Round 503.782 to the nearest tenth

Answers

Answer 1

The value 503.782 to the nearest tenth is 503.8

Rounding up to the nearest tenth means we want only a digit to be placed after the decimal point.

Given the value 503.782, this value to the nearest tenth will be 503.8.

Note that 1 was added to the value "7" after the decimal point. This was because the adjacent value "8" is more than 4.

Hence the value 503.782 to the nearest tenth is 503.8

Learn more here: https://brainly.com/question/21028116

Answer 2

Final answer:

To round 503.782 to the nearest tenth, the digit in the hundredths place is 8, which is greater than or equal to 5. Therefore, the rounded number is 503.8.

Explanation:

To adjust 503.782 to the closest 10th, we really want to take a gander at the digit in the hundredths place, which is the second digit after the decimal point. It is 7 in this instance.

Since 7 is more prominent than or equivalent to 5, we gather together the digit in the tenths place, which is the primary digit after the decimal point. For this situation, it is 8.

Therefore, 503.8 is obtained by rounding 503.782 to the nearest tenth.

To round 503.782 to the nearest tenth, we look at the digit in the hundredths place, which is 8. Since 8 is greater than or equal to 5, we round up. Therefore, the rounded number is 503.8.


Related Questions

| n+2 | = 7 absolute value

Answers

Answer:

Step-by-step explanation:

| n+2 | = 7    : n+2 = 7   or  n+2 = -7

n=5  or n = - 9

The length of a rectangular frame is represented by the expression 2x+4 and the width of the rectangular frame is represented by the expression 2x+10. Write an equation to solve for the width of a rectangular frame that has a total area of 120 square inches
2x^2+20x-80=0
4x^2+28x+40=0
4x^2+28x-80=0
x^2+8x+20=0​

Answers

Answer:

4x^2 + 28x - 80=0

Step-by-step explanation:

(2x+4)(2x+10) = 120

1. Use FOIL (Distribute):

4x^2 + 20x +8x + 40 = 120

2. Group like terms:

4x^2 + 28x+ 40 = 120

3. Subtract 120 from both sides:

4x^2 + 28x - 80 = 0

Answer:

Option 3 - [tex]4x^2+28x-80=0[/tex]

Step-by-step explanation:

We have given,

The length of a rectangular frame is represented by the expression L=2x+4.

The width of the rectangular frame is represented by the expression B=2x+10.

The total area of a rectangular frame is A=120 square inches.

To find : Write an equation to solve for the width of a rectangular frame ?

Solution :

The area of the rectangle is given by,

[tex]\text{Area}=\text{Length}\times \text{Breadth}[/tex]

Substitute the values,

[tex]120=(2x+4)\times(2x+10)[/tex]

[tex]120=4x^2+20x+8x+40[/tex]

[tex]4x^2+28x+40-120=0[/tex]

[tex]4x^2+28x-80=0[/tex]

The required equation is [tex]4x^2+28x-80=0[/tex]

Therefore, option 3 is correct.

HELP HELP HELP PLEASE ASAP

Answers

Answer:

Its Brand 2 :) also do you do connexus?

if so whats ur name :)

Step-by-step explanation:

Answer:

brand 4

Step-by-step explanation:

I really don't know if I'm doing this right and I have a test coming up (I only need the answer for the odds)

Answers

Answer:

all work is shown and pictured

Write 454.12kg with 3 significant

Answers

Answer:  454

Step-by-step explanation:

The first three digits will be the significant digits.  Round the third digit.

454.12

the digit and the 4 is 1 so 454.12 is rounded to 454

A train leaves the station at 6 pm traveling west at 80 mph. On a parallel track, a second train leaves the station 3 hours later traveling west at 100 mph. At what time will the second train catch up with the first?

Answers

Answer:

Step-by-step explanation:

Start train 1 at 6 pm an train 2 at 9pm

there are 52 legs and they all belong to hamsters.how many hamsters are there​

Answers

There are 52 legs and they all belong to hamsters. so 13 Hamsters are there​.

Are hamsters a good pet?Hamsters are rodents from the subfamily Cricetinae, which includes 19 species divided into seven genera. They have established themselves as popular tiny pets. The golden or Syrian hamster is the most well-known species of hamster and is the variety most usually kept as a pet.Hamsters are terrific pets for many people. They don't take much attention, receive adequate exercise when running on their wheel, and are attractive, cuddly, and enjoyable to hold. Some children may find them to be a good first pet. Hamsters, however, do not come with care instructions.

Total No. of legs = 52

Each hamsters have 4 legs.

No. of Hamster = 52/4 =13 Hamsters

To learn more about Hamster refer,

https://brainly.com/question/28474669

#SPJ2

What is the probability of rolling a 6-sided die and getting a 4 or a number
divisible by 3?

Answers

Event A = rolling a 4 on a single die

Event B = rolling a number divisible by 3 (3 or 6) on a single die

There are three outcomes possible in total if either event A happens or event B happens. This is out of six outcomes total.

Divide the values and reduce: 3/6 = 1/2

Final Answer: 1/2

Henry can write 5 pages of his novel in 3 hours. At this rate, how many pages can Henry write in 8 hours?

Answers

Final answer:

Given that Henry can write 5 pages in 3 hours, his rate is 5/3 pages per hour. Multiplying this rate by 8 hours, we get approximately 13.33 pages. Therefore, Henry can write approximately 13 to 14 pages in 8 hours at the given rate.

Explanation:

The subject of this question is mathematics, specifically, it is dealing with the concept of rates. Given that Henry can write 5 pages in 3 hours, we can set up a rate, which is simply a ratio that compares quantities in different units. So, Henry's rate of writing is 5/3 pages per hour.

To find out how many pages Henry can write in 8 hours at this rate, we multiply his rate (5/3) by the number of hours (8 hours). So, (5/3) x 8 = 40/3 = 13.33. However, since we cannot have a fraction of a page, we can round this to 13 pages for a conservative estimate or to 14 pages for a liberal estimate.

So, at the rate given, Henry can write approximately 13 to 14 pages in 8 hours.

Learn more about Rate Problem here:

https://brainly.com/question/29624094

#SPJ12

Final answer:

Henry can write approximately 13.33 pages in 8 hours.

Explanation:

To find out how many pages Henry can write in 8 hours, we can set up a proportion using the given information.

Since Henry can write 5 pages in 3 hours, we can write the proportion as 5/3 = x/8.

To solve for x, we can cross multiply and then divide to find that x = 40/3.

So, Henry can write approximately 13.33 pages in 8 hours.

Learn more about Proportions here:

https://brainly.com/question/34018947

#SPJ12

assume that an avarage cell has a diameter of 7 micrometers (7x10^10 meter) which means it has a volume of 200 cubic micrometers. How many cells are ther in a cubic centimeter

Answers

Answer:

5x10⁸

Step-by-step explanation:

Cell = 200 cubic micrometers.

Te question is, how many 200 cubic micrometers are there in a cubic centimeter. 1st, we have to convert 200 cubic centimeter into cubic centimeter:

1cm = 1x10⁴micro, which is the same to:

1x10⁻⁴ cm = 1micro

Now, we have to cube both sides, to "equal the volumes"

(1x10⁻⁴cm)³ = (1micro)³

1x10⁻¹²cm = 1micro³

Multiple both sides by 200:

200 x 1x10⁻¹²cm = 1micro³ x 200

2x10⁻¹⁰cm³ = 200micro³

Finally, 1 cubic cm / 2x10⁻¹⁰cm³ = 5x10⁸

Final answer:

Explaining the number of cells in a cubic centimeter based on the volume of a 10 μm cell.

Explanation:

For a 10 μm cell:

Calculate the volume: V = (4/3)πr³

Convert diameter to radius: r = 5 μm

Substitute and calculate volume: V = (4/3)π(5)³ = 524 μm³

Convert to cubic centimeters: 1 μm³ = 10^-9 cm³, so 524 μm³ = 5.24 x 10^-7 cm³

Calculate the number of cells in 1 cm³: 1 cm³ / 5.24 x 10^-7 cm³ = 1.91 x 10^6 cells

When is a linear model not a good fit for a set of data?


When there is not a constant rate of change.


When each input value has only one output value.


When the data set does not go through the origin.


When the data set does not increase.
ANSWER: when there is not a constant rate of change

Answers

Answer:

When there is not a constant rate of change

Step-by-step explanation:

A linear model shows a continuous response variable as a function of one or more predictor variables.

A linear model is a good fit for a set of data when the plotted points show a constant rate of change.

When a plot of values form a scatter plot, it is difficult to identify a linear model because the points will not appear to follow a trend.

To come up with a linear function in this case will require you to identify the line of best fit then extending the line to y-axis intercept so as to be able to find the slope.

When members of the military are in a combat​ zone, they often eat​ meals-ready-to-eat (MREs). A typical MRE contains 1 comma 600 calories. If the average soldier eats 3 MREs per day and is deployed for 12 ​months, approximately how many calories will be consumed by a 37​-member platoon of​ soldiers?

Answers

The number of calories by a 37​-member platoon of​ soldiers will be 6,48,24000 calories.

What are calories?

A calorie is a unit of energy. Energy is defined as the capacity to do work.

Now it is given that,

Calories contain in 1 MRE = 1,600

Number of MREs taken by a soldier per day = 3

Therefore, number of calories taken by soldier per day = 3*1600

                                                                                            = 4800 calories

Therefore, number of calories taken by 37 soldier per day = 37*4800

                                                                                           = 1,77,600 calories

Now since, 12 months = 365 days

Number of calories taken by 37 soldier in 12 months = 365*1,77,600

Number of calories taken by 37 soldier in 12 months =6,48,24000 calories.

Hence,The number of calories by a 37​-member platoon of​ soldiers will be 6,48,24000 calories.

To learn more about calories :

https://brainly.com/question/17924093

#SPJ2

5. Write the phrase as an algebraic expression.

6 less than a number times 11

@ 6y - 11y © 11y - 6

6 11=Y

11+ y

Answers

6 less than a number times 11 is:

11x-6
11a-6 is the answer

For which of the following equations is (-4,-3) not a solution?

A.) 5x+2y=-26
B.) y=1+x
C.) 2y-3x=6
D.) -3x=4y

Answers

Answer:

D.) -3x = 4y

Step-by-step explanation:

[tex] -3(-4) ≠ 4(-3) \\ \\ 12 ≠ -12[/tex]

I am joyous to assist you anytime.

Final answer:

The point (-4,-3) is not a solution to both Equation C: 2y-3x=6 and Equation D: -3x=4y. This is determined by substituting x with -4 and y with -3 in each equation and checking if the equation is balanced.

Explanation:

To find which equation (-4,-3) is not a solution to, we substitute x with -4 and y with -3 into each equation, then see if both sides of the equation are equal.

For equation A: 5(-4) + 2(-3) equals -20 - 6, which is -26. So, (-4,-3) is a solution to this equation.For equation B: -3 equals 1 + (-4), which is -3. So, (-4,-3) is also a solution to this equation.For equation C: 2(-3) - 3(-4) equals -6 + 12, which equals 6. This equation does not equal 6. Therefore (-4,-3) is not a solution to this equation. For equation D: -3 equals 4*(-4), which is -16. This equation does not equal -16. So, (-4,-3) is also not a solution to this equation.

So, (-4,-3) is not a solution to both Equation C: 2y-3x=6 and Equation D: -3x=4y.

Learn more about Solving equations here:

https://brainly.com/question/18322830

#SPJ2

Slope intercept form of y=3x+4 passing through (0,9)

Answers

Answer:

y = 3x + 9

Step-by-step explanation:

9 = 3[0] + b

0

9 = b

y = 3x + 9

This would be considered a parallel line, so 3 remains the way it is.

I am joyous to assist you anytime.

A circle passes through points A(7,4), B(10,6), C(12,3). Show that AC must be the diameter of the circle.

I've spent ages on this question and I still can't get it... ​

Answers

so we have three points, A, B and C, if indeed AC is the diameter of the circle, then half the distance of AC is its radius, and the midpoint of AC is the center of the circle, morever, since B is also on the circle, the distance from B to the center must be the same radius distance.

in short, half the distance of AC must be equals to the distance of B to the midpoint of AC, if indeed AC is the diameter.

[tex]\bf ~~~~~~~~~~~~\textit{middle point of 2 points } \\\\ A(\stackrel{x_1}{7}~,~\stackrel{y_1}{4})\qquad C(\stackrel{x_2}{12}~,~\stackrel{y_2}{3}) \qquad \left(\cfrac{ x_2 + x_1}{2}~~~ ,~~~ \cfrac{ y_2 + y_1}{2} \right) \\\\\\ \left( \cfrac{12+7}{2}~~,~~\cfrac{3+4}{2} \right)\implies \left( \cfrac{19}{2}~~,~~\cfrac{7}{2} \right)=M\impliedby \textit{center of the circle}[/tex]

now, let's check the distance from say A to the center, and check the distance of B to the center, if it's indeed the center, they'll be the same and thus AC its diameter.

[tex]\bf ~~~~~~~~~~~~\textit{distance between 2 points} \\\\ A(\stackrel{x_1}{7}~,~\stackrel{y_1}{4})\qquad M(\stackrel{x_2}{\frac{19}{2}}~,~\stackrel{y_2}{\frac{7}{2}})\qquad \qquad d = \sqrt{( x_2- x_1)^2 + ( y_2- y_1)^2} \\\\\\ AM=\sqrt{\left( \frac{19}{2}-7 \right)^2+\left( \frac{7}{2}-4 \right)^2} \\\\\\ AM=\sqrt{\left( \frac{5}{2}\right)^2+\left( -\frac{1}{2} \right)^2}\implies \boxed{AM\approx 2.549509756796392} \\\\[-0.35em] ~\dotfill[/tex]

[tex]\bf ~~~~~~~~~~~~\textit{distance between 2 points} \\\\ B(\stackrel{x_1}{10}~,~\stackrel{y_1}{6})\qquad M(\stackrel{x_2}{\frac{19}{2}}~,~\stackrel{y_2}{\frac{7}{2}}) \\\\\\ BM=\sqrt{\left( \frac{19}{2}-10 \right)^2+\left( \frac{7}{2}-6 \right)^2} \\\\\\ BM=\sqrt{\left( -\frac{1}{2}\right)^2+\left( -\frac{5}{2} \right)^2}\implies \boxed{BM\approx 2.549509756796392}[/tex]

AC must be the diameter of the circle.

What is Circle?

A circle is a closed two dimensional figure in which the set of all the points in the plane is equidistance from a center.

Given that;

A circle passes through points A(7, 4), B(10, 6), C(12, 3).

Now,

If AC is diameter of the circle then half the distance of AC is its radius and midpoint of AC is the center of the circle.

Since, B is also on the circle , then distance from B to the center must be same radius distance.

Midpoint of AC is calculated as;

= (7 + 12 / 2 , 4 + 3/2)

= (19/2 , 7/2)

= (9.5 , 3.5)

Now, Distance from A to the center and check the distance of B to the center as;

AM = √(9.5 - 7)² + (3.5 - 4)²

AM = 2.5495

And,

BM = √(9.5 - 7)² + (3.5 - 6)²

BM = 2.5495

So,  Distance from A to the center and the distance of B to the center is same.

Thus, AC must be the diameter of the circle.

Learn more about the circle visit:

https://brainly.com/question/25927269

#SPJ2

Two coins are tossed simultaneously,Find the probability of getting.1.atleast one head.2.at most one tail​

Answers

If two coins are tossed simultaneously, you will have one of the possible results

[tex]HH,\ HT,\ TH,\ TT[/tex]

with probability 1/4 each.

So, you'll have at least one head if you have HH, HT or TH, i.e. with probability 3/4.

Similarly, you have at most one tail if you get HH, HT or TH, so the probability will be the same.

In fact, both claims (at least one head and at most one tail) are verified by the same set of outputs HH, TH, HT, since they're not satisfied only by the output HH.

So, if those claims are not satisfied with probability 1/4, they're satisfied with probability 3/4.

Final answer:

The probability of getting at least one head when tossing two coins is 0.75.

When two coins are tossed simultaneously, the sample space consists of the following possible outcomes: {HH, HT, TH, TT}. To find the probability of getting at least one head, we can count the favorable outcomes which include at least one head: these are HH, HT, and TH. Thus, there are 3 favorable outcomes.

The total number of possible outcomes is 4. Therefore, the probability is 3 out of 4, or
0.75.

To find the probability of getting at most one tail, we consider the favorable outcomes: these are HH, HT, and TH. Again, we can see there are 3 favorable outcomes.

Since the total number of outcomes is the same, the probability remains
0.75.

Multiplier of 5/7=30/42

Answers

Answer:

6

Step-by-step explanation:

5*6=30

7*6=42

Hey!

---------------------

Solution:

30 / 5 = 6

42 / 7 = 6

5 x 6 = 30

7 x 6 = 42

---------------------

Answer:

Multiplier is 6!

---------------------

Hope This Helped! Good Luck!

3 thousand divided 10 in unit and standard form

Answers

Answer:

300

Step-by-step explanation:

Divide 3000 by 10 by striking out each zero one-by-one [300 ÷ 1] to get 300. This is one of the fastest ways to solve with zeros.

I am joyous to assist you anytime.

The result would be 300 units and 320 units respectively.

3 thousand divided by 10 in unit and standard form:

To divide 3,000 by 10 in unit form: 3,000 ÷ 10 = 300 units.

To divide 3,000 by 10 in standard form: 3.2 × 10³ ÷ 10¹ = 3.2 × 10² = 320 units.

A taxi cab charges $1.75 for the flat fee and $0.25 for each mile. Write an in equality to determine how many miles Eddie can travel if he has $15 to spend.

Answers

Answer:

.25x+1.75=15 and x=53

Step-by-step explanation:

first subtract 1.75 from both sides

then divide by .25 on both sides

and you will get x=53

A triangle has one side that is 5 inches long and the other two sides are both of length x. Write an expression for the perimeter of the triangle in terms of x and then use the expression to find the perimeter when x=10.

Answers

Let P = perimeter

P = 3x + 5

Let x = 10

P = 3(10) + 5

P = 30 + 5

P = 35

What is the domain of f(x)= x-4/square root x

Answers

Answer:

Step-by-step explanation:

f(x)= x-4/√x

f  exist for : x  >  0

so the domain is : D= ]0 ; + ∞[

Write 19h15min into a fraction

Answers

Answer:

19 1/4 hours

Step-by-step explanation:

19 h 15 min = 19 hours + 15 minutes

                   = 19  hours + (15/60)  hours

                   = 19 + 1/4

                   = 19 1/4 hours

The book display has 8 histories, 12 biographies, and 24 novels. Write the ratio of biographies to histories.

Answers

Answer:

12:8

Step-by-step explanation:

Final answer:

The ratio of biographies to histories is 1.5, or more simply as a whole number ratio, 3:2. This means that for every 3 biographies, there are 2 history books.

Explanation:

The question wants us to calculate the ratio of the number of biographies to the number of histories in the book display. To do this, simply divide the number of biographies by the number of histories. The problem provides the number of biographies as 12 and the number of histories as 8. Thus, the ratio is: 12 (biographies) / 8 (histories) = 1.5.

In other words, for every 1.5 biographies, there is 1 history book on the display. However, since ratios are commonly expressed as whole numbers, we can multiply both sides by 2 to get the ratio as 3:2, meaning for every 3 biographies, there are 2 history books. This provides a cleaner and more interpretable ratio.

Learn more about Ratios here:

https://brainly.com/question/32531170

#SPJ2

change 0.72 to a percent

Answers

multiply 0.75 by 100

75 %
0.72 x 100% = 72%
Answer: 72%

-50-2 - 8m) = 10 + 5m

Answers

Answer:

-4 10/13

Step-by-step explanation:

-52-8m = 10 + 5m

-8m = 62 +5m

-13m = 62

-m = 62/13

m = - 62/13

m = -4 10/13

A bakery sold 16 apple pie on Saturday they sold 4 more apple pies on Sunday than they did on Saturday how many apple pies did they sell on Sunday

Answers

Answer:

20 apple pies

Step-by-step explanation:

On Saturday they sold 16, while on Sunday they sold 4 more.

16+4 = 20.

20 apple pies.

what is the substitution of 7+3x=1???​

Answers

Answer:x= -2

Step-by-step explanation:

You want to subtract 7 from both sides so it will be
7+3x=1
-7. -7
Then you get 3x= -6
Now you divide it by 3. So you would end up with x= -2

this is really hard and I need help

Answers

Answer:

No solution

Step-by-step explanation:

Subtract 5k from both sides

Simplify

No solution

Given f(x) and g(x) = f(k⋅x), use the graph to determine the value of k.


A. 5
B. [tex]\frac{1}{5}[/tex]
C. -[tex]\frac{1}{5}[/tex]
D. -5

Answers

Answer:

Option A k=5

Step-by-step explanation:

step 1

Find the equation of f(x)

we have the points

(-10,-6) and (0,4)

Find the slope m

[tex]m=(4+6)/(0+10)=1[/tex]

The function in slope intercept form is equal to

[tex]f(x)=mx+b[/tex]

we have

[tex]m=1[/tex]

[tex]b=4[/tex] -----> the point (0,4) is the y-intercept

substitute

[tex]f(x)=x+4[/tex]

step 2

Find the equation of g(x)

we have the points

(-2,-6) and (0,4)

Find the slope m

[tex]m=(4+6)/(0+2)=5[/tex]

The function in slope intercept form is equal to

[tex]g(x)=mx+b[/tex]

we have

[tex]m=5[/tex]

[tex]b=4[/tex] -----> the point (0,4) is the y-intercept

substitute

[tex]g(x)=5x+4[/tex]

step 3

Find the value of k

we have

[tex]f(x)=x+4[/tex]

[tex]g(x)=5x+4[/tex] -----> equation A

[tex]g(x)=f(kx)[/tex] -----> equation B

[tex]f(kx)=kx+4[/tex] ----> equation C

substitute equation A and equation C in equation B and solve for k

[tex]kx+4=5x+4[/tex]

[tex]kx-5x=0\\kx=5x\\k=5[/tex]

Final answer:

The value of k in the equation g(x) = f(k*x), where g(x) and f(x) are graphs, signifies a horizontal compression, expansion, or reflection of the f(x) graph. It depends on the given graph to determine the exact value of k.

Explanation:

Without the graphical representation, it's difficult to provide a definite value for k. However, understanding the relationship between f(x) and g(x) can help us make an educated guess. If g(x) is a horizontal compression of f(x) by a factor of k, then k is positive and larger than 1. If g(x) is a horizontal expansion of f(x), then k is positive and less than 1. If g(x) is a reflection of f(x) across the y-axis and has a horizontal compression or expansion, then k is negative. For example, if g(x) completes one cycle in a space where f(x) would complete 5 cycles, then k is 5. If g(x) completes 5 cycles in a space where f(x) would complete one cycle, then k equals 1/5.

Learn more about Function Transformation here:

https://brainly.com/question/26896273

#SPJ3

Other Questions
Paraphrase this text from the Ellis Island site. "Ellis Island doctors were particularly watching for signs of contagious diseases. Incurable diseases included trachoma and tuberculosis and guaranteed a return trip to where the immigrant came from." What prompted the formation of the Tertium Quids in 1808? a. Jefferson's desire to buy West Florida. b. Jefferson's opposition to the Embargo Act. c. Napoleon's attack on American shipping. d. The Federalists clamoring for war with England. to create a formula in______, you would first click in one of the cells Dr. Han is studying which brain structure is associated with aggressive behavior among rats. Which part of the brain is she likely to see activated when using neuroimaging techniques? Please i need big helpChoose the adjective clause in the following sentence: The jeans that I want to buy are very expensive.to buyare very expensivethe jeans thatthat I want to buyI want True or false tasks are required activities that need to take place in order to complete a goal Two train whistles have identical frequencies of 175 Hz. When one train is at rest in the station and the other is moving nearby, a commuter standing on the station platform hears beats with a frequency of 4.05 beats/s when the whistles operate together. What are the two possible speeds and directions the moving train can have? slower speed m/s Correct: Your answer is correct. faster speed m/s Changed: Your submitted answer was incorrect. Your current answer has not been submitted. The processivity of a DNA polymerase depends on all of the following actions, EXCEPT for __________. A. association of the DNA polymerase with a sliding clamp (like eukaryotic PCNA) B. interaction between the thumb domain of DNA polymerase and the DNA C. interaction between the minor groove of DNA and the palm domain of the DNA polymerase D. loss of the hydrogen from the 3-OH of the primer due to interaction with a divalent metal ion associated with the palm domain of the DNA polymerase the romans introduced and estabished a common system of written laws why was that important The economy of early villages and cities was based mainly on What is the solution to 4x+5y=12x6y=22 Edouard Daladier became Prime Minister of which country in 1933? A __________ is a wide-mouthed body of water close to shore. Cusic Industries had the following operating results for 2019: sales = $34,621; cost of goods sold = $24,359; depreciation expense = $6,027; interest expense = $2,725; dividends paid = $2,023. At the beginning of the year, net fixed assets were $19,970, current assets were $7,075, and current liabilities were $4,010. At the end of the year, net fixed assets were $24,529, current assets were $8,702, and current liabilities were $4,700. The tax rate was 25 percent. a. What is net income for 2019? (Do not round intermediate calculations.) b. What is the operating cash flow for 2019? (Do not round intermediate calculations.) c. What is the cash flow from assets for 2019? (A negative answer should be indicated by a minus sign. Do not round intermediate calculations.) d-1. If no new debt was issued during the year, what is the cash flow to creditors? (Do not round intermediate calculations.) d-2. If no new debt was issued during the year, what is the cash flow to stockholders? (A negative answer should be indicated by a minus sign. Do not round intermediate calculations.) Evaluate M2/P2 for M = 10, N = -5, and P = -2? A.-5 B.5 C.-25 D.25 Read the sentences. Sentence 1: I hope the dinner comes out perfectly, but even if it doesnt, Im pretty sure theyll know how hard I tried. Sentence 2: Then well have coffee cake for dessert, which I made from scratch. Sentence 3: I am making my sisters favorite: roasted chicken, brown rice, and brussels sprouts. Sentence 4: I cannot wait to cook dinner for my family tonight. What is the most logical sequence for these sentences in a story? 1, 3, 2, 4 4, 1, 3, 2 4, 3, 2, 1 3, 2, 1, 4 An RNA virus that infects plant cells is copied into a DNA molecule after it enters the plant cell. What would be the sequence of bases in the first strand of DNA made complementary to the section of viral RNA shown here? 5' CCCUUGGAACUACAAAGCCGAGAUUAA 3' Reasoning if you multiply two decimals that are less than 1,can you predict whether the product will be less thanor greater than either of the factors? Explain What is the greatest common factor of 19 and 18? What happened as a result of the Sand Creek Massacre?