university students failed to help a person having an epileptic seizure when they thought there were four other witnesses to the emergency. The students' failure to help is best explained in terms of:
A)the ingroup bias.
B)a failure to interpret the incident as an emergency.
C)indifference and apathy.
D)their feelings of limitedresponsibility.
E)emergency preparedness

Answers

Answer:

The correct answer d. D)their feelings of limited responsibility.

Explanation:

Some people do not take actions or responsibilities when there are more people present. In their minds, these individuals think that others are more capable or they are the ones who need to take responsibility in that situation. So, they have feelings of limited responsibility.

The bystander effect and diffusion of responsibility explain why individuals fail to help in emergencies when others are present.

Diffusion of responsibility is the best explanation for why bystanders fail to help in emergencies when others are present. In the presence of multiple witnesses, individuals often assume someone else will take action, leading to inaction from everyone. This phenomenon is known as the bystander effect.

Knowing what you need to accomplish _____, and how you intend to do it, gives you an edge over someone who merely reacts to monetary events as they unfold.

Answers

Answer:

"financially".

Explanation:

According to my research on investment strategies, I can say that based on the information provided within the question the term that is missing is "financially". This can be said because at the end of the statement you are talking about money, which if we stick to that subject the word that would make the most sense in this would be "financially."

I hope this answered your question. If you have any more questions feel free to ask away at Brainly.

Answer:

Financially

Explanation:

Knowing what you need to accomplish financially, and how you intend to do it, gives you an edge over someone who merely reacts to monetary events as they unfold.

A white woman goes into an upscale shop to look at clothes. She is excited to see that there is a sale and gathers a huge pile of clothes to take into the dressing room. An African American woman goes into the store and is also excited about the sale but hesitates to take too many clothes into the dressing room because she is afraid the staff will accuse her of shoplifting. W. E. B. Du Bois would say that the African American woman has:

Answers

Answer:Double Consciousness

Explanation:

Double consciousness is an internal conflict that occurs in someone who belongs in a group considered to be subordinate (a group with less authority than the other group ) due to oppression.

An African women is facing a dilemma because she knows what black people are associated with in an oppressive society .

She may have clean record and good intentions of buying the same amount of clothes just like the white woman but because of her colour the owner may think otherwise or the peoplen in the shop may think otherwise .

The fact that she may also be considered as a person who will not afford those clothes , will have an impact on the situation if she takes the same amount of clothes to fit .

In most one-year-olds,
a. language comprehension typically precedes language production.
b. language production typically precedes language comprehension.
c. language comprehension and language production occur simultaneously.
d. neither language comprehension nor language production is readily apparent.

Answers

Answer: Option (A) is correct.

Explanation:

Cognitive development in most infants and one-year olds tend to take place latter in their life but several component of this development tend to develop from this stage. One such factor is language, under which language comprehension typically precedes language production, i.e. infants and children that are one year old tend to first listen and hear the words and sound being spoken around and to them. Later they try to produce the same.

A member of the Senate makes a statement to the press that she is unsure of how she is going to vote on a bill. After numerous calls from her constituents asking her to vote for the bill, she votes in support of the bill.What is this an example of?

Answers

Republicanism is the correct answer.

Republicanism is a form of government centered on citizenship. In a republican government the people elect the person who will represent them, their interests and protect their rights. The situation above is an example of republicanism because the member of the Senate represented the will of her constituents when voting for the bill.

Janyce, a 50-year-old woman, has several stressors in her life, so she turns to her friends to help her deal with the pressure. Which statement BEST explains the physiological phenomenon associated with her method of coping?

A. She is reacting in a "fight-or-flight" manner, experiencing a rise and then fall in testosterone levels.
B. She is suppressing justifiable feelings, and thus may be at greater risk for an early death.
C. She is arranging her life to minimize stressors, and thus is experiencing reduced stress.
D. Her body is producing oxytocin, a hormone that encourages caring interactions.

Answers

Answer:

d

Explanation:

Scenario: Growth Rates in Two Countries India is growing at a rate of 9% per year, and its real GDP per capita is about $3,500, while the United States is growing at a rate of 3% per year, and its real GDP per capita is about $47,000. (Scenario: Growth Rates in Two Countries) Look at the scenario Growth Rates in Two Countries. How long will it take the United States to double its real GDP per capita?

Answers

Answer:

23,33 years.

Explanation:

We can use the rule of 70 to calculate what the value of a variable might be in the future(taking into consideration that it is an estimate). This rule is pretty efective to determine the amount of years that take a variable to double.

The rule of 70 is representated in this formula:

[tex]Number of years to double=\frac{70}{Annual Rate of Growth}[/tex]

The annual rate of Growth is 3%

We replace:

[tex]Number of years to double=\frac{70}{3}[/tex]

[tex]Number of years to double=23,33[/tex]

Note: In the formula we need to put the percentage not divided by 100 but complete, so we put 3 instead of 0.03 for the formula to work.

At a constant growing rate of 3% per year, the United States would rake 23,33 years to double its real GDP per capita.

An effective warning message designed to elicit a quick response from the public includes all of the following components EXCEPT: A. Protective actions B. Hazard magnitude C. Historical background D. Likelihood

Answers

Answer:

C. historical background

Explanation:

According to my research on natural disaster warning procedures, I can say that based on the information provided within the question all of the answers provided except for historical background will elicit a quick response from the public. In order for the public to react quickly to an upcoming dangerous event they need to know how bad the event will be, how likely it is to happen, and what they can do to protect themselves. Historical background will not provide any help to the public.

I hope this answered your question. If you have any more questions feel free to ask away at Brainly.

Answer:

C. Historical background

Other Questions
The economy of early villages and cities was based mainly on What is the solution to 4x+5y=12x6y=22 Edouard Daladier became Prime Minister of which country in 1933? A __________ is a wide-mouthed body of water close to shore. Cusic Industries had the following operating results for 2019: sales = $34,621; cost of goods sold = $24,359; depreciation expense = $6,027; interest expense = $2,725; dividends paid = $2,023. At the beginning of the year, net fixed assets were $19,970, current assets were $7,075, and current liabilities were $4,010. At the end of the year, net fixed assets were $24,529, current assets were $8,702, and current liabilities were $4,700. The tax rate was 25 percent. a. What is net income for 2019? (Do not round intermediate calculations.) b. What is the operating cash flow for 2019? (Do not round intermediate calculations.) c. What is the cash flow from assets for 2019? (A negative answer should be indicated by a minus sign. Do not round intermediate calculations.) d-1. If no new debt was issued during the year, what is the cash flow to creditors? (Do not round intermediate calculations.) d-2. If no new debt was issued during the year, what is the cash flow to stockholders? (A negative answer should be indicated by a minus sign. Do not round intermediate calculations.) Evaluate M2/P2 for M = 10, N = -5, and P = -2? A.-5 B.5 C.-25 D.25 Read the sentences. Sentence 1: I hope the dinner comes out perfectly, but even if it doesnt, Im pretty sure theyll know how hard I tried. Sentence 2: Then well have coffee cake for dessert, which I made from scratch. Sentence 3: I am making my sisters favorite: roasted chicken, brown rice, and brussels sprouts. Sentence 4: I cannot wait to cook dinner for my family tonight. What is the most logical sequence for these sentences in a story? 1, 3, 2, 4 4, 1, 3, 2 4, 3, 2, 1 3, 2, 1, 4 An RNA virus that infects plant cells is copied into a DNA molecule after it enters the plant cell. What would be the sequence of bases in the first strand of DNA made complementary to the section of viral RNA shown here? 5' CCCUUGGAACUACAAAGCCGAGAUUAA 3' Reasoning if you multiply two decimals that are less than 1,can you predict whether the product will be less thanor greater than either of the factors? Explain What is the greatest common factor of 19 and 18? What happened as a result of the Sand Creek Massacre? Please select the word from the list that best fits the definition Likes to study with music in the background Which function has the given graph? Consider a river flowing toward a lake at an average velocity of 3 m/s at a rate of 500m3/sat a location 90 m above the lake surface. Determine the total mechanical energy of the river water per unit mass and the power generation potential of the entire river at that location. Angelo made the decision to outsource the software components of his consulting company so he could focus on the companys ________, which are sources of competitive advantage, make a contribution to perceived customer benefits, have application in a wide variety of markets, and are difficult to imitate. Food web starting with sun and pointing to grasshopper and squirrel; Grasshopper pointing to squirrel, wolf, and snake; squirrel pointing to wolf, snake, and bird; wolf pointing to decomposition with worms and mushrooms; snake pointing to wolf and decomposition with worms and mushrooms; bird pointing to decomposition with worms and mushrooms; decomposition pointing to the sun stating soil nutrients.If we removed the decomposers from this food web, how would it affect the balance of the ecosystem? There would be an increase in dead matter and a lack of nutrients in the soil. There would be a decrease in dead matter and a lack of nutrients in the soil. There would be an increase in dead matter and an increase in nutrients in the soil. There would be a decrease in dead matter and an increase in nutrients in the soil. Which of the following would NOT be considered an investment in human capital?Aobtaining a college degreeBpurchasing a new computerCattending a first-aid classDpaying for cooking lessons For a class Foo, one difference between a variable declared Foo * and a variable declared Foo & is that only the variable declared Foo & can potentially have the value NULL.Select one:a. FALSEb. TRUE how do chemicals affect our lives? what is the region of very calm seas and little to no wind on either side of equator?