in hopes pf. finding a route to asia

Answers

Answer 1
 Prince Henry teach the first school sailors about mapmaking, and oceanic navigation. He was able to sponsor fourteen expeditions within twelve years to cross over to Cape Bojador. Gil completed the journey, so than this became a way to find a maritime route to Asia

Related Questions

In an Economic Theory of democracy 1957, Anthony Downs describes _______voting as a puzzle because voting is not in one's self interest and in fact is irrational

Answers

Iksksjidhxjdkskdududjksis

How and why did mccarthy begin his communist “ witch hunts “?

Answers

He disagreed with with the communist viewpoint so he tried to find the communist to stop the spread of communism.

Joseph McCarthy initiated communist "witch hunts" or McCarthyism in the 1950s by falsely charging that Communists were taking over the U.S. government, using unfounded claims to fuel his re-election campaign.

Needing a winning issue for re-election in 1952, McCarthy sparked fear by announcing he had a list of Communists in the State Department allegations that were unsupported and constantly changing in number. His claims played into the anxiety of the era, fueled by the Cold War and the fear of Soviet espionage. Despite the serious accusations, McCarthy never substantiated his claims with concrete evidence. It was not until President Eisenhower intervened in 1954, declaring that members of the government did not have to testify before McCarthy's Senate committee, that his influence waned and the era known for its aggressive Red Scare tactics began to fade.

McCarthy's approach centered around sensationalism and the exploitation of fear for political gain. This type of rhetoric and tactics became synonymous with his name, defining McCarthyism as the practice of making unfounded accusations and using unfair investigative techniques to suppress opposition. The strategy not only overshadowed the politician's career but also had long-lasting implications on American politics and society.

Which set of excerpts from Chapter 5 of Wheels of Change would best be placed in the graphic organizer?

In 1895, Stanton contributed an article to the American Wheelman celebrating this "wonderful new style of locomotion." In the article . . . she pointed out that cycling was increasing people's mobility, eliminating the cost of feeding and housing horses, and encouraging the building of good roads.
Willard saw parallels between learning to ride and learning to live. "I began to feel that myself plus the bicycle equaled myself plus the world, upon whose spinning wheel we must all learn to ride," she wrote.
Magazines and some newspapers regularly published poetry and short stories at that time, and cycling was a popular theme. In 1893, poet Madeline S. Bridges celebrated the female cyclist's new freedom by contrasting her with the maidens of the past who used wheels to spin thread.
As the 1890s drew to a close, the cyclists who had cast off their corsets and taken to the open road were leading the way for American women to start embracing new freedoms and a larger place in public life. Ironically, the vehicle that had delivered them to the future had almost reached the end of the ro

Answers

In 1895, Stanton contributed an article to the American Wheelman celebrating this "wonderful new style of locomotion." In the article . . . she pointed out that cycling was increasing people's mobility, eliminating the cost of feeding and housing horses, and encouraging the building of good roads.

Which to Territories of the Ottoman Empire became British territories because of league nations mandates?
Syria
Mesopotamia
Lebanon
Palestine
Istanbul

Answers

lebanon and palestine

The territories that the Ottoman empire had that became British territories were:

Mesopotamia. Palestine.

After the British and her allies won WWI, they established the League of Nations which was to bring peace to the world.

The League then stripped the Ottoman Empire of several possessions in the Middle East and the British got some of these as mandates. These were Palestine and Iraq/ Mesopotamia.

Find out more on British Mandates at https://brainly.com/question/17380247.

what did Native Americans tribes have in common?
A. they lived in the same type house.
B. they got food the same way.
C. they inhabited the land before the settlers arrived.
D. they spoke the same language.

Answers

the answer to your question is c

Answer:

C. they inhabited the land before the settlers arrived.

Explanation:

The natives of the United States, also popularly known as Native American, are the Amerindian ethnic groups that live in the United States and speak Amerindian languages, characterized by their diversity, lifestyle and socioeconomic status. The culture of the different tribes of Indians residing in the territory of the United States is very varied. The natives were the inhabitants of the continent long before the arrival of Europeans and their traditions and ways of life have managed to maintain themselves over time. Cherokees, Sioux or Apaches are the best-known tribes, but there are dozens.

The Third Estate in France was made up of which of the following groups?
Here are the optionsmiddle class known as bourgeoisie nobility peasants clergy urban workers

Answers

Three groups made up the Third Estate: Bourgeoisie, Artisans, and Peasants.

Hope this helps. :)

The Nixon administration is credited with the following environmental achievements except

Answers

awarding offshore oil leases to selected companies

The main source of conflict in the Middle East between Israel and Palestine involves

Answers

The main source of conflict in the Middle East between Israel and the Palestinians involves

Religion

Why did reasons the U.S. shipping industry flourish in the late 1700s?

Answers

The reason the U.S. Shipping Industry flourished in the late 1700's is because to protect their ships, and it was less expensive to pay tribute than going to war.

Which is not a goal of the U.S. in Afghanistan?


Answers

The answer to this question is often
Strengthening its border with Pakistan.This is not a goal of the USA presence in Afghanistan. The USA presence in Afghanistan is informed by two goals which are the need to dismantle the Al Qaeda operation and spearhead reconstruction of Afghanistan as well as train the the Afghan forces.


Briefly describe one specific historical similarity between mass media in the 1920s and in the 1950s

Answers

Both dates occurred after two world wars, the 1920s preceded the World War 1 while the 1950s preceded World War 2.

The mass media similarity between these two is that it focused more on entertainment and advertisements. Because the war ceased already, films and entertainment shows flourished greatly. 

it had entertainment and fun

Question 2(Multiple Choice Worth 5 points)

Photograph of a settlement in Haiti. A building with a cross is seen at the top of a hill. People live in primitive tents at the bottom of the hill.
© 2012 The Associated Press

The town in this photograph is named Duvalierville. It was founded by the Haitian President Francois "Papa Doc" Duvalier. What does this image say about Duvalier's approach toward governing?

He wanted to modernize Haiti.
He focused on improving Haiti's infrastructure.
He did not focus on human welfare programs.
He did not approve of poorly planned projects.

Answers

The correct answer is "he did not focus on human welfare programs." Hope this helps!
(C)He did not focus on human welfare programs is the correct answer hope this helps you

How did Turkey change as a result of World War 1

Answers

-It went from controlling a powerful empire to forming an independent republic- Apex.

Back then in 1914 The Ottoman Empire entered the First World War due to the alliances with the Central Powers.

The end of WWI by 1919 meant the Turkish War of Independence which lasted from 1919 to 1923.  Furthermore, the French together with the British authorities had made a pact to share the Ottoman Empire domain by fostering revolts between the Ottoman Arabs and their Turkish government.

These two factors caused the disintegration of this vast empire and the formation of the Turkish Republic.

is the process of countries becoming more connected over time

Answers

The process that has seen countries around the world becoming connected overtime is Globalization.

What is Globalization?

Globalization refers to the process that explains how the world is becoming more connected.

This had led to increased trade between countries as well as increased political influence.

Find out more on globalization at https://brainly.com/question/1133228.

#SPJ2

Answer:

✔ Globalization is the process of countries becoming more connected over time.

Explanation:

Globalization

How did the Missouri compromise and the compromise of 1850 allow slavery to continue within the United States? Check all that apply

Answers

Slavery had come to America in 1619. It existed through the American Revolution, even after Thomas Jefferson penned his famous lines in the Declaration of Independence, "All men are created equal. They are endowed by their creator with certain unalienable rights. That among these are life, liberty, and the pursuit of happiness." Obviously, slaves were not part of this equation. When it came time to write the Constitution, the word "slavery" was never used. Instead, the framers chose to use the term "other people." These other people were counted as 3/5 of a person for the purposes of representation in Congress according to the 3/5 Compromise. This compromise kept slavery in the United States intact. The founders also decided not to do anything about the issue of slavery for twenty years. Someone else would have to deal with it.

In 1820 with the admission of Missouri to the Union, the issue of slavery came up again. There was already a great deal of tension between the North and the South. The South was highly agricultural. It wanted to keep slavery as a way of life on their plantations. The North, which was

Answer:

The Missouri Compromise allowed newly admitted states to be slave states, depending on their location.

The Compromise of 1850 allowed the citizens of Utah and New Mexico to vote on their state’s laws about slavery.

Explanation:

which organization president kennedy inspiried thousands of americans to share expierance knowledge with the less fortunate nations

Answers

peace corp act 1961, is a group of people that goes to different countries when men ,women and children need help weather its water or farming they help them and train them so they now how to survive.

Answer:

the peace corps

Explanation:

I took the test

Bush invaded iraq in 1991 with congress's approval.
a. True
b. False

Answers

B. False. Bush invaded iraq without approval of Congress.

Answer:

The answer is B, False.


Explanation:

Hedge attacked Iraq without endorsement of Congress.According to the latest figures from Gallup, endorsement of Congress is at 16 percent, or, in other words numbers from August. The last time the endorsement rating for Congress was bring down was in July 2016, when it hit 13 percent.Most Americans don't cast a ballot, which implies that a U.S. congressperson or agent may be chosen by just 20 percent of the qualified voters. Also, the individuals who do cast a ballot frequently cast their polls for thin or ordinary reasons.

What two areas of society changed as a result of the Reformation?

Answers

 Self-government and new views of the world.

The reformation ended the tyranny of the church and brought about a new sense of freedom and liberty which together with renaissance thought catapulted to a new world view.

Government is instituted for the common good; for the protection, safety, prosperity, and happiness of the people; and not for profit, honor, or private interest of any one man, family, or class of men; therefore, the people alone have an incontestable, unalienable, and indefeasible [cannot be defeated] right to institute government; and to reform, alter, or totally change the same, when their protection, safety, prosperity, and happiness require it. —John Adams, Thoughts on Government, 1776 Which Enlightenment ideas are expressed by John Adams in the quotation above? A. Government retains power only through the will and force of the armed forces. B. Government is responsible for maintaining order and peace through laws over the people. C. Government may declare independence from the people, and the people may not rebel. D. Government is legitimate with the consent of the people, and the people have the right to rebel. Reset Next Question

Answers

the answer is d hoped i helped

Enlightenment ideas expressed by John Adams in the quotation above are Government is legitimate with the consent of the people, and the people have the right to rebel. The correct option is D.

Adams argued that a good government is one that is based on laws in Thoughts on Government, and he thought about how the "divine science of politics" might lead to such a government.

What was John Adams's view on democracy?

Recall that democracies are short-lived. Soon it exhausts itself and kills itself. There has never been a democracy that did not end its own life. Saying that democracy is less conceited, self-centered, ambitious, or avaricious than aristocracy or monarchy is a waste of time.

The foundations of constitutional governance that James Madison and other delegates used in the 1787 convention were developed in his political publications, such as Thoughts on Government (1776) and A Defense of the Constitutions of the United States of America (1778). Adams was a fervent advocate for the new constitution.

Thus, the ideal selection is option D.

Learn more about John Adams here:

https://brainly.com/question/12416301

#SPJ2

Who or what does the leopard symbolize in benin iconography?

Answers

In Benin, the leopard is a symbol of royal power. In the past, the leopards were even sacrificed so that the well being of the royal family is assured. In the seventeenth century the Oba kept tame leopards, he led the leopards in chains with him while he was parading through the city, and in this way he was showing his power and dominion over the mighty leopard, ''King of the Bush''.

what led to South Carolina secession from the Union

Answers

Abraham LincoIn was elected president he ran with the message of containing slavery.

Final answer:

The secession of South Carolina from the Union was primarily motivated by the election of Abraham Lincoln and the perceived threat to the institution of slavery. Other deep Southern states also seceded, with the secessionists championing the idea of states' rights and using white supremacy to gain support.

Explanation:

The secession of South Carolina from the Union was primarily motivated by the election of Abraham Lincoln and the perceived threat to the institution of slavery. South Carolina acted quickly after Lincoln's victory, calling a convention and voting unanimously to dissolve their Union with the United States. This action set a precedent for other deep Southern states such as Mississippi, Florida, Alabama, Georgia, Louisiana, and Texas, which also seceded from the Union.

The secessionist states believed in the idea of states' rights and saw the federal government's failure to enforce the Fugitive Slave Act as a violation of these rights. They also used the idea of white supremacy to gain support for secession, arguing that slavery made all whites, even poor whites, superior to blacks. Overall, the secession of South Carolina and other southern states was a response to the perceived threat to slavery and the belief in states' rights.

Which new York museum did the fearless five infiltrate

Answers

The answer is Hermitage Museum. This is a historical center of craftsmanship and culture in Saint Petersburg, Russia. The second-biggest historical center on the planet, it was established in 1764 when Empress Catherine the Great gained an amazing gathering of artistic creations from the Berlin shipper Johann Ernst Gotzkowsky. The gallery commends the commemoration of its establishing every year on 7 December, Saint Catherine's Day. It has been available to the general population since 1852.

I think it is Trippenhuis.

True or False. According to the article, suicide is condemned in Islam.

Answers

Suicide is prohibited by Islam, but unfortunately Islam plants suicide bombs. Your answer is True.
False 
it is forbidden an it's a sin, to take your own life, 

In the 1950's and 1960s a significant factor in the growth of suburbs was the?

Answers

Final answer:

The growth of suburbs in the 1950s and 1960s was driven by affordable housing, a desire for safer and healthier environments, and government policies encouraging suburban development, leading to changes in American life and increased automobile reliance.

Explanation:

In the 1950s and 1960s, a significant factor in the growth of suburbs was a combination of social desire and government policy that encouraged suburban living. Families moved from the cities to the suburbs, driven by the allure of affordable single-family homes, good schools, and a safe and healthy environment. This mass suburbanization was facilitated by developments such as the interstate highway system and federal legislation that provided low-interest loans for home construction. Furthermore, the rapid expansion of the suburbs increased the reliance on automobiles as suburban residents needed transportation to the city for work, or to access new suburban amenities like schools, malls, and supermarkets. Ultimately, this movement shaped a new form of American life, augmenting the economy and altering social patterns.

Final answer:

The growth of suburbs in the 1950s and 1960s was mainly driven by the desire of families to achieve the American dream, along with government policies that made suburban living more affordable.

Explanation:

The significant factor in the growth of suburbs in the 1950s and 1960s was the desire of many families to achieve the American dream. Suburbs offered affordable single-family homes, good schools, a safe living environment, and like-minded neighbors. Government policies also played a role in making suburban dreams affordable through financial incentives.

In his fireside chat after the attack on pearl harbor, how does fdr increase americans' confidence in the ability of the united states to win the war against the axis powers?a. he focuses on the strengths of each military branch.

Answers

He explains how the U.S military has become stronger since world war ll first began

The options of the questions are:

A. He enumerated the heroic efforts of American citizens in past wars. B. He discusses his military leaders abilities and past victories. C. He says that the United States can fight alone and win the war with its military strength. D. He shows his confidence in American support citizens ability to contribute to the war effort.

The correct answer is D) He shows his confidence in American support citizens ability to contribute to the war effort.

In his fireside chat after the attack in Pearl Harbor, FDR increased Americans confidence in the ability of the U.S. to win the war against the Axis powers by showing his confidence in American support citizens ability to contribute to the war effort.

In his speech delivered in December 1941, President Roosevelt addressed the American people. The main message of the chat was the necesary support of the U.S. citizens to help the war effort during the next difficult months. President Roosevelt made clear that he is asking the support of the U.S. people to contribute with the production of products for the war in an emotive way in order to have a favorable response from the people.


What Roman achievements were lost during the Dark Ages?

Economic advances of Roman influence
Architectural styles of the Romans
Economic advances of Roman influence AND the Architectural styles of the Romans
Educational and governmental advances of Roman influence

Answers

Economic advances of Roman influence

Answer:

A

Explanation:

they lost everything they had ever worked for including literature and much much more so it has to be A

What was the original conception of "administration" at the time of the framing of the constitution?

Answers

What was the original conception of 'administration' at the time of the framing of the Constitution?
The execution of executive details

during the 1930s the United States was eager to get involved in international conflicts
true or false

Answers

False:)
They didn't want to cause any problems..
False because it was trying to rebuild america NOT the world to stabilize the economy, but eventually WW2 Came and helped Stabilize the Economy

One reason the framers of the U.S. Constitution favored a federal system over a unitary system is because


they thought it would be cheaper.
B. they wanted to keep states powerless.
C. they wanted a limited national government.
D. they thought it would collect more taxes.

Answers

C. they wanted a limited national government.

A unitary system posits all government power in a "unitary" or single place -- the central government.  A federal system has power shared between the national government and the states' governments.  The founding fathers of the United States wanted to avoid a system that looked like a monarchy, with all the powers centered on whomever was on the throne.  They wanted checks and balances of power, to keep tyranny in any form from arising.

Which of the following composers was extremely important to the development of romantic piano music?

Answers

Final answer:

Frédéric Chopin was crucial to the development of Romantic piano music, renowned for his expressive and technically innovative compositions that emphasized individual expression and emotional depth.

Explanation:

The Romantic era was a transformative period in music history, marked by a shift towards expressive and emotional music that deeply influenced the development of piano music. Among the composers who played a pivotal role in this evolution, Frédéric Chopin stands out as exceptionally important. Chopin's compositions were quintessentially Romantic, characterized by their intricate melody, emotional depth, and technical innovation. His works, such as the ballades, nocturnes, and preludes, are celebrated for their poetic expressiveness and have had a lasting impact on the piano repertoire. Chopin's emphasis on individual expression, along with his revolutionary approach to piano composition and performance, cemented his status as a key figure in the development of Romantic piano music. By blending technical prowess with a profound emotional range, Chopin pushed the boundaries of piano music, making him an integral part of the Romantic movement in music.

Other Questions
Predict where the Katydid would hide from danger? Draw a picture of what you predict, help please The Silk Road was discovered by __________. A. Marco Polo B. Genghis Khan C. General Zhang Qian D. Kublai Khan Calcium carbonate reacts with hydrobromic acid to form calcium bromide, carbon dioxide, and water according to the reaction below. what is the molarity of the hydrobromic acid if 250.0 ml of it reacts with 5.64 grams of calcium carbonate? Explain why the equation (x-4)^2-10=15 has two solutions. Then solve the equation to find the solutions. Please show all your work! (30 points) A standard number cube with the numbers 1 through 6 is rolled. Find the probability of rolling a number greater than 5 .1. 1 / 62. 1 / 33. 1 / 44. 2 / 3 If a = 0.3 with a line over 3 and b = 0.5 with a line over 5, what is the value of a + b?8/108/988/10080/99 75 points Write and solve an equation to find the measure of NEP. Make sure you show all work. A ladder leans against a building. The angle of elevation of the ladder is 70. The top of the ladder is 25 ft from the ground. To the nearest tenth of a foot, how far from the building is the base of the ladder?20.5 ft30.5 ft32.3 ft39.5 ft Three positions of praying mentioned in the Old Testament are:kneeling and sittingkneeling, standing, and falling face downstanding and sittingkneeling, sitting, and lying on one's side Andrew drove 55 mph on his trip. Which of the following equations best represents the distance he drove if x stands for the number of hours? Two people start walking at the same time in the same direction. One person walks at 8 mph and the other person walks at 2 mph. In how many hours will they be 4.5 miles apart? Rowland and molina's work showed that ultraviolet light in the stratosphere causes cfcs to release ________ atoms. Why is this cover letter inappropriate? Genetic disorders caused by multiple genes interacting with the environment are called Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? view available hint(s) where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? it would not bind the target dna. ttttagccatttacgattaatcg ttttagccatttacgattaatcg ttttagccatttacgattaatcg? Find the product.y 4 y 6 Identify a management practice most conducive to the traditional personality. Use the net to find the approximate surface area of the cylinder to the nearest square meter Harry is a healthy man who is 30 years of age. using this information, calculate his approximate target heart rate zone for moderate-intensity physical activity. Speciation may occur when two populations become reproductively isolated from each other