Identify a personal aspect that influences communication.'

Answers

Answer 1
Nurture - the environment where you were born and raised has a great effect on how you communicate with others. For example, Asian culture in general, perceives hierarchy as vital in society. This is why Asians are generally indirect in their speech, hardly contradicts and very respectful to elders and people higher than them in society (parents, teachers, bosses).

Related Questions

Which muslim group is predominant in iraq and iran?

Answers

The Muslim group that is predominant is Shi'ia. Shias follow to the lessons of Muhammad and the religious leaders of his or his descendants known as Shia Imams.  There are also huge Shia people in Afghanistan, India, Kuwait, Lebanon, Pakistan, Qatar, Syria, Turkey, Saudi Arabia and the UAE. 

The neurotransmitter _____ is abundant during a manic state and scarce in a depressive state.

Answers

The correct answer is dopamine. High levels of dopamine can cause mania in an individual but depression when levels are low.

Final answer:

The neurotransmitter abundant in a manic state and scarce in a depressive state is dopamine (DA), which is associated with mood regulation and implicated in mood disorders like depression and bipolar disorder.

Explanation:

The neurotransmitter that is abundant during a manic state and scarce in a depressive state is dopamine (DA). This neurotransmitter plays a critical role in mood regulation and is implicated in conditions such as depression and bipolar disorder. In bipolar disorder, the cycling between mania and depression can be associated with fluctuating levels of dopamine, with higher levels contributing to mania and lower levels relating to depression. In the realm of depression, scientists believe that low levels of serotonin, another neurotransmitter, are one cause of depression. Antidepressants work by normalizing serotonin levels, aiding in relieving symptoms of depression. It is also important to note that noradrenaline, also known as norepinephrine, is another neurotransmitter associated with mood regulation and is targeted by some antidepressant medications.

Julius is african american and mike is white; both are basketball players for high-school teams. they both score same number of baskets and have similar records of assists, rebounds, and free throws. according to information from your text, who would be viewed as having more athletic ability and as having played a better game overall?
a. mike
b. julius
c. it depends on the ethnicity of the person you ask.
d. they would be viewed equally.

Answers

The answer is "b. Julius".

Black athletes are typically given kudos for their "regular physicality," while whites are credited for their "diligent work," "train" and "learning of the amusement"; as though Black competitors are normally given the endowment of awesome physicality, and white individuals end up incredible competitors through diligent work, teach and knowledge. Each Black competitor who is effective has worked hard and is learned of their game. Each white competitor who is fruitful has regular athletic capacity. 

Most social welfare programs are intrinsically __________ in nature. distributive regulatory redistributive no answer text provided.

Answers

Most social welfare programs are intrinsically distributive in nature. Indeed, welfare means social support for the citizens. It is mainly provided by the government from tax revenues, which is then distributed. 

You have an insurance policy with a $300 premium and a $500 deductible. How much should you expect to pay the insurance company each month for coverage?

Answers

about $800 to $1,000

The ability to keep information or events in one's memory until it is time to retrieve them is known as __________.

Answers

The ability to keep information or events in one's memory until it is time to retrieve them is known as retention. The ability to remember information or events is known as retention. Focused attention can be demonstrated by reading a book while eating a snack.

How long does working memory last?

Working memory contains only temporary information. It either decays or is replaced, or it is encoded into long-term memory. Working memory information has a short duration of around 10-15 seconds unless it is actively attended to or rehearsed.

Retention of learned information is defined as storing the information in long-term memory in such a way that it can be retrieved quickly, for example, in response to standard prompts. The process by which a company ensures that its employees do not quit their jobs is known as retention. Every company and industry has a different retention rate, which indicates the percentage of employees who stayed with the company over a specific time period.

Learn more about memory here:

https://brainly.com/question/28754403

#SPJ3

Your classmate, whose part-time job entails reorganizing the paleoanthropology lab on campus, asks you to take a look at a skeleton that she thinks is that of a primate. after noting the absence of a postorbital bar, nails, and an opposable thumb, you tell her that

Answers

You tell her that "she should label this skeleton as a plesiadapiform rather than as a primate."

Plesiadapiforms were in all probability not primates, as prove by their distinctive skeletal life structures, for example, the absence of level nails, opposable digits, and a postorbital bar in the skull.

________ was an historical epoch during which victims had well-recognized rights, including a personal say in imposing punishments on apprehended offenders.

Answers

The answer is "Golden Age of Victim".

A victim is any individual against whom an offense has been conferred. For certain procedural purposes, a parent or lawful gatekeeper is thought to be the casualty if the actual victim is underneath the age of eighteen years or is uncouth. A victim may likewise be at least one relatives or relatives assigned by the court if the genuine casualty is expired or crippled. 
During the “Golden Age of the Victim,” which bloomed a couple of hundred years back in England, casualties had very much perceived rights, incorporating an individual say in forcing disciplines on caught guilty parties. 

A marine scientist has performed an experiment and concluded that the phytoplankton population of an area has decreased due to a recent oil spill. Could another scientist come up with an alternative explanation?

No, unless they changed the original results.

\No, doing a similar test in a different area would yield the same results.

Yes, by repeating the first researchers work and analyzing the data

. Yes, by using a different organism in another study.

Answers

I think the third option is right.
Final answer:

Yes, another scientist might point out alternative factors that could have caused the decrease in the phytoplankton population, such as changes in water temperature, nutrient availability, sunlight, pollution, or invasive species.

Explanation:

Yes, another scientist could potentially come up with an alternative explanation for the decrease in the phytoplankton population. Science is based on investigation and interpretation, and different scientists may have different interpretations of the same data. For instance, another scientist could argue that factors other than the oil spill could have caused the decrease in the phytoplankton population. The newly considered factors might involve changes in water temperature, nutrient availability, or sunlight, which are critical for phytoplankton growth. Alternatively, ambient pollution or invasive species, not accounted for in the original research, could also have an impact on the phytoplankton population. Therefore, it is essential in science to corroborate findings and consider alternative explanations before making decisive conclusions.

Learn more about Scientific Interpretation here:

https://brainly.com/question/32338583

#SPJ2

Research study 10.1 dr. lonsbary is a cognitive psychologist who is curious about how mood affects memory. she recruited 60 high school students and divided them into three groups. group a listened to a five-minute piece of music intended to make them feel happy (a song titled "don't worry, be happy"). group b listened to a five-minute piece of music intended to make them feel sad (a song titled "alone again"). group c listened to no music and instead was asked to sit quietly for five minutes (thought to make them feel neutral). when a participant would come to her laboratory, dr. lonsbary would greet the participant and then ask him or her to draw a card. participants who drew a 1, 2, or 3 were assigned to group

a. participants who drew a 4, 5, or 6, were assigned to group

b. participants who drew a 7, 8, or 9, were assigned to group

c. the participants were then given an unlabeled cd to listen to based on their group assignment. the cd contained either the song sele

Answers

Final answer:

Background music's impact on memory is complex, with some studies indicating a positive effect on memory recall linked to mood and arousal levels, while others find no significant benefit. The effect of music varies depending on the type, presence of lyrics, and the specific memory or cognitive task being performed.

Explanation:

The question pertains to the influence of music on memory functions, a subject of interest within cognitive psychology. Several studies have been conducted to assess how background music affects memory and cognitive performance. One of the core hypotheses is that music modulates mood and arousal levels, which in turn may optimize memory performance. Another hypothesis suggests that the background music creates a context that aids memory recall. Studies involving a range of participants from children to the elderly, with or without musical training, have examined the effects of diverse musical elements such as tempo, lyrics, and emotional valence of the music on tasks requiring memory and attention.

While some research indicates that music can affect memory performance by enhancing mood and arousal, leading to improved recall of studied materials, other studies have found no significant enhancement of working memory due to music listening. The impact of background music appears to be complex and varied, with certain types of music potentially being more conducive to cognitive tasks than others.

For example, Carr and Rickard (2016) found that self-selected music led to better memory of images compared to listening to a radio interview. Such findings are contrasted by others, including Nguyen and Grahn (2017), who showed that while mood and arousal did affect recall and recognition memory, overall background music did not enhance verbal memory performance. The presence of lyrics has also been shown to have differing effects based on the task at hand and the age of participants. In the context of children, music without distracting lyrics was found to be beneficial for cognitive performance by Koolidge and Holmes (2018).

Ultimately, the relationship between music and memory continues to be an intriguing field of research that raises important questions about the cognitive effects of musical stimuli.

Dr. Lonsbary's research is about the impact of mood on memory, and various studies have looked into how background music and mood affect cognitive functions, including memory and attention, with mixed results.

Explanation:

The research question posed by Dr. Lonsbary encompasses a psychological study focused on the impact of mood on memory. Various studies have aimed to understand how music affects cognitive functions such as memory and attention. Studies like Lake and Goldstein (2011), Carr and Rickard (2016), and Thompson et al. (2001) have explored the relationship between mood, induced by music or silence, and memory performance across different age groups. While some research found that background music with certain characteristics can affect memory and cognitive task performance positively or negatively, other studies did not find significant impacts of music on memory performance.

For instance, Nguyen and Grahn (2017) showed that mood and arousal affected recall and recognition memory, but background music did not significantly enhance memory performance overall. Similarly, studies by Steele and colleagues (1997, 1999) and Koolidge and Holmes (2018), among others, have analyzed the effects of mood and arousal on different cognitive tasks, with mixed results regarding the ability of music to enhance memory and cognitive function. These studies help to better understand the complex interactions between auditory stimuli, emotional states, and cognitive abilities.

George gershwin usually collaborated with the lyricist ______.

Answers

Final answer:

George Gershwin collaborated with his older brother, lyricist Ira Gershwin, to create many popular musical pieces.

Explanation:

Composer George Gershwin typically collaborated with his older brother, lyricist Ira Gershwin. This artistic duo was well-known in the music industry, often lauded for their harmonious blend of musical composition and poetic lyrics. They worked together to create many popular pieces, such as 'Rhapsody in Blue' and 'An American in Paris'. Their collaboration significantly impacted the field of American music, especially the genre of musical theater.

Learn more about George Gershwin here:

https://brainly.com/question/30164102

#SPJ6

What does the metaphor in lines 3-4 help the reader understand

Answers

It means that he is waiting for and dreaming for something he wants and needs. And it finally does appear. Everything comes at its own time.

I hoped this helped!

Many young adults also adopt what levinson calls _____, that is the drive to become someone, to leave one's mark on history—which serves as a tentative blueprint for life.​

Answers

The answer is "the dream".

Maybe the greatest contrast amongst people, and between gatherings of ladies, concerns what Dr. Levinson called ''The Dream.'' Between ages 22 and 28, a young fellow designs a speculative life structure. He shapes a fantasy: his vision of himself on the planet, his objectives and desires. The dreams are for the most part identified with occupation, said Dr. Levinson. He'll be a boxer, a supervisor or a football star - the legend of his own story. Ladies have more prominent trouble shaping the dream, he said.

The Dream is the correct answer

The origins of rapping can be traced back to a style of talking or chanting over a rhythm or beat. what was this style called? where did it originate? when did it first emerge?

Answers

This style is known as toasting. it is believed to have originated from the ancient African war songs and dance. It further evolved in Jamaica through African ancestry who modernized it. Toasting style was an idea conceived way back in the 1950s by deejay Machucki, but it became more popularised in the 1960s and 1970s in Jamaica.

Ther origins of rapping can be traced to what was called toasting at the time.

Where did rapping originate?

The history of rapping can be traced to the blacks of Jamaica. This style of music is done in a fast way.

Rapping usually involves some sort of rhythm that is done in a fast poetic manner.

Read  more on rapping here:

https://brainly.com/question/27039735

#SPJ5

To say that modern society has a "mass scale" means that many fewer people ________
a. live in small communities.
b. have a strong sense of cultural heritage.
c. are very sure about what is right and wrong.
d. all of these responses are correct.

Answers

I believe the answer is: live in small communities, have a strong sense of cultural heritage, are very sure about what is right and wrong

In  a mass scales society, the society would be filled with people with various principles and ethnicity, to the point where that society could no longer imposed a same tradition that must be followed by all people.
When this happen, more and more people would be drawn into invididualism and started to stay away from collective attitudes.

Employed mothers who value their parenting role have increased rates of marital discord and divorce. often prevent fathers from becoming fully involved in parenting. are more likely to use authoritative child rearing and coregulation. tend to experience stress and anxiety due to role overload.

Answers

If you're wondering if this is true or false, I think this is more of opinion, but I'd guess true? Sorry, I'm not completely sure what you're asking. :)
Final answer:

Working mothers who strongly engage with their parenting role often face stress and anxiety due to the challenge of balancing multiple roles. This can increase marital conflicts and divorce rate, and occasionally can prevent fathers from being fully involved in parenting. Meanwhile, these mothers often use authoritative child-rearing styles.

Explanation:

The statement provided appears to allude to various dynamics and potential challenges related to employment, motherhood, and parental roles. Mothers who work and highly value their parenting role may sometimes experience stress and anxiety owing to role overload. This is often due to the pressures and demands of balancing work and family responsibilities.

Such stressors could potentially lead to increased instances of marital discord and even divorce. On another note, the statement suggests that employed mothers often limit the engagement of fathers in parenting, although this is not always the case. Fostering shared parenting responsibilities can be a useful approach for mitigating such issues.

Also, the statement suggests that these mothers are likely to use authoritative child-rearing and coregulation techniques. These practices involve setting clear standards for children's behavior and adopting a balanced approach towards discipline, which includes open communication and mutual respect.

Learn more about Working Mothers here:

https://brainly.com/question/32397823

#SPJ2

You are at a football game with your friends, though you aren't a football fan. nonetheless, when "the wave" comes your way, you stand up and take part. afterward, you feel surprised that you did such a silly thing that you don't really even enjoy. a sociologist explains that you were influenced by the behavior of those close to you, which is called ________ theory.

Answers

The correct answer is the social contagion theory. 

The social contagion theory refers to a theory that explains crowd behavior. According to this theory, a crowd or group's behavior starts and "spreads" to individuals in the crowd, leading them to take part in the behavior or action. According to this theory, our behavior is influenced by those in close proximity to us. This explains why you might participate in the "wave" even though its something you would normally find silly. 

It swore every boy to stick to the band, and never tell any of the secrets; and if anybody done anything to any boy in the band, whichever boy was ordered to kill that person and his family must do it, and he mustn't eat and he mustn't sleep till he had killed them and hacked a cross in their breasts

Answers

every boy had to stick to the band, and never tell any of the secrets; and if anybody done anything to any boy in the band, whichever boy was ordered to kill that person and his family must do it, and he eat and he mustn't sleep

Is a constitutional grant of power that enables each of the three branches of government to check some acts of the others and therefore ensure that no branch can dominate?

Answers

Referendum or maybe it could be this onstitutional grant of powers that enables each of the three branches of government to check some acts of the others and therefore ensure that no branch can dominate. and then maybe Referendum 

What type of money system did the united states use and what was it based on?

Answers

The money system uses is based on a decimal system of vaules

The difference between a passport and a visa is that

Answers

Final answer:

A passport is an official government issued document verifying your identity and citizenship, universally required for international travel. A visa, on the other hand, is a document or stamp on your passport that allows you to enter and stay in a specific country for a certain period and purpose.

Explanation:

The difference between a passport and a visa lies in their purpose and role in international travel. A passport is an official government document that verifies your identity and citizenship. It is a universally accepted form of identification and is required for any international travel. On the other hand, a visa is a document or a stamp on your passport, letting you enter and stay in a specific country for a certain period of time and for specific purposes (e.g. tourism, business activities, studying, etc.). Not all countries require a visa for entry, but all require a passport.

Learn more about Passport vs Visa

https://brainly.com/question/9909121

#SPJ12

Most people in the united states who divorce ________
a. remain single.
b. have experienced family violence.
c. remarry within five years.
d. experience a rising standard of living.

Answers

I believe the answer is: C. remarry within five years

The data shown that the period that divorcees take to remain unmarried would get significantly shorter as they grow older in age.
Among divorcees that are 60 years old or older, they usually remarried between the period of 2 years, since they already reach later level of maturity.


a. True
b. False. reliability is synonymous with precision, whereas validity is synonymous with accuracy.

Answers

T/F Reliability is synonymous with precision, whereas validity is synonymous with accuracy. True.

The constitution specifies that members of the house must be at least __________ years old and american citizens for _________ years.

Answers

They must be 25 years old and be an American citizen for 7 years.

If congress passed a law today that made it illegal for a convicted felon to own or possess body armor regardless of how they came to own or possess it, the supreme court likely would:

Answers

I believe the answer is: find it constitutional under the Commerce Clause.

The commerce clause stated that the congress has the full power in regulating our country's relationship with another country regarding trade activities.
So, it should be fairly easy for congress to make law that determine the legality of various products

what is the minimum number of seismic stations needed to determine the location of an earthquakes epicenter?

Answers

Answer:

At least three seismic stations

Explanation:

To determine an earthquake epicenter requires coordination between at least three seismographs. This is because a seismograph is only capable of registering the strength and amplitude of an earthquake; that is to a say, a single seismograph can register the occurrence of an earthquake. This describes a circle with the seismograph at the center. A second seismograph, which can be hundreds or thousands of miles away, can generate a similar plot. The circles from these two stations cross each other at two points. Finally, the third station points to the epicenter as the only place where all three circles intersect.

Final answer:

A minimum of three seismic stations are required to triangulate and accurately determine the location of an earthquake's epicenter.

Explanation:

The minimum number of seismic stations needed to determine the location of an earthquake's epicenter is three. Each station records seismic waves and the time difference between the arrival of P waves and S waves. To locate an epicenter, seismologists use a method called triangulation. The principle is based on drawing three circles on a map, with each circle's center being a seismograph station, and the radii equal to the distance to the epicenter determined by the time difference of P and S wave arrivals. The point where all three circles intersect is the epicenter's location. This method is crucial in understanding Earth's geophysical properties and in making decisions related to safety, urban planning, and disaster management.

Countries that are experiencing rapid economic growth and democratization are generally known as ___________ countries.

Answers

Newly industrializing countries.

Countries experiencing rapid economic growth and democratization are known as emerging market economies. Examples include South Korea and China, among others, which have seen rapid growth due to factors like cheap labor and market reforms. Economic development often leads to an increased demand for political freedom and democratization.

Countries that are experiencing rapid economic growth and democratization are generally known as emerging market economies. Examples of such countries include Hong Kong, Singapore, South Korea, and Taiwan, which have achieved quick economic progress through cheap labor, high technology, and aggressive exports. Furthermore, nations like Thailand, Indonesia, and particularly China, have observed significant economic growth after instituting market-oriented economic reforms.

Many economists posit that with increased economic development, there is a rise in the demand for political freedom, leading to the establishment of democratic institutions. It's seen as a product of economic growth, not a cause of it. This means that as countries develop economically, they tend to move towards democracy because their citizens demand it as they become more affluent.

South Korea stands out as a prime example of a country that has experienced not only rapid but also sustained economic growth, transforming its economy from being primarily rural and agricultural to one based on services, manufacturing, and technology. Similar patterns of growth and economic transformation can be observed in other high-income economies, including the United States.

A group of researchers studying the effects of alcohol on the overall health of urban adults asked respondents whether they drank alcohol during the past month. in this instance, the researchers were collecting _____ data.

Answers

In this instance, the researchers were collecting "Prevalence data".


Prevalence is a term which implies being broad and it is particular from occurrence. Prevalence is an estimation of all people influenced by the infection at a specific time, while occurrence is an estimation of the quantity of new people who get a sickness amid a specific timeframe.

Final answer:

The researchers were collecting prevalence data. Prevalence data refers to information about the proportion of individuals in a population who have a particular characteristic or engage in a specific behavior at a given point in time.

Explanation:

In this case, the researchers were interested in determining the prevalence of alcohol consumption among urban adults over the past month. By asking respondents whether they drank alcohol during the past month, the researchers aimed to ascertain the percentage of urban adults who had consumed alcohol within that timeframe.

Prevalence data is valuable for understanding the frequency or extent of a particular phenomenon within a population. It provides insights into the prevalence rate, which is the proportion of individuals exhibiting the characteristic or behavior of interest within the population. For the researchers studying the effects of alcohol on the overall health of urban adults, prevalence data on alcohol consumption would serve as a foundational aspect of their research. It would help them assess the scope of alcohol use within the urban adult population and provide a basis for further analysis of its effects on health outcomes. Therefore, by collecting prevalence data on alcohol consumption, the researchers could better understand its prevalence and its potential impact on overall health among urban adults.

Evan is a tall, 12 year old boy. he has a scar on his right cheek. he is intelligent and an excellent drummer. which of his traits did he most likely inherit?

Answers

he inherited height from his tall parents

Eighty percent of people who are diagnosed with osteoporosis are women. what is the simple explanation for this phenomenon?

Answers

During menopause, ladies lose estrogen and this puts ladies at a more serious risk for the development of osteoporosis.

Osteoporosis is a bone condition that happens when the body loses too much bone, makes too minimal bone, or both. Thus, bones wind up frail and may part from a fall or, in extreme cases, from sniffling or minor knocks.

Other Questions
The U-Drive Rent-A-Truck company plans to spend $15 million on 310 new vehicles. Each commercial van will cost $35 comma 000 , each small truck $70 comma 000 , and each large truck$60 comma 000 . Past experience shows that they need twice as many vans as small trucks. How many of each type of vehicle can they buy? How is augmented reality used A) to integrate 3-D graphics for providing a live, direct, or indirect view of a physical real-world environmentB) to gather and analyze digital data using special software toolsC) to provide up-to-the-minute information for decision-making processesD) to monitor employee movement during working hours Compare and Contrast topics and themes of writers from Americas and Europeans Predict where the Katydid would hide from danger? Draw a picture of what you predict, help please The Silk Road was discovered by __________. A. Marco Polo B. Genghis Khan C. General Zhang Qian D. Kublai Khan Calcium carbonate reacts with hydrobromic acid to form calcium bromide, carbon dioxide, and water according to the reaction below. what is the molarity of the hydrobromic acid if 250.0 ml of it reacts with 5.64 grams of calcium carbonate? Explain why the equation (x-4)^2-10=15 has two solutions. Then solve the equation to find the solutions. Please show all your work! (30 points) A standard number cube with the numbers 1 through 6 is rolled. Find the probability of rolling a number greater than 5 .1. 1 / 62. 1 / 33. 1 / 44. 2 / 3 If a = 0.3 with a line over 3 and b = 0.5 with a line over 5, what is the value of a + b?8/108/988/10080/99 75 points Write and solve an equation to find the measure of NEP. Make sure you show all work. A ladder leans against a building. The angle of elevation of the ladder is 70. The top of the ladder is 25 ft from the ground. To the nearest tenth of a foot, how far from the building is the base of the ladder?20.5 ft30.5 ft32.3 ft39.5 ft Three positions of praying mentioned in the Old Testament are:kneeling and sittingkneeling, standing, and falling face downstanding and sittingkneeling, sitting, and lying on one's side Andrew drove 55 mph on his trip. Which of the following equations best represents the distance he drove if x stands for the number of hours? Two people start walking at the same time in the same direction. One person walks at 8 mph and the other person walks at 2 mph. In how many hours will they be 4.5 miles apart? Rowland and molina's work showed that ultraviolet light in the stratosphere causes cfcs to release ________ atoms. Why is this cover letter inappropriate? Genetic disorders caused by multiple genes interacting with the environment are called Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? view available hint(s) where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? it would not bind the target dna. ttttagccatttacgattaatcg ttttagccatttacgattaatcg ttttagccatttacgattaatcg? Find the product.y 4 y 6 Identify a management practice most conducive to the traditional personality.