How did fidel castro became involved in revolutionary activities?

Answers

Answer 1
In 1945, Castro began the study of law in Cuba's capital, Havana. While at law school, he became involved in revolutionary activities.
After graduating from law school, Castro joined a reformist political party and ran for a seat in the Cuban House of Representatives. However, just before the elections, an army general named Fulgencio Batista overthrew the government and grabbed power for himself.
Answer 2

Son of a wealthy farmer, Castro adopted left-wing anti-imperialist policy while studying law at the University of Havana. After participating in rebellions against right-wing governments in the Dominican Republic and Colombia, he planned the overthrow of Cuban President Fulgencio Batista, launching a failed attack on the Moncada Barracks in 1953. After a year in prison, he traveled to Mexico where he formed a revolutionary group, the 26th of July Movement, with his brother Raúl Castro and Che Guevara. Returning to Cuba, Castro assumed a fundamental role in the Cuban Revolution, leading the movement in a guerrilla against the forces of Batista in the Sierra Maestra. After Batista's defeat in 1959, Castro assumed military and political power as Cuba's prime minister.


Related Questions

In 1981, reagan approved a cia plan to arm the contras, which opposed the sandinista government of __________.

Answers

The correct answer is Nicaragua .

This plan to overthrow the Contras was part of Reagan's foreign policy. Ultimately, Reagan was fighting the spread of communism on a global scale, trying to get rid of this system of government/economics wherever possible. However, this incident is remembered in a negative light, as he broke laws in order to help the Contras.

the ___ is a body of civil law that still used in some places in europe

Answers

The Roman law or civilian law is used in some places in Europe to this day

What three states rose in central europe in the seventeenth and eighteenth centuries?

Answers

The correct answer is Austria, Prussia, and Russia

They had strong central authority and modernized rapidly which made them a superpower in the political sense in Europe. Their power lasted for a long time after which it started falling down near the end of the 19th century. In the beginning of the 20th century, they participated in world war 1 because of this as they wanted to stay on top.

What are the "public journals" and why did lee mention them in his August 8th letter?

Answers

The public journals are the newspaper reports in which Lee's ability to lead was questioned after his defeat in Gettysburg. He mentioned them because he himself had felt a loss of confidence in his ability to lead.

The Public journals of General Robert E Lee are a series of letters wrote by him throughout his time in the United States Army until his secession and eventual confirmation of the Confederate Army. This collection of journals continued growing in size until his letter of resignation which he addressed to Confederate President Jefferson Davis on August 8th, 1863.

These countries have a border along the Persian Gulf

Answers

There are many countries with borders touching the Persian Gulf. If taken in a clockwise direction, these countries are from the north: Iran, United Arab Emirates,Saudi Arabia, Qatar on a peninsula off the Saudi coast; Bahrain on an island; and Kuwait and Iraq in the northwest.

Hope this helps!

Abolitionist Republican leaders were known as ___.
Radicals
Recluses
Racists
Rebels
Rascals

Answers

They were known as Radicals.

radicals is the right one


The prime minister and the members of parliament are elceted for a period of three years true or false

Answers

Flase. For the prime minister they are elected every 4 years. If the same party is still in power, normally the prime minister would serve longer too. 

Hope I helped a bit!

what was a reason that northern leaders disagreed over the south rejoining the union

Answers

Final answer:

Northern leaders disagreed over the South rejoining the Union due to the issue of slavery and the fear of northern aggression towards the South.

Explanation:

During the time of the Civil War and Reconstruction, there were several reasons why northern leaders disagreed over the South rejoining the Union. One reason was the issue of slavery. Northern Republicans rejected compromise proposals that allowed slavery to continue, as it contradicted their goal of abolishing slavery in the territories. Another reason was the fear among southerners that the North would attack the institution of slavery and infringe on the rights of the South. These disagreements between northern and southern leaders led to ongoing conflicts and tensions during this time.

Learn more about Reasons for northern disagreement over the South rejoining the Union here:

https://brainly.com/question/34786109

#SPJ12

Which was true of labor unions during the harding administration?

Answers

The correct answer is Unions were weakened by a strong economy

Harding was against unionizing and fought political wars against them because he believed that unions ruin economy because workers change the way that businesses are run through their activism. Since the economy was strong and stable, he didn't want the workers to change this so he implemented several laws and acts that weakened unions.

What event prompted the Persian Gulf War?
A) Iraq invaded KUWAIT
B) Saddam Hussein came to power in Iraq
C) the 9/11 attacks
d) Osama bin Laden founded the terrorist network al-Qaeda

Answers

What event prompted the Persian Gulf War?
The correct answer is:
A) Iraq invaded KUWAIT

The Iraqi invasion of Kuwait in 1990 prompted the Gulf War, but this event was made possible by the end of the Cold War in 1989. The basis for the Iraqi annexation of Kuwait goes back to the end of World War 1, when Kuwait was not included as a part of Iraq.

How did the creation of military plans help draw the nations of europe into world war i? in your opinion, what should today's national and military leaders have learned from the military plans that helped initiate world war i? explain your answer?

Answers

The military plans laid before World War I presupposed a major war between the countries which were tied together with alliances.  Because the Triple Entente had Britain, France and Russia as allies, Germany thought if a war began it would need to fight on two fronts -- west and east.  So German Field Marshall Alfred von Schlieffen drew up war plans that said attack France first, quickly, and then hold that territory while deploying forces to contend with Russia in the east.   So when Germany declared war on Russia in 1914, the first thing it did was to go and attack France.  Thus the war spread and became instantly a more global conflict.

National leaders in politics and the military need to learn caution when dealing with alliances and when committing themselves to military action. Restrained, limited military actions are preferable to the all-out plunging into war that was seen in the outbreak of World War I.   Diplomacy should be given its best chance to work before resorting to military options -- even if military options have been pre-planned. 

What is a major benefit of globalization?

Answers

Increased free trade a communication.

With globalization of cultures and goods, more so goods, trade would obviously ensue. With trade opening up to more foreign countries, communications between countries would be forced to increase. With that, this would lead to peace between nations and their trade partners.

Hope this helps!


Some Legal Rights of a Juvenile
Right to a lawyer
Right to provide witnesses and evidence
Right to remain silent
Right to appeal

What can you conclude about the information given here?
A) Juveniles have far fewer rights than adults.
B) Adults have far fewer rights than juveniles.
C) Juveniles and adults have some of the same legal rights.
D) The legal system is meant to keep juveniles from a fair trial.

Answers

C) Juveniles and adults have some of the same legal rights

You can tell from this abbreviated list that juveniles and adults have some of the same legal rights. Because of age, not all of these rights are the same, however.

a key issue in forming states in the west in the 1800s was __________

Answers

The Rocky mountains were kind of in the way.

what did the farmers in shays rebellion want

Answers

Hello there!

The farmers wanted the government to issue new money and make new policies to relieve debtors.


I hope this helps! As always, it is my pleasure to help students like you!

In order to rejoin the union in 1861,48 countries organized themselves as a separate state called

Answers

When the 48 countries organized themselves as a separate state called they were called West Virginia 

What insult motivates odysseus to prove his athleticism to the phaeacians?

Answers

Broadsea insults Odysseus by claiming he has no athletic training or skill

Which of the following statements best describes the civil rights movement led by Martin Luther King Jr.?
A. A protest movement involving peaceful civil disobedience
B. A violent radical protest movement
C. A protest movement that broke no laws
D. A lobby group that used its influence and money to sway lawmakers

Answers

The answer is A. I was kinda leaning towards C, but A sounds much better.

The best description about the civil rights movement led by Martin Luther King Jr. is it was a protest movement involving peaceful civil disobedience.  Hence, Option A is correct.

What is a protest?

An objection, criticism, or dissent toward a concept or action, usually one that is political, can be expressed strongly through a protest. Many people cooperate by attending protests, sharing the associated costs and risks, and these protests can be seen as cooperative activities.

For instance, a protest occurs when a number of individuals come together in a public place to voice their disagreement with a government decision. Some of the types of protest are Sit-In Protests, Marches & Rallies, Posters & Banners, Hunger Strike, Flag Burning, and many more.

Thus, Option A is correct.

Learn more about the protest here: https://brainly.com/question/13667698

#SPJ2

The first known terrorist attack that showed evidence of a link to bin Laden and his associates was a 1992 explosion in a hotel in Aden, Yemen. True or false

Answers

false ......
.....................
......

Answer:

It is TRUE!!!!!

Explanation:

WHY? WELL BECAUSE I JUST ANSWERED IT AND GOT IT CORRECT!

Which of the following are examples of Axis aggression that led to World War II? Select all that apply.


the Nazi-Soviet pact


Mussolini invades Ethiopia


Hitler signs the Munich Agreement


Franco starts the Spanish civil war


Japan takes control of Nanking
CHOOSE ALL THAT APPLY, PLEASE.

Answers

Japan invades the northeastern part of China, China goes to the League of Nations, League of Nations condemns Japan

Mussolini invades Ethiopia

The correct options are: " Japan takes control of Nanking - Mussolini invades Ethiopia"

• Mussolini invades Ethiopia: The Italian Invasion of Ethiopia, also called the Second Italo-Ethiopian War, was a seven-month armed conflict between October 1935 and May 1936. It is seen as an example of the expansionist policy that characterized the Powers of the Axis and the inefficiency of the League of Nations before the outbreak of the Second World War.

• Japan takes control of Nanking: it was a military conflict between the Republic of China and the Empire of Japan that was fought between July 7, 1937 and September 9, 1945, in the framework of the Second World War. It began when the Japanese army, which already controlled Manchuria (see Manchukuo), initiated the invasion of northern and eastern China. China fought with the economic support of the Soviet Union and the United States against Japan whose economic support came from Nazi Germany.

This time period saw the dismantling of old systems of powerful nation-states exercising direct political and military control over other peoples. which events are examples of the dismantling of these older systems?

Answers

Guinea-Bissau, Angola, and Mozambique gained independence from Portugal.The Soviet Union and the Soviet Bloc broke apart.

in what portion of the country were most of the areas of rebellions located

Answers

Final answer:

Rebellions often arose in areas where there was significant economic discontent or political marginalization, including the northeast of the United States among farmers, the antebellum South during major slave uprisings, and internationally in colonial resistances and modern conflicts like Libya and Syria.

Explanation:

Rebellions and areas of resistance were predominantly located in regions of various countries where there was significant political exploitation or economic discontent. In the context of the United States, unrest from exploited farmer communities typically occurred in the Northeast, following economic hardships and political marginalization. Other areas of significant rebellion activities throughout history include the southern parts of the US, where major slave uprisings like the German Coast Uprising and Nat Turner's Rebellion took place, signaling the widespread discontent and the quest for freedom amongst enslaved populations. Internationally, the resistance against colonial powers led to rebellions in places like Egypt, where locals refused European control, and Ethiopia fought against Italy. Within the current global framework, countries like Libya and Syria have faced armed conflicts between the government and rebels desiring significant political change.

During the early history of the United States, most of the areas of rebellions were located primarily in the Northeastern and Southern portions of the country.

These areas experienced various forms of unrest and resistance against local and federal authorities during the formative years of the United States, highlighting regional differences and socio-economic tensions that shaped early American history.

In the Northeastern, rebellions such as Shays' Rebellion (1786-1787) occurred in states like Massachusetts, reflecting discontent among farmers and rural communities over economic hardships and perceived injustices.

In the Southern, the region saw uprisings and rebellions primarily related to issues such as taxation, economic policies, and social inequalities, often centered around agrarian economies dependent on crops like tobacco and cotton.

The complete question is

In what portion of the country were most of the areas of rebellions located during the early history of the United States?

The majority of the japanese-americans who were interned during the war were not actually citizens of the united states.

Answers

That statement is FALSE.

Two-thirds of the Japanese-Americans who were confined to internment camps were natural-born citizens of the USA.  There were around 70,000 of these persons who were citizens of the US, born in the US, who were included along with those who were first-generation Japanese immigrants to the country.  It didn't matter who you were or what your profession.  If you were of Japanese ancestry, you were considered suspect.

How did persia india and greece influence islam how did islam influence those societies?

Answers

Islam is not hellenistic

Heloo, No one influced any religion first thing to start with. Second in islam and othe rreligions we have missionaries were there is a group which is sent to different places to call people to islam or whatever religion in arabic its called " Jamat " .

Lincoln won the 1860 presidential election primarily because

Answers

Lincoln won the 1860 presidential election primarily because he gathered overwhelming support in the highly populated Northern states while his three opponents divided the anti-Lincoln vote in the North, West, and South.

A method in which voters can directly vote for their party's candidates introduced by robert la follette. previously, republicans and democrats nominated candidates in conventions ruled by party bosses. this new method was common by 1915. however, party bosses still maintained power by confusing voters and splitting the anti-machine vote. also, southern states used this system as a way to keep blacks from voting

Answers

The answer is"Primaries".
  Hope I helped.

How did the climate influence the economies of the southern colonies?

Answers

the southern colonies were better suited to the production of cotton, tobacco and other field goods. this lead to the continuation of slavery and the use of slave labor in these states; it also complicated efforts to quell slavery because the entire economy was based on the practice

Answer:

The humid climate was well suited for farming cash crops like cotton and tobacco which encouraged the plantation system.

Explanation:

Southern colonies experienced a humid climate that influenced the type of crops they grew. Crops like tobacco, rice, cotton, and indigo all grew better in the south because of the warm weather. The international demand for these crops encouraged farmers to concentrate their fields on growing these cash crops. One particular example of the farmer's focus was the establishment of the plantation system where farms consisted of many acres of farmland dedicated to one crop.

A classic example of public fear reaction is the ____________ radio broadcast in 1938. this occurred because some people believed they were in actual danger. a day the earth stood still b alien invasion c world war ii d war of the worlds

Answers

tbh do some research. www doesnt start at a certain time. it was an alien invasion i think but look it up im sure wikipedia can give u a direct answer

what is black power?

Answers

It is a movement in support of rights and political power for black people, especially prominent in the US in the 1960's and 1970's.

Describe the events that led to the collapse of communism in Europe and the Soviet Union.
Type your response here in paragraph form (at least 7 sentences):

Answers

The fall of communism can be contributed to several different factors. Two of the most important factors are the policies of glasnost and perestroika implemented when Mikhail Gorbachev took office. Glasnost was an idea that allowed for more individual freedom of expression and more rights to media outlets. This allowed them to speak up/out against the government of the Soviet Union. Along with this, the policy of perestroika resulted in citizens of the Soviet Union having greater economic freedom. This meant they could make decisions on how they spent their money/resources rather than the government telling them how to use their money.

Lastly, the call for independence and freedom from Soviet satellite nations like East Germany, also lead to the fall of communism in Europe.

Answer:The fall of communism can be contributed to several different factors. Two of the most important factors are the policies of glasnost and perestroika implemented when Mikhail Gorbachev took office. Glasnost was an idea that allowed for more individual freedom of expression and more rights to media outlets. This allowed them to speak up/out against the government of the Soviet Union. Along with this, the policy of perestroika resulted in citizens of the Soviet Union having greater economic freedom. This meant they could make decisions on how they spent their money/resources rather than the government telling them how to use their money.

Explanation:

Other Questions
How is augmented reality used A) to integrate 3-D graphics for providing a live, direct, or indirect view of a physical real-world environmentB) to gather and analyze digital data using special software toolsC) to provide up-to-the-minute information for decision-making processesD) to monitor employee movement during working hours Compare and Contrast topics and themes of writers from Americas and Europeans Predict where the Katydid would hide from danger? Draw a picture of what you predict, help please The Silk Road was discovered by __________. A. Marco Polo B. Genghis Khan C. General Zhang Qian D. Kublai Khan Calcium carbonate reacts with hydrobromic acid to form calcium bromide, carbon dioxide, and water according to the reaction below. what is the molarity of the hydrobromic acid if 250.0 ml of it reacts with 5.64 grams of calcium carbonate? Explain why the equation (x-4)^2-10=15 has two solutions. Then solve the equation to find the solutions. Please show all your work! (30 points) A standard number cube with the numbers 1 through 6 is rolled. Find the probability of rolling a number greater than 5 .1. 1 / 62. 1 / 33. 1 / 44. 2 / 3 If a = 0.3 with a line over 3 and b = 0.5 with a line over 5, what is the value of a + b?8/108/988/10080/99 75 points Write and solve an equation to find the measure of NEP. Make sure you show all work. A ladder leans against a building. The angle of elevation of the ladder is 70. The top of the ladder is 25 ft from the ground. To the nearest tenth of a foot, how far from the building is the base of the ladder?20.5 ft30.5 ft32.3 ft39.5 ft Three positions of praying mentioned in the Old Testament are:kneeling and sittingkneeling, standing, and falling face downstanding and sittingkneeling, sitting, and lying on one's side Andrew drove 55 mph on his trip. Which of the following equations best represents the distance he drove if x stands for the number of hours? Two people start walking at the same time in the same direction. One person walks at 8 mph and the other person walks at 2 mph. In how many hours will they be 4.5 miles apart? Rowland and molina's work showed that ultraviolet light in the stratosphere causes cfcs to release ________ atoms. Why is this cover letter inappropriate? Genetic disorders caused by multiple genes interacting with the environment are called Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? view available hint(s) where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? it would not bind the target dna. ttttagccatttacgattaatcg ttttagccatttacgattaatcg ttttagccatttacgattaatcg? Find the product.y 4 y 6 Identify a management practice most conducive to the traditional personality. Use the net to find the approximate surface area of the cylinder to the nearest square meter