Karen ditched her little sister so we could go to the year​ - end party. ditched means​ __________.

Answers

Answer 1
gotten rid of her
left her out
Answer 2

Answer:

get rid of or give up

Explanation:


Related Questions

Which weakness of the articles of confederation did the delegates to the constitutional convention want to address?
A. The federal government did not have a legislative branch to pass new laws
B. State governments did not have enough power compared to the federal government.
C. The federal government had too many branches to be efficient.
D. State governments were more powerful than the federal government.

Answers

The delegates to the constitutional convention converged in Philadelphia to address the weakness of the articles of confederation which gives more power to the state at the expense of the Federal government. Therefore, the correct answer is D

Further Explanation

The federal government was weak under the articles of the federation, although the articles of confederation only provided for the continental congress at the federal level with the power to make laws but lacked the power to enforce the laws. The federal was so weak to the extent that a state can decide to ignore federal laws if it so desires.  

Under the articles of confederation, the federal government lacked the power to collect or regulate tax; there was no executive or the judiciary branch, so it became so difficult for the federal government to function effectively.  

All these weaknesses strangulates the federal government and a constitutional convention was held to addresses the problems of the articles of confederation.

At the constitutional convention, a new constitution was drafted and grants more powers to the federal government. The New constitution allows checks and balances by dividing the federal government into three branches which include Executive, legislative and judiciary.

The newly drafted constitution was ratified in 1789 and replaced the articles of confederation.

LEARN MORE:

What weakness did delegate at the constitutional convention see in the articles of confederation  https://brainly.com/question/13372941What weakness did delegates at the constitutional convention see in the Articles of Confederation?  https://brainly.com/question/11134251

KEYWORDS:

federal governmentarticles of confederationstate governmentsconstitutional conventiondelegates

In a study of nearly 29,000 male criminals in denmark, what factor did researchers find had the greatest impact on whether lawbreakers were rearrested for a subsequent crime?
a. consistency of punishment
b. severity of punishment
c. age when punished
d. length of punishment

Answers

the  right answer is b

The correct answer is B) severity of punishment.

The factor that researchers found had the greatest impact on whether lawbreakers were arrested for a subsequent crime was the severity of the punishment.

In the study in 29,000 criminal men in Denmark, the severy of the punishment was the factor researchers found as the variable of whether lawbreakers were arrested for a subsequent crime. Denmark is a first world country with low rates of crime due to the high standard of education and good pay jobs of its citizens. The safety level in the country is of 88 percent and the crime level is only 25 percent, in data obtained when asking visitors and tourists.  

""pump and dump" is a technique used by individuals, such as the teenage wheeler-dealer, where:"

Answers

Where the businessperson pumps up the stock and after that dumps his investment into the stocks.

"Pump and dump" is a type of securities scam that includes falsely blowing up the cost of a possessed stock through false and deceiving positive proclamations, keeping in mind the end goal to offer the inexpensively obtained stock at a higher cost.

In terms of drug use, generational forgetting refers to: the inability of drug knowledge to pass from one generation to another. the failure of teens to believe the things that their parents tell them. the idea that each new generation forgets what the previous generation learned about drugs. the tendency of knowledge to skip a generation.

Answers

It refers to the "idea that each new generation forgets what the previous generation learned about drugs".

A consistent cycle of new medications and drugs creeps onto the scene while others make a rebound, similar to neon hues or thin pants. The National Institute on Drug Abuse (NIDA) calls this as "generational forgetting," a societal condition where the learning of specific medications' antagonistic results blurs among youth as generational substitution takes place.

The biggest air pollution threat to poor people is ____.

a. smoke from burning forests

b. dust blown into the air

c. indoor air pollution

d. badly maintained automobiles

e. pollutants from industry

Answers

Indoor air pollution. Most people smoke in houses

Your best friend is coming over to give you an exercise pep talk. according to force-field analysis, what's the best topic for the talk?

Answers

The best topic for the talk is: How much exercise you can get into very short periods of time
According to short field analysis, the best way to conducted a behavioral changes is by doing the easiest/most attainable goal first before moving to the harder ones. So, when starting an exercise program, it's best to focus on the lowest targets/movement before moving up to a more advanced ones.

True or False: It is legal to park on the right side of the roadway on a one-way street.
True
False

Answers

False because one way means that the right is the way that it is going
You may ONLY park on the right side on a one-way street

In decision making by consensus, group members voice their feelings and opinions, but the leader or boss makes the final decision. true or false

Answers

The correct answer is false. It is because the statement is likely describing the decision of authority by which the members voices out their feelings and opinions whereas the leader or the CEO is the one responsible for making the final decision.

Bart has decided to buy some water balloons rather than get an extra milk at lunch. Choosing among economic alternatives is referred to as

Answers

The answer is "trade-off"

Choosing among economic alternatives is referred to as a trade-off. Thus option B is correct.

What are economic alternatives?

Production, trading, labor/compensation, financial, and consumable methods that deliberately diverge from traditional (capitalist) economic growth; a distinct way of conceiving of the economy as a diverse and expanding social arena.

Due to the scarcity of economic resources, it is necessary to make these trade-offs. The client must choose how to spend his finite amount of resources after being provided a fixed endowment of resources.

If his inheritance cannot cover almost all, Bart has chosen to purchase some water balloons rather than acquire an extra glass of milk. As a result, making an economic decision entails rejecting all other options. Therefore, option B is the correct option.

Learn more about  economic alternatives, Here:

https://brainly.com/question/3209978

#SPJ6

The question is incomplete, the complete question will be :

Bart has decided to buy some water balloons rather than get extra milk at lunch. Choosing among economic alternatives is referred to as

A)scarcity

B) a trade-off

C) interdependence

D) labor allocation

Mental learning is closest in meaning to which form of learning

Answers

The right answer is "Cognitive Learning". The theory of cognitive learning postulates that to carry out an efficient learning process, several higher cognitive processes are used, such as awareness or the analysis of information. If these cognitive processes are used correctly, effective learning will occur.

Explain two factors that could motivate a nation to carry out genocide.



Answers

1. Discrimination or immense hatred against another tribe or race, such as the Rwanda Genocide

Answer:

Prejudice to a particular nationality or race. Rejection of a particular religion and its members.

Explanation:

Genocide is the name given to the deliberate killing of a group of people and is characterized by the existence of differences. For this reason, we can cite as possible factors of a genocide prejudice against a nationality or race (blacks, Latinos, Chinese, etc.) or total rejection of a religion and its members (Muslims, Jews, Umbanda, etc).

The term genocide is recent in the history of mankind, however its practice is far away. The word was only used to identify the deliberate killing of people at the end of the first half of the twentieth century. On this occasion, the most famous genocide in popular knowledge occurred, the killing of Jews by Adolf Hitler and his Nazi Germany during World War II. To try to explain the high number of murders of people in a specific group and to push for justice, Polish Raphael Lemkin coined the term in 1944, based on the Greek meaning to kill a race or tribe.

Confronters are successful at resolving conflict when they wait long enough before confronting the other party and do it in an emotional state.
a. True
b. False

Answers

The correct answer is false. They are not successful at resolving conflict if they wait long enough because this could take the problem to last more and that doing it in an emotional state would only make the confrontation worst because they are likely to act with emotions than acting in a more formal way that will prevent any dispute. 
The answer is False 



brainliest pls and hope this helps

what limitation is put on admitting new states to the union?

Answers

New States may be admitted by the Congress into this Union; but no new States shall be formed or erected within the Jurisdiction of any other State; nor any State be formed by the Junction of two or more States, or Parts of States, without the Consent of the Legislatures of the States concerned as well as of the Congress.

ARTICLE IV, SECTION 3, CLAUSE 1

Final answer:

The main limitations on admitting new states to the Union are geographical restrictions and the consent from the Congress and the legislatures of the concerned states. The Fourteenth Amendment also protects the rights of citizens in new states. Historical debates around issues like slavery and equal representation have also influenced the admittance of new states.

Explanation:

The limitations on admitting new states into the Union primarily deal with geographical limitations and consent. Based on Article IV, Section 3, Clause 1 of the United States Constitution, Congress may admit new states to the Union. However, a new state cannot be formed within the jurisdiction of an existing state nor can a state be created by merging two or more states or parts of states, unless both the legislatures of the concerned states and Congress agree to such a condition.

Another important aspect involves the implication of the Fourteenth Amendment, which prohibits states from denying citizens their rights, due process of law, equal protection of the laws, and voting rights based on race, sex, and age.

In historical context, debates around issues, such as slavery and equal representation, have also influenced the process of admittance of new states. Nonetheless, it's also significant that the new states needed to adopt Constitutions essentially aligning with the ideals of the United States Constitution.

Learn more about Admitting New States here:

https://brainly.com/question/13745410

#SPJ12

Thomas was stung by a wasp and became afraid of wasps. However, he also fears honey bees, bumble bees, and common house flies. This process is referred to as

Answers

Final answer:

Stimulus generalization is when a reaction to a specific stimulus extends to similar stimuli, which explains why Thomas fears various insects after being stung by a wasp.

Explanation:

The process described where Thomas was stung by a wasp and subsequently developed a fear of not only wasps but also honey bees, bumble bees, and common house flies is known as stimulus generalization. This is a concept in psychology where a response to a specific stimulus becomes associated with similar stimuli, leading to the same reaction being triggered by related but distinct cues. A famous example of stimulus generalization is the case of Little Albert, who was conditioned to fear a white rat and subsequently became fearful of other white and furry objects, similar to how Thomas developed a broader fear of insects after his wasp sting.

The traditional role of a manager is that of a(n):

Answers

leader of work force

Answer:

Monitor

Explanation:

That would be someone that controls and supervises the daily activities that are done in a certain department of a business the manager often only oversees the activities and responsabilities that others have and makes sure everything is done properly and that deadlines are met.

S libby entered the library, her friend saw her and raised her finger perpendicular to her lips to indicate to libby that she needed to remain quiet. which element of kinesics is this

Answers

I believe the answer is substituting function.
Substituting function refers to the replacement of a certain action with another that served the same function.
From the situation above, placing your finger on the lips is a generally accepted substitution gesture that indicates a request for other person to stop talking/lower their voice.

Ncome inequalities are often greatest in the poorest countries. true false

Answers

That statement is false
Income inequalities tend to exist in rich countries.
This happen because after a wealthy individuals died, they tend to give all their inheritances to their direct bloodline, same with poor individuals.
Because of this, children from wealthy families started with certain advantages that would most likely widen the inequality.

After the battle in the Wilderness, the Union and Confederate armies battled for 11 days first in terrible heat and then in pouring rain near___________ , often in bloody hand-to-hand combat that left many traumatized.

Answers

Spotslyvania Courthouse


The battle occurred from May 8 to May 21, 1864. There was no clear winner in the battle. Ulysses S. Grant and George G. Meade led the Union and the Confederates were under the command of Robert E. Lee. It is one of the several  bloodiest battle in the civil war.

I believe the answer is: Spotslyvania courhouse
The battle happened on may 8th - may 20th 1864. During the period of those 12 days, each sides have to witness more than 10,000 of their comrades being slaughtered one from another (the north lost 18,000 and the south lost 12,000) which caused a lot of them to be traumatized.

When bill is alone with sally, he apologizes by saying, "i'm sorry about getting angry yesterday. i should have informed you sooner that i rescheduled my appointments." bill's apology could be even stronger if he had included?

Answers

If he had included "a remedy".

A significant apology conveys the three R's: regret, responsibility and remedy. While an individual can't fix the past, they can repair the mischief caused. In this way, a significant apology needs to incorporate an announcement in which they offer compensation, or a guarantee to make a move so they won't rehash the conduct.

Answer:

The art of apologizing

Explanation:

Dinabi is unwilling to give to charity to help the poor because she believes that people who remain poor year after year have values, beliefs and practices that ensure that they will continue to be poor. dianbi's beliefs are in line with:

Answers

Dianbi's beliefs that people who remain poor year after year have values, beliefs and practices that ensure that they will continue to be poor are in line with the Culture of poverty. The culture of poverty is an social concept  that states the idea that people tend to persist in a state of poverty because they have distinct beliefs, values and behavior, and by doing so they are belonging to a separate culture

Carefully study the map above. What is the most likely reason why towns on the Mexican border are located near American towns?
A.
because it allows Mexican towns to use American water and electrical services
B.
because the climate is better in these locations
C.
because it makes trade between the two nations easier

D.
because these areas are safer for residents

ANSWER IS NOT D!


Answers

Answer:

C.

because it makes trade between the two nations easier

Explanation:

Answer:

c

Explanation:correct on edge2020

​a man was trapped behind a refrigerator and nearly suffocated. subsequently, he has a phobia of tight, enclosed spaces and is afraid to ride on small, crowded elevators. however, he has no fear of large, uncrowded elevator rides. the man's fear of small elevators is an example of ______, and his lack of fear toward large elevators is an example of _______.

Answers

the man's fear of small elevators is an example of "stimulus generalization", and his lack of fear toward large elevators is an example of "stimulus discrimination".

Stimulus generalization refers to the propensity for stimuli like a unique stimuli in a learning worldview to deliver a reaction approximating that learnt under the first condition. A generalization inclination can be drawn up demonstrating that the more comparable the stimuli the more comparable the reactions.
Stimulus discrimination refers to a phenomenon recognized in behaviorist learning theory, the individual figures out how to recognize, for reaction purposes, between comparable stimuli. 

Which ethnic group makes up 90 percent of the population in most countries of Southwest Asia

Arab
Israeli
Turkish
Kurdish

Answers

i looked all over the web so i just going to ask my taacher ( kurdish)

its Turkish. hope that helped.

Posttraumatic stress disorder (ptsd) may develop in persons who _____ life-threatening events. experienced witnessed imagined experienced or witnessed

Answers

Experienced or witnessed I believe

Final answer:

PTSD is a mental health condition that can occur in individuals who have experienced or witnessed traumatic events, such as military combat, natural disasters, or serious accidents. Symptoms can include intrusive memories, increased jumpiness, and avoidance behaviors.

Explanation:

Posttraumatic stress disorder (PTSD) is an anxiety disorder that can develop in persons who have experienced or witnessed life-threatening events. This condition may emerge after exposure to severe psychological trauma, and it is characterized by a range of symptoms which include intrusive and painful memories, increased arousal such as jumpiness, avoidance of reminders of the traumatic event, persistent negative emotional states, detachment from others, and angry outbursts. Certain individuals and demographic groups may be more likely to experience traumatic events and develop PTSD, such as veterans who have served in combat. The psychological trauma stemming from these experiences is considered a normal reaction to abnormal events, which can often be debilitating and persistent throughout a person's life. Moreover, PTSD is not just confined to war veterans; it can affect anyone who experiences, witnesses, or is confronted with a traumatic event, such as natural disasters, terrorist attacks, serious accidents, or personal assaults.

in 1688 what nation became more important to england than the colonies?

Answers

it is the united nation

Answer: France

Explanation:

Beginning in 1688, England started focusing on France, which was its main contender over the control of Europe.

Therefore, the applied the Salutary Neglect, which was the British governmental policy over the American colonies. As long as the colonies stayed loyal to the British rule and added to the economic development of Britain, trade regulations and imperial surveillance of colonial matters were loosely applied.

Using complete sentences, describe Europe before the existence of the nation-state.

Answers

-Prior to the existence of the nation-state, Europe was comprised of several multiethnic empires, the largest and most powerful of which was the Holy Roman Empire.


Hope it helped :D have a nice day!!

Throughout the 18th century and before then, the political, geographical, economic and social comformation of Europe was dictated by the existence of Empires and some smaller kingdoms that were characterized by the fact that they were not identified by a single common language and culture, but rather, they were regions commanded by a ruler, or a dynasty, whose language and customs ruled others, even if the ethnicity and origins, as well as language and customs of those ruled, were totally different. As such, before the 19th century, with the emergence of nationalism and a sense of belonging to a specific nation, and thus the emergence of states, the European continent, and most others, except for Australia and Antartica, was divided into 6 major empires: Austrian Empire, Ottoman Empire, Russian Empire, British Empire, Kingdom of France and Kingdom of Hungary and some smaller kingdoms. The main characteristic was, a divergence of language and cultural backgrounds, all united under a ruler, but without any links, except for the ruler and the region where people lived.

Kelly thinks she works hard to make sure that her relationship with her boyfriend michael is fulfilling and fun. however, lately she has begun to think that michael doesn't appreciate her efforts. according to __________, this relationship might not last.

Answers

I believe the answer is: social exchange theory
social exchange theory views that Our society was built on the act of exchange that initiated by a certain members of society that would benefit one another.
The relationship above would most likely to fail because the exchange only benefit one partner and not the other..

What precedents did George Washington establish as first president

Answers

Made the Cabinet within the Executive Branch by assigning Thomas Jefferson Secretary of State and Alexander Hamilton Secretary of Treasury, a figure that was not drawn within the Constitution.

Maintained innovative fiscal ideas for instance the Bank of America and a national liability , which would be later accepted

Presented a policy of neutrality relating to foreign wars that was shadowed up until WWI

Set the pattern for a two term limit of Presidents that was monitored until Franklin Delano Roosevelt and then twisted into the 22nd Amendment to the Constitution

Recognized relations with Great Britain with Jay’s Treaty. To this day England rests one of our neighboring and toughest partners

Recognized the custom of a Presidential farewell speech

According to the graph, in this market, a price of $1.50 would be _____.

Answers

According to the graph, in this market, a price of $1.50 would be equilibrium.

answer on grad point is "the equilibrium graph"

What are the benefits of instant communication and sales for consumers? Check all that apply.

Companies can ship goods to customers in an instant.
Businesses can be available for customers 24 hours a day.
Customers can purchase goods and services online.
Customers can give feedback to producers instantly.
Employers can hire workers from all over the world.

Answers

The answers that are correct are:

Businesses can be available for customers 24 hours a day.

Customers can purchase goods and services online.

Customers can give feedback to producers instantly.


Hope this helps you



Thanks to modern technologies, like the Internet, the customer reviews have gained a lot of importance for companies and they aim to receive good feedback from them. For example, when you are going to buy something on Amazon, would you buy a 1-star item or a 5-star one? Some companies have even hired people to write good reviews for their products online. So, instant communication and sales for customers is one of the most important factors when rating a product or a company because it shows: (1) Businesses can be available for customers 24 hours a day.  (2) Customers can purchase goods and services online.  and (3) Customers can give feedback to producers instantly

Other Questions
What is the equation, in slope-intercept form, of the line that is perpendicular to the line y 4 = 2/3(x 6) and passes through the point (2, 2)? y = 2/3x 10/3 y = 2/3x +10/3 y = 3/2x 1 y = 3/2x + 1 Your gross pay on your paycheck is $400. your deductions are as follows: federal income tax - $50.00 state income tax - $20.00 social security tax - $7.00 medicare tax - $3.50 please calculate your net pay (in dollars). question 2 options: Which statement accurately describe the role of decomposers in the carbon cycle? When parking downhill on a road with a curb, you should turn your front wheels __________ .A. parallel to the curbB. towards the curbC. towards the street Which of the following terms describes the primary core of a comet? two cards are drawn without replacement from a standard deck of 52 playing cards. find the probability that both are odd numbers (aces are considered odd because they have a value of 1 or 11). 14) Which BEST describes the way the Fourteenth Amendment affected the states?A)States had to give all citizens, regardless of their race or religion, equal protection under the law.B)States could no longer make any laws that were not approved by the federal government.C)States had to pass laws that gave more rights to freed slaves than to other citizens.D)States could no longer institute poll taxes or tests for citizens before they voted.2) The term "Reconstruction" in United States history refers to the period after what event?A)the Civil WarB)the Revolutionary WarC)the Constitutional ConventionD)the Declaration of Independence The major problem with hydrogen as an alternative source of energy is that none exists on the surface of the earth. a. True b. False Analyze the following statement: Marcus notices that he runs faster in the mornings rather than the evenings. Is the statement an example of correlation or causation? A. Correlation, because time of day doesn't cause a person to run faster or slower B. Causation, because Marcus has noticed this over several trials C. No relationship, because time of day has nothing to do with how fast a person runs D.There is not enough information to make a conclusion Which head glands secrete sucrase, lipase, amylase, and invertase? What is the measure of an angle that turns through 3/4 of a complete circle What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatctcatccagcattctgaaagggtaatgaataattattccgctgagttcatgaggtatccgaaggaggagcaacacttaggctataagagtatcatgcacatagatcgggataaatcgcctatcatatgtgacaacaatttcatgattaaaagt code for? Which is a pro-election of federal judges argument?A. When judges are elected they can be biased by party politics. B. When judges are elected there they can focus more time on reviewing law.C. Judges are more accountable to the people and what they think is just when they are elected Which statement displays an effect of developing a successful atomic bomb? Question 11 options: A.encouraged private sector employees to not share their discoveries with the government B.was the final time that the government and private sector combined to form any great invention C.served as a model for future government or private research and development labs to create innovationsD.proved that military innovation is always ahead of private innovation the graph shows the percentage of dog breeds affected by elbow dysplasia, which causes dogs to limp. What???s the most likely explanation for the mixed breed???s disease incidence? The probability is 0.2 that a person shopping at a certain store will What is the differecne of the following polynomials? (6x^2 - 3x^3) - (2x^3 + 4x^2 -5) Congratulations As you know, the position for which you are applying requires superlative problem-solving skills in a variety of arenas, and the ability to think critically on the fly is essential. To evaluate your ability in this area, the practical portion of the interview process consists of a series of locked-room puzzles. You will need to use all of your ingenuity to find the key to unlocking each room. There are six rooms total; four of the rooms will have individual time limits, while the remaining two rooms will be untimed. You will be observed by the interview team from a remote location, and your progress through the rooms will be recorded. For which type of communication would this paragraph be used?A)casual noteB)informal emailC)formal business If 1495 J of heat is needed to raise the temperature of a 337 g sample of a metal from 55.0C to 66.0C, what is the specific heat capacity of the metal? Evaluate the expression when a=15 and b=5. b2 ------------ = a + 5Help