MATH HELP PLEASE UGRGENT WILL GIVE BRAINIEST!!
In the figure, YX−→− and YZ−→− are tangents to circle A at points X and Z, respectively.

mXZ=140∘
mXSZ=220∘



What is the measure of ∠XYZ ?

MATH HELP PLEASE UGRGENT WILL GIVE BRAINIEST!!In The Figure, YX And YZ Are Tangents To Circle A At Points

Answers

Answer 1
The measure of an angle formed by two tangent lines intersecting at a point outside the circle is equal to one-half their intercepted arcs.
XYZ = 1/2(XSZ - XZ)
XYZ = 1/2 (220 - 140)
XYZ = 1/2 (80)
XYZ = 40

The measure of angle XYZ is 40 degrees.

Hope this helps =)
Answer 2

Answer:

40

Step-by-step explanation:


Related Questions

Factorise fully 6m+18

Answers

6m+18
6(m+3)
that's the answer

The factorised form of 6m + 18 is given by the equation: 6(m + 3).

Given :

Equation - 6m + 18

Solution :

Factorisation is the method of diminishing the bracket of a quadractic condition, rather than growing the bracket and changing over the condition to a item of variables which cannot be decreased assist.

To factorise the equation 6m + 18 we have to follow some steps:

In first step we have to write 18 = [tex]6\times 3[/tex] so the equation becomes:

[tex]\rm = 6m + (6\times3)[/tex]  ----- (1)

In second step we have to take 6 common from equation (1):

[tex]\rm=6(m+3)[/tex]

So the factorised form of 6m + 18 is given by the equation: 6(m + 3)

For more information, refer the link given below

https://brainly.com/question/19261816

What is an equation stating that two ratios are equivalent.

Answers

the answer is a proportion 
Final answer:

A proportion is an equation that shows two ratios are equivalent, such as 1/2 = 3/6. It is commonly used with unit rates and unit scales in various fields including science, engineering, and everyday measurements.

Explanation:

An equation stating that two ratios are equivalent is known as a proportion. For example, the equation 1/2 = 3/6 is a proportion because it shows that the two ratios have the same value. Proportions are very useful in various aspects of mathematics and science. Notably, they are essential when dealing with unit rates and unit scales, where comparisons between two measurements are made.

A unit rate is a special kind of ratio where one of the quantities is one, such as 55 miles per hour (55/1 mph). It describes how many units of the first type of measurement corresponds to one unit of the second type of measurement. Similar in concept, a unit scale compares the dimensions of an actual object to a model or drawing. For instance, a map might have a unit scale that reads 1 inch = 100 feet, which would be written as 1 inch/100 feet.

When applying proportions in real-world scenarios, we can create conversion factors to switch from one measurement to another. This is directly applicable to cooking recipes, chemistry with mole ratios, or engineering with the transformer equation, where ratios of different quantities are kept consistent.

Learn more about Proportion here:

https://brainly.com/question/34018947

#SPJ6

A circle has a radius of 2 cm.

How does the circumference of the circle compare to the area?

Drag and drop a phrase to correctly complete the sentence.

A. Greater Than

B. Less Than

C. Equal To

Answers

C , hope i helped. (:
the answer is c. hope this helps

choose the answer that best completes the sentence. if you know a root of a function is -2 + sqrt3 , then __
A. 2 + sqrt3 is a possible root
B. 2 + sqrt3 is a known root.
C. -2 - sqrt3 is a possible root.
D. -2 - sqrt3 is a known root.

Answers

answer:

d. -2 - sqrt3 is a known root.

hope this helps! :o)


Answer:the answer is D

Step-by-step explanation:

Which of the following represents the graph of f(x) = 2(x + 3)?
A. https://cdn.flvsgl.com/assessment_images/algebra2_v14_gs-xml/93228_559e8103/08_14_17.gif

B. https://cdn.flvsgl.com/assessment_images/algebra2_v14_gs-xml/93228_559e8103/08_14_18.gif

C. https://cdn.flvsgl.com/assessment_images/algebra2_v14_gs-xml/93228_559e8103/08_14_19.gif

D. https://cdn.flvsgl.com/assessment_images/algebra2_v14_gs-xml/93228_559e8103/08_14_20.gif

Answers

we have that
the correct expression is
y=2^(x+3)

using a graph tool
see the attached figure

the answer is the option C

Please show all work

Answers

1a) distance = speed*time
.. 10x +6y = 30 . . . . . . . total distance = 30 km

1b) x +y = 4 . . . . . . . . . . total of time spent running and walking is 4 hours


2) See the graph for points and plots.

Jenna's parents required her to put $10 of her $50 monthly allowance into a savings account for what percent of her monthly allowance did this represent?

Answers

$10 is 20% of $50 dollars therefore the answer is it represented 20% of her monthly allowance

Final answer:

To determine the initial amount needed in a bank account to reach $10,000 in ten years with 10% compound interest, use the compound interest formula.

Explanation:

To find out how much money you need to put in a bank account to have $10,000 in ten years with 10% interest compounded annually:

Use the formula for compound interest: A = P(1 + r/n)^(nt)

Plug in the values: $10,000 = P(1 + 0.10/1)^(1*10)

Solve for P: P = $10,000 / (1.10^10)

Calculation:

PV = FV / (1 + r/n)^(n*t)

Inserting the known values:

PV = $10,000 / (1 + 0.10/1)^(1*10)

PV = $10,000 / (1.10)^10

Calculating the exponent:

PV = $10,000 / 2.59374

Finally:

PV = $3,855.43 (approximately)

Therefore, you need to put approximately $3,855.53 into the bank account initially.

Kail Ryans 10 laps around the track each day each lap around the track is 400 m meters how many times around the track will she need to run a total of 12 kilometers

Answers

hello

1 km = 1000 m

12 km = 12,000 m

Each day, she runs 10 * 400 m = 4000 m

12,000 m / 4000 m = 3

It will take 3 days.

Have a nice day

John says the transformation rule (x, y) es002-1.jpg (x + 4, y + 7) can be used to describe the slide of the pre-image (4, 5) to the image (0, –2). What was his error?

Answers

John didn't check his work.

The appropriate transformation rule is (x -4, y-7).

_____
John's signs were in error.

Sample Response: The pre-image is the point you start with. To check the transformation rule, substitute the values of the coordinates (4, 5) into the rule. You get (4, 5) → (4+4, 5+7). Simplify to get (4, 5) → (8, 12). This is the image. Instead the rule was applied to the image. This is the source of the error.


suppose the digits cannot repeat. find the number of possible two-digit and three-digit codes. 1,2,3,4,5

Answers

there are 20 possibilities, for 2 digit codes and 60 possibilities for 3 digit codes.

What is the minimum number of weighings on a balance scale need to find a counterfeit coin among 8 coins if the counterfeit coin is either lighter or heavier that the other true coins (which are all the same weight.) describe the algorithm to find the counterfeit coin in this minimum number of weighings?

Answers

It would take only 3 weighings to find the counterfeit coin (at the most). 

First you would weigh coins against each other in pairs. 

-Coins 1 and 2 vs Coins 3 and 4
-Coins 5 and 6 vs Coins 7 and 8

One of the 4 pairs would weigh more or less than the other. Once you have determined that pair and whether it is more or less, then weigh the coins in that pair against each other. Use whether the pairing was more or less than the other pairing to determine which of the coins you are looking for. 

To find a counterfeit coin among 8 coins with a balance scale, divide the coins and use up to 3 weighings. The algorithm involves grouping and comparing the weights, identifying the counterfeit in the imbalanced group.

Algorithm to Find a Counterfeit Coin among 8 Coins

To find a counterfeit coin among 8 coins with a minimum number of weighings on a balance scale, we need at most 3 weighings. Here is the step-by-step algorithm:

Divide the 8 coins into three groups: two groups of 3 coins each, and one group of 2 coins.Weigh the two groups of 3 coins against each other.If they balance, the counterfeit coin is in the group of 2 coins. Weigh those two coins against each other to find the counterfeit one.If the two groups of 3 coins do not balance, take the lighter or heavier group (depending on whether the counterfeit is known to be lighter or heavier) and divide the 3 coins into three groups of 1 coin each.Weigh one coin against another. If they balance, the third coin is the counterfeit. If they do not balance, the heavier or lighter coin (again, depending on the counterfeit's known weight difference) is the counterfeit.

With this algorithm, the maximum number of weighings needed to determine the counterfeit coin is three.

You can draw a quadrilateral with two sets of parallel lines and no right angles? @KamiBug,

Answers

Yes, you can do this. It is important to note however that inside of lines, the sides of a this quadrilateral are better described as segments. A quadrilateral has four sides, and if there are two sets of parallel sides, it is a parallelogram. A rectangle is a parallelogram, but it has four right angles. If you take a rectangle, and change the angles, you will still have a parallelogram that is no longer a rectangle. It will have two sets of parallel sides, but no right angles. Opposite angles will be congruent.

What number would you add to complete the square for the equation below?x2 + 10x = 0?

Answers

For a quadratic of the form [tex]x^2+bx=-c[/tex], we complete the square by first adding 
[tex](\dfrac{b}{2})^2[/tex]
to each side.

Here, the coefficient b is equal to 10. We take half of this—5—and square it to get 25. We add this to both sides of the equation.

FYI, this equation can easily be factored, so there's no need to complete the square.

What does -3.4 E + 38 mean? (In normal number terms).

Answers

"E" stands for exponent, specifically 10. If something says "E+38" (like in Microsoft Excel), that means 10^38 in scientific notation.  
Therefore, "-3.4 E + 38" means -3.4x10^38.  
The "+38" means there are 38 zeros following a 1 as the exponent. It also works with negative numbers. For example, E-3 equals 10^-3

Can someone please help me solve this problem????

Weston is buying a house for $215,000. He is financing $185,000 and obtained a 30-year, fixed-rate mortgage with a 6.525% interest rate. How much are his monthly payments?

$1,005.94

$1,362.48

$1,614.09

$1,172.37,

Answers

$1,172.37 The formula for calculating the payment on a loan is P = r(PV)/(1 - (1 + r)^(-n)) where P = Payment PV = Present value r = interest per period n = number of periods Since there's 12 months per year and the loan is for 30 years, there will be 12 * 30 = 360 periods. The interest rate per month will be 0.06525 / 12 = 0.0054375, and finally, the present value is the size of the loan at 185000. Now let's substitute and solve. P = r(PV)/(1 - (1 + r)^(-n)) P = 0.0054375(185000)/(1 - (1 + 0.0054375)^(-360)) P = 1005.9375/(1 - (1.0054375)^(-360)) P = 1005.9375/(1 - 0.141961802) P = 1005.9375/0.858038198 P = 1172.369134 P = 1172.37 So the monthly interest and principle payments are $1,172.37 Note: The actual payments will be higher since the above figure doesn't include insurance and taxes.
For this problem, we will be using the formula for loan:

PMT=P[(r/n)/1-(1+r/n)^-ny]
where: 
P=Principal Value
r=rate
n=number of compoundings/year
y=year

To solve:
*Weston is only financing $185,000.

P=$185,000
r=6.525% or 0.06525
n=12 (monthly)
year=30

PMT=185000[(0.06525/12)/1-(1+0.6525/12)^-12*30
        = 185000[(.0054375)/1-(1+.0054375)^-360
        = 185000[(.0054375)/1-(1.0054375)^-360
        = 185000[(.0054375)/1-(0.142)
        = 185000[(.0054375)/(.858)
        = 185000(0.00634)
        = 1,172.37

Answer: $1,172.37

Determine the equation for the parabola graphed below.

Answers

The general equation for a parabola is: y = a(x - b)^2 + c
So given the vertex is at (-1, 7), this means that b = -1 and c = 7:
y = a(x + 1)^2 + 7
Then we substitute a point from the graph (aside from the vertex). The easiest is the y-intercept of (0, 5):
5 = a(1)^2 + 7
a = -2
Therefore the equation is: y = -2(x + 1)^2 + 7 = -2x^2 - 4x + 5

The equation for the parabola graphed below is  [tex]y = -2(x + 1)^2 + 7 = -2x^2 - 4x + 5[/tex]

A parabola's general equation is: y = a(x - b)2 + c

Given that the vertex is located at (-1, 7), this means that b = -1 and c = 7:

y = a(x + 1)^2 + 7

Then, instead of the vertex, we replace a point from the graph. The y-intercept of (0, 5) is the simplest:

5 = a(1)^2 + 7

a = -2

As a result, the equation is as follows: [tex]y = -2(x + 1)^2 + 7 = -2x^2 - 4x + 5[/tex]

for the final answer do i add the 5 to (x+1) making it 5x+5 or do i leave it how it is? Also how do i find the domain

Answers

You don't "add the 5" in any event. Multiplication is very different from addition, and precision of vocabulary is important.

It depends on what your teacher or answer key expect. You can take a hint from the fact that the given polynomials are all multiplied out.

(5x^2 +5)/(x -1)

_____
The domain of polynomials in general is "all real numbers." However, you must exclude any specific numbers that make the rational expression be undefined. This includes numbers that make the denominator of the numerator zero, as well as those that make either the numerator or the denominator of the denominator zero. In other words, you must exclude from the domain
.. x ∈ {-5, 1, 2}

NEED HELP ASAP AND WILL GIVE A MEDAL ***
Tammy is using a treadmill, and when she puts her hands on the bar, sensors read her heart rate. Today, the sensors are telling Tammy that she is reaching 183, which is the highest rate in her target zone. What should she do to get the most effective workout?

Increase her running speed without adjusting the incline
Use the machine to maintain or decrease her intensity
Do additional aerobic exercises immediately after the treadmill
Use the machine to increase the incline and intensity,

Answers

Tammy should use the machine to maintain or decrease her intensity. 183 is a very high heart rate and indicates that she is working at, or near, a maximal effort. She should not increase the intensity (speed or incline).

The vertex of this parabola is at (-1,-3) which of the following could be its equation

A. x = -2(y + 3)2 - 1
B. x = -2(y - 1)2 - 3
C. x = -2(y - 3)2 - 1
D. x = -2(y + 1)2 - 3

Answers

its actually A.AAAAaaaa...
Answer:

                     Option: A is the correct answer.

                         [tex]x=-2(y+3)^2-1[/tex]

Step-by-step explanation:

We know that any general equation of a right or left open parabola is given by:

                           x=a(y-k)^2+h

where if a<0 then the parabola open to the left and if a>0 then the parabola opens right.

Also the vertex of the parabola is: (h,k)

Now here we are given:

Vertex (h,k)=(-1,-3)

Also a= -2 in each of the options.

Hence, we have the equation of parabola as:

                [tex]x=-2(y-(-3))^2+(-1)\\\\x=-2(y+3)^2-1[/tex]

Hence, the equation of the parabola is:

                  [tex]x=-2(y+3)^2-1[/tex]

What is the lateral area of this regular octagonal pyramid?(PICTURE ONE)




114.8 cm²

162.4 cm²

229.7 cm²

281.3 cm²

2.What is the slant height x of the square pyramid?(PICTURE 2)

The figure shows a square pyramid. The slant height is shown as a dashed line perpendicular to the base edge and is labeled as x. The length of the lateral edge is 8 meters. The lateral edge makes a 60 degree angle with the base edge

Express your answer in radical form.

3.What is the surface area of this square pyramid? (pICTURE 3)

Round your answer to the nearest tenth, if necessary.


43.8 yd²

66.6 yd²

105 yd²

171.6 yd²

Answers

Q1)
the lateral area of the pyramid is the total area of all the lateral faces excluding the base.
In this regular octagonal pyramid, the lateral sides are triangles. As there are 8 triangles we need to find the area of all 8 sides.
Area of one lateral triangle face = 1/2 * base * slant height 
slant height is the hypotenuse of the right angled triangle formed from the base of the pyramid with the perpendicular height.
slant height - l
l² = 7² + 7² = 49 *2
 l²  = 98 
l = √98
l = 9.9
Area = 1/2 * 5.8 cm * 9.9 cm 
         = 28.71 cm²
There are 8 sides 
total lateral area = 8 * 28.71 = 229.68 rounded off is 229.7 cm²
third option is correct - 229.7 cm²

Q2)
in the triangular face, the lateral edge makes a 60° angle with the base edge. Therefore 2 of the angles are 60° each, since the sum of the interior angles of a triangle is 180°, the third angle too is 60°. this makes the triangle an equilateral triangle with equal angles, hence equal sides. 
since lateral edge is 8 cm,base edge too is 8 cm. 
since this is an equilateral triangle, the perpendicular line cuts the base edge at its midpoint, bisecting the line forming 2 right angled triangles.
in the right angled triangle, height of triangle is x slant height ,
base = 8 /2 = 4 cm
hypotenuse = 8 cm
We need to find x, use Pythogoras' theorem 
4² + x² = 8²
16 + x² = 64
x² = 62 - 16
x = √48
x = √4x√4x√3
  = 2x2√3
  = 4√3 cm

Q3)
surface area of the square pyramid 
surface area of the base + surface area of triangular faces 
square area = length x length 
                    = 6.2 x 6.2 
                    = 38.44 yd²
triangular face area = 1/2 * length * height 
since the angle between lateral edge and base edge is 60°, its an equilateral triangle where all sides are equal. in this case each side is 6.2 yd. 
to find the perpendicular height, use pythogoras' theorem
the perpendicular line(slant height ) cuts the base edge at its midpoint, therefore length of the right angled triangle is = 6.2/2 = 3.1 yd

slant height - l
l² + 3.1² = 6.2²
l² = 38.44 -9.61
l²  = 28.83 
l = 5.37
area = 1/2 *length *height 
        = 1/2 * 6.2 * 5.37
        = 16.64 yd²
there are 4 triangles = 4 * 16.64 = 66.58 yd²
total area = 38.44 + 66.58 = 105 yd²
correct answer is 3rd option - 105 yd²

Answer:

1.  229.7cm^2

2.  4 (square root) 3 cm

3.  16.64yd^2

Step-by-step explanation:

I just took th test, and came to confirm the other guys' answers ;)

the radioisotope cobalt-60 is used in cancer therapy. the half-life isotope is 5.27 years. which is equation determines the percent of an initial isotope remaining after t years?

Answers

Answer : The equation determines the percent of an initial isotope remaining after t years is, [tex]\frac{a}{a_o}\times 100=2^{(-\frac{t}{5.27})}[/tex]

Explanation :

Half-life = 5.27 years

Formula used :

[tex]a=\frac{a_o}{2^n}[/tex]        ............(1)

where,

a = amount of reactant left after n-half lives

[tex]a_o[/tex] = Initial amount of the reactant

n = number of half lives

And as we know that,

[tex]n=\frac{t}{t_{1/2}}[/tex]        ..........(2)

where,

t = time

[tex]t_{1/2}[/tex] = half-life  = 5.27 years

Now equating the value of 'n' from (2) to (1), we get:

[tex]a=\frac{a_o}{2^{(\frac{t}{t_{1/2}})}}[/tex]       ...........(3)

[tex]a=\frac{a_o}{2^{(\frac{t}{5.27})}}[/tex]

[tex]\frac{a}{a_o}\times 100=2^{(-\frac{t}{5.27})}[/tex]

Therefore, the equation determines the percent of an initial isotope remaining after t years is, [tex]\frac{a}{a_o}\times 100=2^{(-\frac{t}{5.27})}[/tex]

Final answer:

The equation that determines the percent of an initial isotope remaining after t years is: Percent remaining = (100) x (1/2)^(t/h), where t is the number of years and h is the half-life of the isotope.

Explanation:

The equation that determines the percent of an initial isotope remaining after t years is: Percent remaining = (100) x (1/2)(t/h), where t is the number of years and h is the half-life of the isotope.

For example, for the radioisotope cobalt-60 with a half-life of 5.27 years, you can use the equation Percent remaining = (100) x (1/2)(t/5.27) to determine the percent remaining after t years.

Let's say you want to find the percent remaining after 10 years, you would substitute t with 10 in the equation, like this: Percent remaining = (100) x (1/2)(10/5.27). Simplify the equation to find the answer.

what is the 8th term in the following sequence 28,33,38,43.....

Answers

To solve this, you have to figure out how they created the sequence, i.e., how did they get from 28 to 33 and then from 33 to 38 (etc.). If you subtract 28 from 33 the answer is 5, and the same is true for all the consecutive numbers in the sequence, so you have to add five to 43 to figure out the next term. You already have four terms, so we only need 4 more:
28, 33, 38, 43, 48, 53, 58, 63   63 is the 8th term. 

Luis strength trains two times per week. He uses 12-pound weights and performs three sets of eight repetitions. He wants to improve his frequency. What should he do?

Increase to 10 repetitions.
Increase to 15-pound weights.
Increase to four sets.
Increase to three times per week.

Answers

Increase to 10 repetitions. Increasing repetitions increases the frequency of each period (or set). It will be increased by 2 for every set Luis does. The other choices may increase resistance, or amount of sets done but do not affect frequency.

To improve his frequency in strength training, Luis should increase his strength training days to three times per week. Hence, the correct option is fourth.

Luis wants to improve his frequency in strength training. Since he is already training twice a week, to enhance frequency, he should consider increasing the number of days he strength trains. Therefore, the best option for Luis would be to increase to three times per week. This aligns with the muscle-strengthening activities recommendation which suggests activities should be performed on 2 or more days a week, and this can be increased over time. Luis can also regularly increase the intensity of his workouts by adding more weight or sets, to ensure continuous muscle overload and growth.

Before a renovation, a movie theater had 111 seats. after the renovation, the theater has 144 seats. what is the approximate percentage increase of the number of seats in the theater? if necessary, round to the nearest tenth of a percent.

Answers

Change in number of seats = 144 - 111 = 33

percentage increase = 33/111 x 100 = 29.8% (nearest tenths)

The proportional relationship between the number of pages (p) and the number of hours (h) is represented by the equation . Write the equation in standard form with a constant of proportionality greater than 1.

Answers

I believe the equation would be: p=hx

Answer:

the answer is p=40h, hope this helps!!!

Step-by-step explanation:

A serving of a certain cereal has 8 grams of sugar in 1 portion. Which equation shows how the amount of sugar and the number of portions are related? The s stands for the grams of sugar and the p stands for the portions of cereal.

Answers

I love this kind of problems 
it would be p=1 and s=8 
it helps to keep on going like a chart 
ex: 1/8 2/16 3/24 etc


your gamer unstopableboy21

The equation relating sugar amount and portions in a cereal serving is s = 8p. To find how many servings of cereal are needed to consume a specific amount of sugar, moles are converted to grams, then related to the sugar content per serving.

The equation relating the amount of sugar (s) and number of portions (p) in a serving of cereal is:

s = 8p

To answer the given problem, let's relate moles of sugar to grams and servings. First, we convert moles to grams, then use the sugar content in grams per serving to find the number of servings needed to consume the specified amount of sugar.

5+25+125+625+3125+15625 rewrite each series using sigma notation

Answers

1. You have that the series is: 5+25+125+625+3125+15625
 2. You must find the ratio (r) between the adjacent members. Then, you have:

 25/5=5
 125/25=5
 625/125=5
 3125/625=5
 15625/3125=5

 3. Therefore, the ratio is:

 r=5

 4. Then, each term has te form 5^k. So, you have:

 5^1=5
 5^2=25
 5^3=125
 5^4=625
 5^5=3125
 5^6=15625

 5. As you can see, "k" goes from 1 to 6.

 6. The answer is shown in the image attached.

Final answer:

The series 5+25+125+625+3125+15625 can be rewritten in sigma notation as Σ 5*5^(n-1) from n=1 to 6, representing a geometric series with a common ratio of 5 and 6 terms.

Explanation:

To rewrite the series 5+25+125+625+3125+15625 using sigma notation, we first need to identify the pattern of the series. We notice that each term is 5 times the previous term, which is a characteristic of a geometric series. A geometric series can be expressed in sigma notation as Σ a*r^(n-1) from n=1 to N, where a is the first term, r is the common ratio between terms, and N is the number of terms.

In this series, a = 5, and r = 5. The series has 6 terms, so N = 6. Therefore, the series in sigma notation is Σ 5*5^(n-1) from n=1 to 6.

1. What is the value of w? 7, 3.5, 7(sqrt)of 3, 14

Answers

check the picture below.

The value of w is 14.

What is the value of w?

The image given is a right angled triangle. In order to determine the value of the hypotenuse, w, tan would be used.

Cos 30 = adjacent / hypotenuse

√3 / 2 = 7√3 /  hypotenuse

hypotenuse = 7√3 ÷ √3/2  = 14

To learn more about right angled triangle, please check: https://brainly.com/question/20694080

#SPJ2

Determine 10th term : 5,-25,125

Answers

Every time, the previous term is multiplied by -5. 
Keep doing this until you reach the tenth term. 
You will get -9,765,625. 
Hope this helps!

MEDAL!!!!
A narrator who is not part of the story and only knows particular portion of thoughts and feelings is
A. first person
B. second person
C. third person limited
D. third person omniscient

Answers

I think it would be C. 3rd Person Limited because 1st and 2nd don’t work and omniscient means the narrator knows all of the thoughts/ feelings.
Other Questions
Which of the following terms describes the primary core of a comet? two cards are drawn without replacement from a standard deck of 52 playing cards. find the probability that both are odd numbers (aces are considered odd because they have a value of 1 or 11). 14) Which BEST describes the way the Fourteenth Amendment affected the states?A)States had to give all citizens, regardless of their race or religion, equal protection under the law.B)States could no longer make any laws that were not approved by the federal government.C)States had to pass laws that gave more rights to freed slaves than to other citizens.D)States could no longer institute poll taxes or tests for citizens before they voted.2) The term "Reconstruction" in United States history refers to the period after what event?A)the Civil WarB)the Revolutionary WarC)the Constitutional ConventionD)the Declaration of Independence The major problem with hydrogen as an alternative source of energy is that none exists on the surface of the earth. a. True b. False Analyze the following statement: Marcus notices that he runs faster in the mornings rather than the evenings. Is the statement an example of correlation or causation? A. Correlation, because time of day doesn't cause a person to run faster or slower B. Causation, because Marcus has noticed this over several trials C. No relationship, because time of day has nothing to do with how fast a person runs D.There is not enough information to make a conclusion Which head glands secrete sucrase, lipase, amylase, and invertase? What is the measure of an angle that turns through 3/4 of a complete circle What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatctcatccagcattctgaaagggtaatgaataattattccgctgagttcatgaggtatccgaaggaggagcaacacttaggctataagagtatcatgcacatagatcgggataaatcgcctatcatatgtgacaacaatttcatgattaaaagt code for? Which is a pro-election of federal judges argument?A. When judges are elected they can be biased by party politics. B. When judges are elected there they can focus more time on reviewing law.C. Judges are more accountable to the people and what they think is just when they are elected Which statement displays an effect of developing a successful atomic bomb? Question 11 options: A.encouraged private sector employees to not share their discoveries with the government B.was the final time that the government and private sector combined to form any great invention C.served as a model for future government or private research and development labs to create innovationsD.proved that military innovation is always ahead of private innovation the graph shows the percentage of dog breeds affected by elbow dysplasia, which causes dogs to limp. What???s the most likely explanation for the mixed breed???s disease incidence? The probability is 0.2 that a person shopping at a certain store will What is the differecne of the following polynomials? (6x^2 - 3x^3) - (2x^3 + 4x^2 -5) Congratulations As you know, the position for which you are applying requires superlative problem-solving skills in a variety of arenas, and the ability to think critically on the fly is essential. To evaluate your ability in this area, the practical portion of the interview process consists of a series of locked-room puzzles. You will need to use all of your ingenuity to find the key to unlocking each room. There are six rooms total; four of the rooms will have individual time limits, while the remaining two rooms will be untimed. You will be observed by the interview team from a remote location, and your progress through the rooms will be recorded. For which type of communication would this paragraph be used?A)casual noteB)informal emailC)formal business If 1495 J of heat is needed to raise the temperature of a 337 g sample of a metal from 55.0C to 66.0C, what is the specific heat capacity of the metal? Evaluate the expression when a=15 and b=5. b2 ------------ = a + 5Help Do you think that humans and humpback whales share a common evolutionary lineage? Help Im really stuck and need help fastttttttt!!!!!!!? which is an example of circadian rhythm in plants? Which of the following bodies of water is located between the countries of Malaysia and Indonesia and connects the Pacific Ocean to the east with the Indian Ocean to the west? Bodies of Water in Eastern Asia (Points : 1) The Strait of Sunda The Strait of Malacca The Makassar Strait The Java Sea,