From the book the Alchemist.

How does the Englishman develop the theme that one can only realize one’s Personal Legend by overcoming challenges?

A)When Santiago offers his help and knowledge, the Englishman is able to find the alchemist in the desert.

B)The Englishman recognizes that his meeting with Santiago is an omen.

C)When the Englishman asks the alchemist how to turn lead into gold, the alchemist tells him that he must keep trying.

D)The Englishman encourages Santiago to speak with Fatima.

Answers

Answer 1
D ........................................................
Answer 2

Answer:

C) When the Englishman asks the alchemist how to turn lead into gold, the alchemist tells him that he must keep trying.

Explanation:

In "The Alchemist," by the Brazilian author Paulo Coelho, the Personal Legend is the personal fate, the deepest wish that every person has and constantly must seek to satisfy. In the book, the Englishman wants to be an alchemist in order to transform lead into gold, that is his Personal Legend and that is the reason why he crosses the desert in order to find the alchemist to be his mentor. But the alchemist does not help him to turn lead into gold, instead, he tells him to keep trying by himself. This means that one cannot realize his/her Personal Legend without overcoming challenges. In this sense, it is necessary to face obstacles and to overcome them in order to grow and to fulfill one's fate.


Related Questions

In the poem “The Bells,” the words “liquid ditty” are an example of _____.

A.) Personification

B.) Assonance

C.) Alliteration

D.) Hyperbole

Please do not answer with hyperbole that is a wrong answer.

Answers

I believe that since Assonance would be repeated vowel sounds between 2 or more words the answer SHOULD be B Assonance.

Answer:

assonace

Explanation:

Who does mercutio suggesr romeo spent tue nihy with?

Answers

to dance at the party with other girls

Which sentence is written correctly? A) Were my grandfather alive, he will be so proud of me today. B) Was my grandfather alive, he would be so proud of me today. C) Were my grandfather alive, he would be so proud of me today. D) When my grandfather is alive, he would be so proud of me today.

Answers

C) Were my grandfather alive, he would be so proud of me today 

Due to the usage past tense (tenses must match) 
Hope this helps:)
C) Were my grandfather alive, he would be so proud of me today.

Read the excerpt from On the Road. I began to learn from him as much as he probably learned from me. As far as my work was concerned he said, “Go ahead, everything you do is great.” He watched over my shoulder as I wrote stories, yelling, “Yes! That’s right! Wow! Man!” and “Phew!” and wiped his face with his handkerchief. “Man, wow, there’s so many things to do, so many things to write!” What does this excerpt demonstrate about Kerouac’s connection to the literary movement of the beat generation?

Answers

Answer:

The connection is shown through the way Kerouac freely expressed himself and told his view of the world in his stories.

Explanation:

In his most important book, which would become the "hippie Bible," Kerouac talks about his seven-year journey across the US, with frequent descents to Mexico. Kerouac wrote it in just three weeks, with a typewriter and two rolls of paper (so you do not have to stop to put new sheets in the machine). His "avalanche-style", without concern for punctuation and paragraph, is a striking feature of the writers of the beat movement .

Answer:

Kerouac expresses original ideas and viewpoints that are exciting to read.

Explanation:

Which verb correctly agrees with the subject of the sentence? Most of the team ____________ the opponents' skills. A)respect B)respected
C)respectfullyD) respects

Answers

my answer is d hope that helps
The correct answer would be:

Most of the team respects the opponents' skills.

The other options provided would make the sentence incorrect.

In what way does "She Dwelt Among the Untrodden Ways" best exemplify Wordsworth's choice to take his subjects from "Low and rustic life"? Click here to read the poem. Lucy was quite dear to the speaker. Lucy was quite young when she passed away. Lucy was "Fair as a star, when only one / Is shining." Lucy was little known because she frequented "the untrodden ways / Beside the springs."

Answers

The correct answer is the final one: Lucy was little known because she frequented "the untrodden ways / Beside the springs."

Rustic means "relating to the countryside; rural." The poem describes a young country girl. We know that she is from the country because Wordsworth describes a country scene -- he mentions a spring, a flower, a mossy stone. Also, the fact that she frequents the "untrodden ways" is another indication that she is not from a city. She "lived unknown," meaning she lived a simple, rustic life.

The poem "She Dwelt Among the Untrodden Ways" exemplifies Wordsworth's choice to take subjects from "Low and rustic life" by portraying Lucy as a humble, secluded figure in a rural setting, which aligns with Wordsworth's theme of finding beauty and emotional depth.

The poem "She Dwelt Among the Untrodden Ways" by William Wordsworth exemplifies his choice to take his subjects from "Low and rustic life" by focusing on a character, Lucy, who leads a simple, obscure existence in a rural setting. Lucy is portrayed as living among "the untrodden ways beside the springs," which indicates a life far removed from the bustle and recognition of society, embodying Wordsworth's preference for the simplicity and purity found in the rustic life.

The speaker's deep affection for Lucy, despite her lack of fame and her proximity to nature, mirrors Wordsworth's valuing of the common man and the ordinary, natural world over the artificiality and pomp of urban life and the elite. In his larger body of work, Wordsworth emphasized the beauty and emotional value inherent in the natural world and the lives of common people.

This theme is consistent with his concept of poetry as the "spontaneous overflow of powerful feelings," which is meant to originate from emotions recollected in tranquility, often amidst natural settings, as demonstrated in other poems like "I Wandered Lonely as a Cloud." Wordsworth's approach in "She Dwelt Among the Untrodden Ways" reflects this philosophy, as the poem's tranquil and simple depiction of Lucy's life resonates with deep emotion felt by the speaker upon reflecting upon her death.

Identify three groups that White says heard the call of the American idea

Answers

In 'The American Idea', Theodore White identifies three groups of immigrants that heard the call of the idea that all men are created equal. They are workers from potato patches of Ireland, the ghettos of Europe, and the paddy fields of China.  
Final answer:

The three groups that may have heeded the call of the American Idea, as per Theodore White, could be inferred as the early American settlers working towards freedom, the waves of immigrants seeking opportunity in the new world, and African Americans and women fighting for equality and democratic rights.

Explanation:

In 'The American Idea', Theodore White does not specify three distinct groups, but through interpretation of various literary and historical sources, we might infer the groups as follows:

Early American Settlers: These were the pioneers of the American democracy, from different backgrounds, who fought for freedom and independence. Their shared common cause was a stepping stone to the formation of a democratic government. Immigrant Populations: America, a 'nation of immigrants' as quoted by many, has welcomed waves of immigrants with its promise of equality and opportunity. These new Americans, whether they originated from Europe or Asia, contributed to the American idea by integrating their cultural values African Americans and Women: Initially denied voting rights, these groups struggled for suffrage rights, thus embodying the spirit of the American Idea – equality and democracy for all.

Learn more about American Idea here:

https://brainly.com/question/31272825

#SPJ11

which is an example of foreshadowing in the mousetrap

Answers

major Metcalfs true identity

A model would be the young lady saw the substance of her genuine romance in a fantasy this is portending the young lady seeing her genuine romance, all things considered as option C i.e major Metcalfs true identity.

What do you understand by foreshadowing?

Portending is a scholarly gadget where an essayist gives a development clue of what is to come later in the story.

Hinting frequently shows up toward the start of a story, or a part, and it assists the peruser with creating assumptions regarding the impending occasions. An essayist might carry out foretelling in various ways.

A person's contemplations can hint. For instance, I let myself know this is the finish of my difficulty, however I didn't trust myself.

Narration can hint by letting you know something will occur. Subtleties are much of the time forgot about, however the tension is made to keep perusers intrigued.

For more information about Foreshadowing, refer the following link:

https://brainly.com/question/12619838

#SPJ2

Please help..... what real life event inspired Amy tan to write the joy luck club?

Answers

C is the answer on apex

The real life event that inspired Amy Tan to write the joy luck club is that she discovered that she had half sisters living in China. Option C is correct.

The Joy Luck Club is a novel written by Amy Tan in 1989. It follows the story of four Chinese American immigrant families in San Francisco who start a club known as The Joy Luck Club, playing the Chinese game of mahjong for money while feasting on a variety of foods.

Is copping someone answer from Brainly show up as plagiarism for the teacher?

Answers

Yes if it is not your work then it is plagiarism to copy and say you did it. you always want to rephrase your work. (: 

Answer:

Yes

Explanation:

Plagiarism is any work that is not yours but turned in as yours,

BY THE PRESIDENT OF THE UNITED STATES OF AMERICA.
A PROCLAMATION.

I, ABRAHAM LINCOLN, President of the United States of America, and Commander-in-Chief of the Army and Navy thereof, do hereby proclaim and declare that hereafter, as heretofore, the war will be prosecuted for the object of practically restoring the constitutional relation between the United States, and each of the States, and the people thereof, in which States that relation is, or may be, suspended or disturbed.

That it is my purpose, upon the next meeting of Congress to again recommend the adoption of a practical measure tendering pecuniary aid to the free acceptance or rejection of all slave States, so called, the people whereof may not then be in rebellion against the United States and which States may then have voluntarily adopted, or thereafter may voluntarily adopt, immediate or gradual abolishment of slavery within their respective limits; and that the effort to colonize persons of African descent, with their consent, upon this continent, or elsewhere, with the previously obtained consent of the Governments existing there, will be continued.

That on the first day of January in the year of our Lord, one thousand eight hundred and sixty-three, all persons held as slaves within any State, or designated part of a State, the people whereof shall then be in rebellion against the United States shall be then, thenceforward, and forever free; and the executive government of the United States, including the military and naval authority thereof, will recognize and maintain the freedom of such persons, and will do no act or acts to repress such persons, or any of them, in any efforts they may make for their actual freedom.

That the executive will, on the first day of January aforesaid, by proclamation, designate the States, and part of States, if any, in which the people thereof respectively, shall then be in rebellion against the United States; and the fact that any State, or the people thereof shall, on that day be, in good faith represented in the Congress of the United States, by members chosen thereto, at elections wherein a majority of the qualified voters of such State shall have participated, shall, in the absence of strong countervailing testimony, be deemed conclusive evidence that such State and the people thereof, are not then in rebellion against the United States.

That attention is hereby called to an Act of Congress entitled "An Act to make an additional Article of War" approved March 13, 1862, and which act is in the words and figure following:

‘‘Be it enacted by the Senate and House of Representatives of the United States of America in Congress assembled, That hereafter the following shall be promulgated as an additional article of war for the government of the army of the United States, and shall be obeyed and observed as such:

Article —. All officers or persons in the military or naval service of the United States are prohibited from employing any of the forces under their respective commands for the purpose of returning fugitives from service or labor, who may have escaped from any persons to whom such service or labor is claimed to be due, and any officer who shall be found guilty by a court-martial of violating this article shall be dismissed from the service.

SEC. 2. And be it further enacted, That this act shall take effect from and after its passage."

What is the effect of the following passage on the U.S. government?

“...and the executive government of the United States, including the military and naval authority thereof, will recognize and maintain the freedom of such persons, and will do no act or acts to repress such persons, or any of them, in any efforts they may make for their actual freedom.”

A) It intends to conscript former slaves into the military.

B) It intends to prosecute former slave owners.

C) It will not stop any slave from moving toward freedom.

D) It will use its military and naval authority to stop the war.

Answers

The answer is C because if you look at the last paragraph it says -“...and the executive government of the United States, including the military and naval authority thereof, will recognize and maintain the freedom of such persons, and will do no act or acts to repress such persons, or any of them, in any efforts they may make for their actual freedom.” hope it helps

Based on this etymological information, what is the meaning of the word tectonic?
technology: Greek tekhno "chief" + Greek logy "study of"
architect: Greek arkhi "chief" + Greek tekton "builder, carpenter"
archbishop: Greek arkhi "chief" + Greek episkopos "bishop"
polytechnic: Greek polys "many" + Greek tekhne "art"

Answers

Using "Tekton" we can guess that tectonic means something related to building, carpentry, or construction

Why are classical allegories not regarded as realistic fiction?

Answers

The correct answer is the second statement. Classical allegories are not regarded as realistic fiction because their characters are generally flat and merely function as symbols for particular concepts. Allegories are literary genre that are textually constructed as a metaphor, that presents political or moral hidden meaning, which is why they can’t be considered for realistic fiction.

Answer: Their characters are generally flat and merely function as symbols for particular concepts.

Explanation:

Which group of people generally make the most valuable informants?
A. Criminals or their associates
B. Mentally ill persons
C. Law enforcement officers
D. Average citizens

I feel that A and C are the most reasonable, but im confused because what does it mean by informants? Police officers who gather info?

Answers

By informants I think they mean who would be able to give the most info to law enforcement officers so A would be the answer.
By informants they mean people that can provide information, so the most valuable imformants of crime would be A. criminals or their associates.

Which statement describes the cultural and generational perspectives revealed in Shakespeare’s sonnet 130 and “Perfect for Me” by Shwayze?
A. Shakespeare idealizes his love; Shwayze accepts her as she is.
B. Both writers claim the world stops for their love.
C. Both writers express their love for someone as she is.
D. Neither writer uses imagery in his poem.

Answers

The answer is c
They both claim there love for who she is

The correct answer is letter C. Both Shakespeare and Shwayze describe a lady in a natural light as the object of their poetry.

Shakespeare describes his mistress in a very realistic way which borders into parody e.g. "And in some perfumes is there more delight. Than in the breath that from my mistress reeks ". Still, however, he affirms his love as he considers it rare.

Schwayze describes his  platonic love's kiss, lips, and nose as "perfect" for him. Even though they "have been playing musical chairs for years" he is confident enough in his love to admit "I love everything" as he wonders "do you think that we could ever be one instead of two?" .


Identify the sentence type. Should we take the freeway, or would the surface streets be faster? a. simple c. complex b. compound d. compound-complex Please select the best answer from the choices provided A B C D

Answers


B, compound



♣Amaranthine

Answer:

The sentence above is a compound sentence.

Explanation:

A compound sentence joins two or more independent clauses with a coordinator such as and, for, or, but, or a semicolon.  An independent clause is a sentence that can stand alone as a sentence as it represents a complete thought. In the case of the sentence above, the independent clauses that make up the compound sentence have been brought together by the coordinator "or".

Match the type of menus to its description.
1.) this menu is a combination of fixed and market.
2.) the items on this menus are constant throughout the year.
3.) this menu features only seasonal items.
4.) this menu features a different set of items each day of the week, but the menus repeats each week.
A.) fixed
B.) market
C.) hybrid
D.) cycle

Answers

2. A
1. C
4. D
3.B

Please vote my answer brainliest. thanks!

Suppose an author writes a story about a peaceful dragon who is attacked by an evil knight in shining armor. With this reversal in character depiction, what theme is the author most likely trying to emphasize?
A. A theme about the tragedy of violence
B. A theme about how appearances can be deceiving.
C. A theme about death and kindness
D. A theme about the nature of friendship

Answers

The author is most likely trying to emphasize (B.) a theme about how appearances can be deceiving.

The author is presenting an original reversal in character depiction, that is, a literary technique that consists in portraying a character in an opposite way to his stereotype, which is the way in which it is usually portrayed. While in traditional stories and legends the knight in shining armor is depicted as the hero and the dragon is presented as an evil animal and a big menace due to its size, in this story the author pretends to represent the dragon as the good one and the knight as a wicked man. What the writer wants to emphasize is that a dragon can be peaceful and quiet despite the way it looks and a human being can be ruthless in spite of its small size; therefore, appearances can be deceiving.

Final answer:

The author is most likely emphasizing the theme that appearances can be deceiving, by portraying a peaceful dragon and an evil knight, challenging stereotypical roles and encouraging readers to look beyond the surface.

Explanation:

If an author writes a story about a peaceful dragon who is attacked by an evil knight in shining armor, the theme the author is most likely trying to emphasize is how appearances can be deceiving. This reversal in character depiction contrasts the traditional roles and expectations of dragons and knights, typically seen in literature as the embodiment of evil and good, respectively. The peaceful nature of the dragon subverts the common stereotype, suggesting that external appearances and established roles might not accurately reflect true character or intentions. Instead of viewing literature and its characters in black and white, this theme encourages readers to look beyond the surface and question our preconceived notions. This perspective aligns with the broader theme of questioning and understanding the Other, which refers to individuals or groups perceived as different from oneself. Such themes are prevalent in stories across cultures, emphasizing the importance of empathy and the dangers of snap judgments based on appearances or societal roles.

in our keyboard era, should we still attempt to teach orthography, or is handwriting becoming an anachronism

Answers

Final answer:

While we live in a digital age, the teaching of handwriting or orthography still holds significant value. Handwriting promotes cognitive exercise and memory retention. Therefore, despite shifting trends, it remains an essential learning tool.

Explanation:

In this modern technological age, the topic of whether we should continue to teach orthography or handwriting is quite relevant. While it's true that digital communication is becoming more prevalent, handwriting still serves a fundamental purpose in our society.

Handwriting is not merely a means of communication but a form of cognitive exercise. Research like that carried out by Zwicker (2005) has demonstrated the effectiveness of handwriting as a cognitive and multi-sensory intervention in primary students. Despite the convenience of digital keyboards, the practice of handwriting promotes memory retention and fine motor skills development, essential aspects that are not activated in the same way when typing.

Therefore, despite the popularity and efficiency of the keyboard era, handwriting or orthography is not becoming an anachronism, rather it becomes more valuable. Though technology brings convenience, balancing it with traditional handwriting skills can lead to more comprehensive cognitive and learning development.

Learn more about Importance of Handwriting here:

https://brainly.com/question/35090688

#SPJ12

Modern poetry, fiction, and non-fiction were influenced by ____.

Answers

Since "modern times" are usually defined to have begun during the Industrial Revolution. The best answer to your question is that industrialization and technological advances; new discoveries in science; and the rapid growth of cities influenced modern poetry, fiction, and non-fiction.

Read the passage.


Benjamin Franklin was a man of vision. He was an inventor who created bifocals, a new kind of eyeglasses that people still wear to see better. Benjamin Franklin was also concerned about public welfare. He established the United States Postal Service and the first city hospital in America. In Philadelphia, he organized the police department, the fire department, the public library, and a university. He also helped write the Declaration of Independence and the Constitution. Today, millions of people benefit from the ideas that Benjamin Franklin had more than two hundred years ago.

What is the role of the underlined sentence in this paragraph?


It is a statistic that serves as a supporting detail.
It is a summarizing sentence.
It is the topic sentence.
It is an example that serves as a supporting detail.

Answers

b because today we still have and use universities and the police and fire department. also, public libraries are vastly used

Answer:

It is a summarizing sentence.

Explanation:

Taking into account the passage and the examples provided to relate it, we can affirm that the correct option is the B, since the sentence is a summary of the biography of Mr. Benjamin Franklin, in addition to this it also summarizes his main achievements as well as his main concerns, and how all this influences the lives of Americans today.

what different types of companionship exist

Answers

Well, there's camaraderie, which I believe is a relationship with brothers-in-arms (army, navy people, etc), obviously romantic relationships, platonic relationships, etc.. 
for bio there are symbiotic relationships

Summarize the narrative Churchill present

Answers

Our idea of the wartime 'Big Three' may be derived from their photographs together at Teheran in 1943 and at Yalta in 1945; it is well to be reminded that these were the only occasions at which they met as a group. On the other hand, Churchill and Roosevelt met together on eleven occasions (including the Atlantic Conference before the US entered the war) and Churchill and Stalin on three occasions. Roosevelt and Stalin never met except on the margins of the two trilateral meetings. In so far as a triumvirate existed, it was a matter of communications through messages or intermediaries. Room for misunderstanding was always present. How could this not be the case since their countries, their personal philosophies and national objectives were so different? What united them was the determination between June 1941, when Hitler invaded the Soviet Union, and the end of the European war (by which time Roosevelt was dead) that Hitler's Reich should suffer total defeat and Nazism be extirpated. Everything else was problematic and contingent.

How English has evolved since the beginning?

Answers

Mar 23, 2015 · The Evolution Of Language English Language Essay. ... middle English has evolved a great deal since the beginning of its time into ... modern English

✨Hope this Helps



Over time, the different languages combined to result in what English experts call Middle English. While Middle English still sounds similar to German, it also begins to sound like Modern English.


Here Warren Scheer reads the very beginning of Geoffrey Chaucer’s great poem, “The Canterbury Tales” as it was written in Middle English.


Chaucer wrote that poem in the late thirteen hundreds. It was written in the language of the people. The rulers of Britain at that time still spoke the Norman French they brought with them in ten sixty-six.


The kings of Britain did not speak the language of the people until the early fourteen hundreds. Slowly, Norman French was used less and less until it disappeared.


The English language was strongly influenced by an event that took place more than one thousand four hundred years ago. In the year five ninety-seven, the Roman Catholic Church began its attempt to make Christianity the religion of Britain.


The language of the Catholic Church was Latin. Latin was not spoken as a language in any country at that time. But it was still used by some people.

Match the definition to the term.

1. a verb functioning as a noun predicate
2. a subordinate clause which modifies a noun gerund
3. the verb of a clause possessive case
4. a word which joins words, phrases, or clauses adjective clause
5. shows ownership transitive verb
6. transfers action to an object conjunction

Predicate
Gerund
Possessive Case
Adjective Case
Transitive Verb
Conjunction

Answers

These are the answers:

1. Predicate
2. Adjective Case 
3.Gerund
4. Conjunction
5. Possessive Case 
6. Transitive Verb

Gerund = a verb functioning as a noun

Adjective Case = a subordinate clause which modifies a noun

Predicate = the verb of a clause

Conjunction = a word which joins words, phrases, or clauses

Possessive Case = shows ownership

Transitive Verb = transfers action to an object

Which quote from "The Morning of June 28, 1948" best supports the conclusion that the public strongly disliked "the lotttery?"

"This, as any writer of stories can tell you, is not a usual thing"

"Your story has kicked up quite a fuss around the office"

"Later that day there was a call from on of the magazine'sitors; they had had a couple of people phone in about my story, he said to say if there were any more calls?"

"One of the most terrfying aspects of publishing stories and books is the realization that they are going to be read, and ready by strangers."

Answers

I think the answer is C.

Answer:

The best answer here would be C: "Later that day there was a call from one of the magazine editors; they had a couple of people phone in about my story, he said to say if there were any more calls?" The second best answer from the choices would be B: "Your story has kicked up quite a fuss around the office."

Explanation:

This is because these two options, but particularly C, shows the bad reaction that readers had towards Shirley Jackson´s "The Lottery", and which was explained by the author on her smaller "The Morning of June 28, 1948" and "The Lottery", which was published in 1983 by Ann Charters. The reaction, to say the least, was even aggressive and this is what Mrs. Jackson relates in the smaller story. The situation got so bad, that the author almost wished that she had never published the story, and the fact only changed a few years after, when the story was taken up by others and transformed for television, plays, and other arts.

I ________ hearing about the heros on last night's news. A. recall B. regular C. reduce D. responsible

Answers

The answer is A Hope you know this answer

What does Orwell accomplish by including the phrase (I'm not exaggerating in paragraph 3?

A He adds humor to support his earlier descriptions of "Travelling" as a joke

B He introduces a new claim about coal-mining through his exaggeration and irony

C He addresses the possible counterargument that he is overemphasizing the difficulty of "Travelling"

D He provides supporting evidence for the idea that he is not suited for coal-mining

Answers

i believe option "D"

The Fall of the House of Usher By Edgar Allan Poe
Shaking off what must have been a dream, I scanned more narrowly the real aspect of the building. Its principal feature seemed to be that of an excessive antiquity. The discoloration of ages had been great. Minute fungi overspread the whole exterior, hanging in a fine tangled web-work from the eaves. Yet all this was apart from any extraordinary dilapidation. No portion of the masonry had fallen; and there appeared to be a wild inconsistency between its still perfect adaptation of parts, and the crumbling condition of the individual stones. In this there was much that reminded me of the specious totality of old wood-work which has rotted for long years in some neglected vault, with no disturbance from the breath of the external air. Beyond this indication of extensive decay, however, the fabric gave little token of instability. Perhaps the eye of a scrutinizing observer might have discovered a barely perceptible fissure, which, extending from the roof of the building in front, made its way down the wall in a zigzag direction, until it became lost in the sullen waters of the tarn.
Roderick Usher's poem By Edgar Allan Poe
I. In the greenest of our valleys, By good angels tenanted, Once a fair and stately palace— Radiant palace—reared its head. In the monarch Thought's dominion— It stood there! Never seraph spread a pinion Over fabric half so fair.
II. Banners yellow, glorious, golden, On its roof did float and flow; (This—all this—was in the olden Time long ago); And every gentle air that dallied, In that sweet day, Along the ramparts plumed and pallid, A winged odor went away.
III. ... And, round about his home, the glory That blushed and bloomed Is but a dim-remembered story Of the old time entombed.
IV. And travellers now within that valley, Through the red-litten windows see Vast forms that move fantastically To a discordant melody; While, like a rapid ghastly river, Through the pale door, A hideous throng rush out forever, And laugh—but smile no more.
What is a key difference between these pieces of literature?
A One describes a house while the other describes a palace.
B One describes a person, while the other describes an army.
C One describes the valley, while the other describes a palace.
D One describes the summer, while the other describes the winter.

Answers

A One describes a house while the other describes a palace. 

Both pieces describe buildings that do not exist in their prime. The house in the first passage is old and falling apart, while people who walk by the palace described in the second passage talk of seeing ghosts and other spooky things where the palace was once golden and beautiful. 

In the Devil and Tom Walker (p. 349). Where does Old Scratch mark the names of the people he makes deals with?

Answers

The devil, who is later referred to as Old Scratch carves the names of the people he makes deals with into the trees. Those whose names are carved into the tress, having made a deal with old scratch, are those who have sold their souls to the devil.
In the Devil and Tom Walker, the place in where  Old Scratch marked the names of the people he makes deals with are on the trees. This is a short story by Washington Irving. This first appeared in his 1824 collection Tales of a Traveller and it also became  a part of the "Money-Diggers" section.
Other Questions
A ladder leans against a building. The angle of elevation of the ladder is 70. The top of the ladder is 25 ft from the ground. To the nearest tenth of a foot, how far from the building is the base of the ladder?20.5 ft30.5 ft32.3 ft39.5 ft Three positions of praying mentioned in the Old Testament are:kneeling and sittingkneeling, standing, and falling face downstanding and sittingkneeling, sitting, and lying on one's side Andrew drove 55 mph on his trip. Which of the following equations best represents the distance he drove if x stands for the number of hours? Two people start walking at the same time in the same direction. One person walks at 8 mph and the other person walks at 2 mph. In how many hours will they be 4.5 miles apart? Rowland and molina's work showed that ultraviolet light in the stratosphere causes cfcs to release ________ atoms. Why is this cover letter inappropriate? Genetic disorders caused by multiple genes interacting with the environment are called Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? view available hint(s) where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? it would not bind the target dna. ttttagccatttacgattaatcg ttttagccatttacgattaatcg ttttagccatttacgattaatcg? Find the product.y 4 y 6 Identify a management practice most conducive to the traditional personality. Use the net to find the approximate surface area of the cylinder to the nearest square meter Harry is a healthy man who is 30 years of age. using this information, calculate his approximate target heart rate zone for moderate-intensity physical activity. Speciation may occur when two populations become reproductively isolated from each other Polands energy resources can be described as _____. a. based on large deposits of coal b. rich in petroleum c. large deposits of sulfur d. large deposits of copper If a circle has a radius of 18 feet what's the closest approximation for circumference Has complete control of the laws rules and affairs of a country Plz jphelp me answer this year 7 question and explain how u got the answer. If the most industrialized countries all signed a climate-change treaty with the goal of keeping the sea at its current level, which would be a free rider benefiting from a positive externality of the treaty America wanted to end japan's aggression by placing a(n) _______ to cut off the oil and scrap metal supply. Eva is jumping on a trampoline. Her height h at time t can be modeled by the equation h=-16t^2+20t+6. Would Eva reach a height of 14 feet?