Napoleon Bonaparte's rise to power came as A) an opponent of the Revolution. B) husband of Marie Antoinette. C) after executing Louis XVI. D) a French military hero.

Answers

Answer 1
D. a French Military Hero

Related Questions

What changes occurred in the world at the end of 1980s?

Answers

Final answer:

The world experienced significant changes in the 1980s, including the acceleration of globalization, the end of the Cold War and the dissolution of the Soviet Union, and an oil boom followed by a bust.

Explanation:

In the 1980s, several significant changes occurred in the world. Here are some key changes:

Technology and Globalization: The globalization process accelerated, characterized by increased foreign investment, privatization of state enterprises, and reduced tariffs.The End of the Cold War: The Soviet Union dissolved in 1991, leading to a shift in global power dynamics and the breakdown of communist regimes in Eastern Europe.Oil Boom and Bust: Following the oil crisis in the 1970s, the oil-producing countries experienced an economic boom, but oil prices plummeted in the late 1980s.

Doctors have been looking for a cure for which
disease since 1981

Answers

the disease that was discovered in 1981 and hasnt been cured yet is AIDS

About 4,000 _________ Indians died on the Trail of Tears.
a. Choctaw
b. Creek
c. Comanche
d. Cherokee

Answers

The answer to the question above is D. Cherokee.
About 4,000 Cherokee Indians died on the Trail of Tears after the United States government forced them to relocate out of their lands in Southeastern part of the United States. They were forced out of their lands after United States President Andrew Jackson signed the Indian Removal Act of 1830 to give way for White settlers.
The answer is the Cherokee.

Cesar Chavez's approach to organizing farm workers to demand better working conditions was notable because

Answers

In 1962 Cesar founded the National Farm Workers Association, later to become the United Farm Workers – the UFW. He was joined by Dolores Huerta and the union was born. That same year Richard Chavez designed the UFW Eagle and Cesar chose the black and red colors. Cesar told the story of the birth of the eagle. He asked Richard to design the flag, but Richard could not make an eagle that he liked. Finally he sketched one on a piece of brown wrapping paper. He then squared off the wing edges so that the eagle would be easier for union members to draw on the handmade red flags that would give courage to the farm workers with their own powerful symbol. Cesar made reference to the flag by stating, “A symbol is an important thing. That is why we chose an Aztec eagle. It gives pride . . . When people see it they know it means dignity.”

For a long time in 1962, there were very few union dues paying members. By 1970 the UFW got grape growers to accept union contracts and had effectively organized most of that industry, at one point in time claiming 50,000 dues paying members. The reason was Cesar Chavez’s tireless leadership and nonviolent tactics that included the Delano grape strike, his fasts that focused national attention on farm workers problems, and the 340-mile march from Delano to Sacramento in 1966. The farm workers and supporters carried banners with the black eagle with HUELGA (strike) and VIVA LA CAUSA (Long live our cause). The marchers wanted the state government to pass laws which would permit farm workers to organize into a union and allow collective bargaining agreements. Cesar made people aware of the struggles of farm workers for better pay and safer working conditions. He succeeded through nonviolent tactics (boycotts, pickets, and strikes). Cesar Chavez and the union sought recognition of the importance and dignity of all farm workers.

Answer:

insisted on using nonviolent tactics

Explanation:

How did the ideologies of nationalism contribute to the holocaust?

Answers

An example of ideology is communism and this played a big part in the holocaust because Hitler was a dictator and supported communist.

before World War one, which factor helped transform the united states from an agricultural to an industrial nation?
-Declining financial resources
-a shortage of skilled laborers
-lower production costs
-a lack of new inventions

Answers

bbbbbbbbbbbbbbbbbbbbbbbb

Which writing was influenced by The Odyssey and The Iliad?
-The Trojan War
-Oedipus
-Histories
-The Aeneid

Answers

Answer:

The answer would be The Aeneid.

The answer would be D, the Aeneid

Also thanks to the person who answered before me because I just had this question on my quiz. so thanks!

How did the test offensive affect the perceptions of the Vietnamese war within the United States

Answers

The Tet Offensive of 1968 (as well of US media coverage of the Tet Offensive) had strong negative effect on perceptions of the Vietnam War in the United States.  It became clear to the American public that the US was not making progress in the war, and that the US government had not been honest with the public about US ability to win the war.

Additional explanation:

By 1966, 93% of American households owned a television set. Most Americans now were getting their news from television, and Walter Cronkite was the most trusted anchorman on TV news.  When the North Vietnamese and the Viet Cong launched the Tet Offensive in 1968, Cronkite, known as "the most trusted man in America," offered a television editorial that shaped the nation's mood.  Cronkite said in that broadcast on February 27, 1968:  "It seems now more certain than ever, that the bloody experience of Vietnam is to end in a stalemate. To say that we are closer to victory today is to believe, in the face of the evidence, the optimists who have been wrong in the past.  To say that we are mired in stalemate seems the only realistic, if unsatisfactory conclusion. ...It is increasingly clear to this reporter that the only rational way out then will be to negotiate, not as victors, but as an honorable people who lived up to their pledge to defend democracy, and did the best they could."

In addition to Cronkite's reporting, there were also photo and video images coming from the war front that showed a "credibility gap" between what the US government had been saying about the war and what was actually happening there.

US public perception of the Vietnam War increasingly turned away from support for the war effort.

The Tet Offensive, which took place in 1968 during the Vietnam War, had a profound impact on American public opinion and the perceptions of the war within the United States.

Prior to the Tet Offensive, the Johnson administration had been largely optimistic in its public portrayal of the war effort. American military leaders had spoken of progress and the possibility of seeing "light at the end of the tunnel." However, the scale and surprise of the Tet Offensive, which saw a coordinated series of attacks by North Vietnamese and Viet Cong forces on more than 100 cities and towns in South Vietnam during the Tet holiday, shattered this image of progress.

The offensive was a military failure for the Communist forces in that they did not achieve their objective of sparking a general uprising, nor did they hold any of the targets for an extended period. However, the psychological and political impact on the American public was significant for several reasons:

1. Shock and Contradiction: The American public was shocked by the scope and intensity of the attacks, which contradicted the optimistic assessments they had been receiving from government and military officials.

2. Media Coverage: The extensive media coverage of the Tet Offensive, including the iconic image of the South Vietnamese police chief executing a Viet Cong prisoner, brought the brutality of the war into American living rooms. This led to a loss of confidence in the government's handling of the war.

3. Credibility Gap: The discrepancy between the public's understanding of the war's progress and the reality of the situation led to a "credibility gap." Many Americans felt that they had been misled by their government, which eroded trust in official reports and statements.

4. Public Opinion Turn: Public opinion polls showed a sharp decline in support for the war following the Tet Offensive. The American public began to question the necessity and morality of U.S. involvement in Vietnam.

5. Political Consequences: The offensive contributed to President Lyndon B. Johnson's decision not to seek re-election in 1968. It also influenced the presidential campaign, with the war becoming a central issue.

6. Policy Reassessment: The Tet Offensive forced a reassessment of U.S. policy in Vietnam. It led to a reevaluation of military strategies and contributed to the eventual shift towards "Vietnamization" under President Richard Nixon, which aimed to reduce American troop presence and involvement in the war.In summary, the Tet Offensive significantly affected the perceptions of the Vietnam War within the United States by undermining public confidence in the government's honesty and the war's successful conclusion, leading to increased opposition to the war and a shift in U.S. policy.

Someone who deals with money is called a _____.

Answers

A general term for someone who deals with money is a businessperson, which can be specified further as a manager, accountant, business owner, or entrepreneur. Employees and sellers are also key players in financial transactions. Understanding money as a unit of account is essential for these roles, simplifying trade and value assessment.

Someone who deals with money can have various titles depending on their specific role, but a general term is businessperson. More specific titles include manager, accountant, business owner, or entrepreneur. These individuals must understand the principles of money and banking, as it is crucial for leading successful and fulfilling lives.

In ancient times, such as in Babylon, these roles were also prevalent, with positions like the money-lender and banker mentioned in historical texts like 'Chapter VII. The Money-Lender And Banker'.

Moreover, an employee is someone hired to perform services for another, often dealing with financial compensation such as wages, commissions, or bonuses. On the other hand, a seller is one who provides goods or services in exchange for money, thus participating in the financial aspect of business operations.

In all these roles, money serves critical functions, including being a unit of account, which simplifies trade-offs and transactions in the economy. For instance, an accountant may use money to value their services, like charging $100 to file a tax return, illustrating money's role as a standard measure for trade and value.

By the early 21st Century, most Americans had Internet access through their homes, schools, offices, and/or libraries. What is a major impact the Internet has had on American society?

Answers

People were able to learn more and as a result education was more prized

"what were black codes? describe the purpose of their usage."

Answers

The Black Codes were laws passed by Southern states in 1865 and 1866 in the United States after the American Civil War with the intent and the effect of restricting African Americans' freedom, and of compelling them to work in a labor economy based on low wages or debt.

How did William Penn come in possession of land in the New World? A. The king owed his father money. B. He explored it and claimed it for himself. C. He bought it from the Virginia Company. D. He inherited it from his father.

Answers

I believe it was granted to him by King Charles.

The correct answer to the question is Option A. The king owed his father money.


William Penn's father was Sir William Penn, a wealthy real estate entreprneurs who had made a vast fortune in England.



He was an influential person and close to the King Charles himself. When the King could not repay some of his debts, he gave Sir William Penn a piece of land in the New World. This was done under a Royal Chater in 1681.



His won, William Penn then took advantage of the opportunity and set out to the new world, where he planned and founded Pennsylvania

Which of the following is NOT one of the functions of county governments?

A.

approve/disapprove state sales tax rates

B.

enforce state laws within the county

C.

keep and maintain land records

D.

report local election results to the secretary of state

Answers

A. Approve or disapprove state sales tax rates

Answer:

The correct answer is option A) "approve/disapprove state sales tax rates"

Explanation:

County governements in the USA are part of state goverments and function as local administrative portions.

The functions of counties are related to administrative tasks within their states such as law enforcement, elections administration and administration, property tax collection, amongo others.

Counties, on the other hand, cannot aprove or disapprove state sales tax rates since that function is under state government´s responsibility.

One of the main problems in the Indian reservation system that the government agent

Answers

A main problem is dealt dishonestly with American Indian families.

The nineteenth century was an important time in african history because

Answers

African literature and music began to be recordedSome of the most famous textile and beading objects were created by Africans. The fight against malaria has become more effective thanks to Western explorers.

What is Africa renowned for on a global scale?

Africa is known as the "Mother Continent" since it is the earliest inhabited place on the planet. For almost 5 million years, humans and their ancestors have resided in Africa. The Mediterranean Sea, Red Sea, Indian Ocean, and Atlantic Ocean are all oceans that border Africa, the second-largest continent.

Among the seven continents in the world, Africa is clearly unique. Africa boasts a rich variety of cultures. It has a diverse and rich cultural legacy, abundant natural resources, and breathtaking tourist sites. These fascinating African facts are essential to know.

Learn more about Africa, from:

brainly.com/question/1959687

#SPJ2

What were the two major differences between the Western Empire of Rome and the Eastern Byzantine Empire?

Answers

One of the Major differences was the Language that was spoken... Eastern Rome picked up the Greek Language while the Western side kept the Latin. Additionally Eastern Rome split from Roman Catholicism and practiced orthodox Christianity.  

Under the constitution what happens when conflicts arise between state and federal government?

Answers

The Supremacy Clause and the Doctrine Of Preemption!!!!

When conflicts arise between state and federal government, according to the constitution, the Supremacy Clause and the Doctrine of Preemption come into play. According to the Supremacy Clause, the federal law is the supreme law, so a federal court may order a state to stop a behaviour or resolution that is in conflict or interferes with the interests of the federal law and government. In case of conflict, federal law prevails.

What ethnic tensions did australia canada and new zealand face?

Answers

The indigenous people were all discriminated by the European settlers and had their land taken away.

Which of the following is most representative of the philosophy of the human potential movement?

A. Positive psychology
B. Existentialism
C. Self-actualization
D. Hierarchy of needs

Answers

Answer Is B Existentialism

Answer: Self-actualization is the right answer.

Explanation: The human potential movement is a psychological philosophy that grew out of a humanistic approach which was created by Abraham Maslow. He was the one who gave the concept of self-actualization that is a state when an individual realizes his own talent and potentialities. Thus, self-actualization is most representative of the philosophy of human potential movement.



Gamal Abdel Nasser's great accomplishment was to



bring democracy to Egypt



modernize Egypt



create an Islamic state in Egypt



achieve peace with Israel

Answers

Modernize Egypt

Gamal Abdel Nasser was president of Egypt from 1956 to 1970.  He abolished political parties and created a one-party system, so don't credit him as a democratizer.  He worked to suppress the Muslim Brotherhood and keep Egypt from becoming a religious state.  And he went to war with Israel over the Suez Canal in 1956, and again in the Six Day War of 1967.

Answer:

Modernize Egypt

Explanation:

Organic food in the united states now constitutes how many in percent

Answers

Organic food in the US now constitutes 2 precent of the total food production.

How did the heritage foundation become more than just another Washington “think tank”

Answers

The result, called Mandate for Leadership, epitomized the intellectual ambition of the then-rising conservative movement. Its 20 volumes, totaling more than 3,000 pages, included such proposals as income-tax cuts, inner-city “enterprise zones,” a presidential line-item veto, and a new Air Force bomber.

Despite the publication's academic prose and mind-boggling level of detail, it caused a sensation. A condensed version -- still more than 1,000 pages -- became a paperback bestseller in Washington. The newly elected Ronald Reagan passed out copies at his first Cabinet meeting, and it quickly became his administration’s blueprint. By the end of Reagan’s first year in office, 60 percent of the Mandate’s 2,000 ideas were being implemented, and the Republican Party’s status as a hotbed of intellectual energy was ratified. It was a Democrat, Daniel Patrick Moynihan, who would declare in 1981, “Of a sudden, the GOP has become a party of ideas.”

How was the battle of britian the battle of stalingrad, d day and battle of teh bulge significant to the europeaons during world war two?

Answers

They were all major victories. I think around 90,000 German Tripp’s surrendered at Stalingrad to the soviets. D day itself was a wreck but also a huge victory and the Battle of the Bulge marked the end of the Germany’s last offensive campaign.

3 effects of the French Revolution?

Answers

Long Term Causes. Social and Economic Injustices of the Old Regime. Enlightenment ideas. ... Immediate Causes. Economic crisis-famine and government ideas. Weak leadership. ... Immediate Effects. End of the old regime. Execution of monarchy. ... Long-term effects. Conservative reaction. A decline in French power.
Final answer:

The French Revolution ended the absolute monarchy, initiated the rise of republicanism, and dismantled the traditional social hierarchy. It spurred the development of nation-states due to a surge in nationalism. Additionally, it impacted global politics by influencing political systems and inspiring revolutions in other nations.

Explanation:

Effects of the French Revolution

The French Revolution had several profound effects on Europe and the world. First, it signalled the end of absolute monarchy and paved the way for the rise of republicanism and democratic ideals. The traditional hierarchy and privileges associated with the aristocracy were dismantled, leading to a new social order where birthright was less determinant of one's status. Likewise, the revolution led to the initiation of modern nation-states in Europe, as it inspired a surge of nationalism and the redrawing of political borders, particularly during the subsequent Napoleonic Wars. Finally, the revolution affected the global political climate, influencing political systems, including the evolution of the American political system, and lighting the fire of revolutionary fervor in other parts of the world.

End of Aristocratic Privilege

The revolution destroyed the age-old social hierarchy that had privileged the European aristocracy for centuries. By questioning the divine right of kings and the inherent power of the nobility, the revolution prompted a shift towards a society where merit and talent could define one's position.

Rise of Nationalism

As the revolution spread and Napoleon's armies carried its ideals across Europe, it inspired the rise of nationalism, with people beginning to identify themselves by their nation rather than their locality or monarchy. This nationalistic sentiment eventually contributed to the consolidation and formation of modern nation-states.

Influence on Global Politics

The shockwaves of the French Revolution were felt worldwide, deeply influencing political discourse and inciting other revolutions. The American political system, for example, absorbed democratic principles that emerged from France and reevaluated its own governance in light of those ideas.

Which area on the map represents the area known as ground zero in world war ii?

Answers

The answer to the question is 4

The answer has to be 4

How did florence's wealth contribute to its cultural activity?

Answers

Florence had amassed huge wealth because of their famous bankers who gained power. These bankers and politicians, most notably the Medici family, used their wealth to pay for commissions from famous artists of the time which enriched the society. This is one of the reasons why the renaissance began in Italy.
Final answer:

Florence's wealth from textile industry and banking significantly contributed to its cultural activities, enabling patronage of the arts by families like the Medici and nurturing a climate in which the Renaissance could flourish. This investment supported pioneering artists and the development of new artistic techniques, making Florence a key center of Western art and thought.

Explanation:

The wealth accumulated in Florence, primarily through the lucrative woolen textile industry and banking, played a pivotal role in the cultural activities and the advent of the Renaissance in the city. Prominent Florentine families like the Medici used their vast fortunes not only for political influence but also to patronize the arts, commissioning works from celebrated artists like Leonardo da Vinci, Sandro Botticelli, and Michelangelo Buonarroti.

This investment in art and architecture was an expression of the city’s prosperity and a display of civic pride, fuelling an unprecedented period of creativity and intellectual achievement that defined the Renaissance.

Furthermore, the emergence of a wealthy and influential merchant class contributed to Florence becoming a major mercantile center in the 15th century. This economic prosperity, combined with the humanistic ideals of the time, fostered a climate where art and culture could thrive. Artists and intellectuals were supported by patrons who valued the pleasures of life and aimed to leave a legacy that would adorn the city and symbolize its cultural and economic vitality.

Florence's affluence not only fostered a vibrant cultural scene but also facilitated the development of new techniques and artistic expressions. The city’s wealth provided the means for the luxurious patronage that financed the Renaissance's most iconic works, turning Florence into the cradle of modern Western art and tho

_______ was accidentally given a boost with the prohibition of alcohol.

Answers

organized crime
Organized crime was accidentally given a boost by prohibition of alcohol because people who initially relied on liqueur sales to make a living found it easier to engage in gangster activities to make a living.

The options of the question are A) Foreign war. B) Poverty. C) Organized crime. D) Alcoholism.

The correct answer is Organized crime.

Organized Crime was accidentally given a boost with the prohibition of alcohol.

The prohibition of Alcohol that started in 1920 had significant consequences in the spread of crime, violence and the contraband of liquor. Illegal trade was the common activity of Gangsters like Al Capone. Cities such as Los Angeles, Chicago, and New York had territories controlled by Gangsters who traded illegally alcohol and generated violence on the streets. Police struggled to combat Gangsters.  


The senate watergate committee of 1973 is an example of a ________ committee.
a. conference
b. joint
c. standing
d. select

Answers

The Senate Watergate was a Select Committee.

Final answer:

The Senate Watergate Committee of 1973 was a select committee established for the specific purpose of investigating the Watergate scandal; it was not a permanent body like a standing committee.

Explanation:

The Senate Watergate Committee of 1973 is an example of a select committee. Unlike a standing committee, which is permanent and has jurisdiction over a specific area, a select committee is established for a specific, temporary purpose. The Watergate Committee was created to investigate the Watergate scandal, which was outside the scope of the permanent committees. Standing committees deal with legislative proposals and other routine matters, while select committees are often used for special investigations or to address urgent matters outside the scope of existing committees.

The answer to the given question is d. select. According to provided information, a select committee is convened for a specific and temporary purpose, whereas a standing committee is a permanent structure with ongoing responsibilities. Therefore, the Watergate Committee, convened to investigate a unique and time-sensitive issue, fits the definition of a select committee.

This graph shows a supply curve. What happens when the price of a good increases? The quantity of goods that are produced increases. The producer of the good is certain to make less money. The quantity of goods that are produced decreases. The quantity of goods that are produced stays about the same.

Answers

A. The Quantity of Goods that are produced Increases.

The quantity of goods produced increases.

The economy is governed by the Law of Supply and Demand. The supply curve and the demand curve interact according to the price of the good. From the perspective of the consumer, it is interesting to pay a lower price for a larger quantity of the product. On the supply side, the opposite occurs. The producers have a stimulus to produce more when the price increases, because the possibility of profit is greater. This is described in the first alternative.

What was the major disagreement between the united states and the soviet union at the conclusion of world war ii?

Answers

The conflict was based on ideology. The Soviet Union wanted to spread communism. The United States was opposed to the spread of communism. This resulted in the Cold War which was basically a state of geopolitical tension between powers in the Eastern Bloc (the Soviet Union and its satellite states) and powers in the Western Bloc

Other Questions
The Silk Road was discovered by __________. A. Marco Polo B. Genghis Khan C. General Zhang Qian D. Kublai Khan Calcium carbonate reacts with hydrobromic acid to form calcium bromide, carbon dioxide, and water according to the reaction below. what is the molarity of the hydrobromic acid if 250.0 ml of it reacts with 5.64 grams of calcium carbonate? Explain why the equation (x-4)^2-10=15 has two solutions. Then solve the equation to find the solutions. Please show all your work! (30 points) A standard number cube with the numbers 1 through 6 is rolled. Find the probability of rolling a number greater than 5 .1. 1 / 62. 1 / 33. 1 / 44. 2 / 3 If a = 0.3 with a line over 3 and b = 0.5 with a line over 5, what is the value of a + b?8/108/988/10080/99 75 points Write and solve an equation to find the measure of NEP. Make sure you show all work. A ladder leans against a building. The angle of elevation of the ladder is 70. The top of the ladder is 25 ft from the ground. To the nearest tenth of a foot, how far from the building is the base of the ladder?20.5 ft30.5 ft32.3 ft39.5 ft Three positions of praying mentioned in the Old Testament are:kneeling and sittingkneeling, standing, and falling face downstanding and sittingkneeling, sitting, and lying on one's side Andrew drove 55 mph on his trip. Which of the following equations best represents the distance he drove if x stands for the number of hours? Two people start walking at the same time in the same direction. One person walks at 8 mph and the other person walks at 2 mph. In how many hours will they be 4.5 miles apart? Rowland and molina's work showed that ultraviolet light in the stratosphere causes cfcs to release ________ atoms. Why is this cover letter inappropriate? Genetic disorders caused by multiple genes interacting with the environment are called Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? view available hint(s) where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? it would not bind the target dna. ttttagccatttacgattaatcg ttttagccatttacgattaatcg ttttagccatttacgattaatcg? Find the product.y 4 y 6 Identify a management practice most conducive to the traditional personality. Use the net to find the approximate surface area of the cylinder to the nearest square meter Harry is a healthy man who is 30 years of age. using this information, calculate his approximate target heart rate zone for moderate-intensity physical activity. Speciation may occur when two populations become reproductively isolated from each other Polands energy resources can be described as _____. a. based on large deposits of coal b. rich in petroleum c. large deposits of sulfur d. large deposits of copper