Shavon is going to wrap a box that is shaped like a rectangular prism. The box is 12 inches long, 8 inches wide, and 3 inches high. What is the least amount of wrapping paper that Shavon will need to completely cover the Box?

Shavon Is Going To Wrap A Box That Is Shaped Like A Rectangular Prism. The Box Is 12 Inches Long, 8 Inches

Answers

Answer 1

It is given in the question that , the box is 12 inches long, 8 inches wide and 3 inches high .

We have to find the least amount of wrapping paper that Shavon will need to completely cover the box .

And for that we have to use the formula of surface area, which is

[tex] Area= 2(length*width+width*height+length*height) [/tex]

Substituting the values of length, width and height, we will get

[tex] Area= 2(12*8+8*3+12*3) =2(156)=312 [/tex]

Correct option is the last option .


Related Questions

Please help......

1. Write an approximate equation of the line of best fit in slope-intercept form.

2. Use the equation from part B to predict the resting heart rate of a person who exercises 30 minutes per day. Show your work.

3. Explain how you found your answer to part C.

Answers

1. using 2 dots that are on the blue line (0,72) and (6,69)
find the slope:

slope = change in Y over change in x = 69 - 72 / 6-0 = -3 / 6 = -1/2
 equation would be y = -1/2x + 72

2. y = -1/2x+72 = -1/2(30) +72 = -15 +72 = 57 beats per minute

3. replaced x in the equation with 30 to find the beats per minute for exercising 30 minutes

A sample of 81 was taken from a population with a standard deviation of 45 kilograms. If the sample mean was 112 kilograms, the mean of any other sample of 81 will be within what range 99.7% of the time?

A. 97 kilograms to 127 kilograms
B. 102 kilograms to 122 kilograms
C. 92 kilograms to 132 kilograms
D. 107 kilograms to 117 kilograms

Answers

Sample size = n = 81
Population Standard Deviation = s = 45
Sample Mean = x = 112

Since, population standard deviation is known, we will use z distribution to find the confidence interval.

The critical z value for 99.7% is 2.968

So, the confidence interval will be:

[tex](112-2.968* \frac{45}{ \sqrt{81} }, 112-2.968* \frac{45}{ \sqrt{81} }) \\ \\ (97.16, 126.84)[/tex]

Rounding of to nearest integers the confidence interval will be 97 to 127.

So, option A gives the correct answer

Through music we can communicate more then what can be expressed with words alone
True or false

Answers

 i believe it is true.
I believe it is true because music has many expressions. Like for example, a violin(that’s what I play) can be played that it is singing the songs. I believe music is such a important thing in life.

give the length and width in whole inches of three different rectangles that each have an area of 48 in. squared

Answers

To find the length and width of 3 different rectangles that have an area of 48 square inches, you can use the factor pairs that result in 48.

The reason is that to find the area of a rectangle you multiply two dimensions.

2 in x 12 in
3 in x 8 in
4 in x 6 in

On all these either one could be the length and the other the width.

I was sick the day that the class went over how to do this and I don’t know how to do it.

Answers

You first need to know the equation A=pi x r^2. The equation you need for this problem is pi (3.14) x 3^2

You start a business making painted flower containers. You spend 300$ on paint and 5$ on each container. You charge 20$ for each container. How many containers do you have to sell to break even?

Answers

without paint, you're profiting $15 per container with the $5 original cost

300/15 = 20


It says in abc, What is m

Answers

The interior angle measures of a triangle add up to 180°.

Make ∠A + B + C = 180.

x + (4x) + (5x - 13) = 180
Add all like terms.

10x - 13 = 180
Add 13 to both sides.

10x = 193
Divide both sides by 10.

x = 19.3

Now plug in x into m∠C, (5x - 13).
5(19.3) - 13 = 83.5

The m∠C is 83.5°.

Please help me with this!

Answers

Differences between x-values are 1. Differences between y-values are 2. The y-values are changing 2 times as fast as the x-values, so you are looking for an answer that involves 2x. The appropriate choice is
   D. 2x + 3

_____
You can check this result:
   for x=1: 2·1 + 3 = 5
   for x=4: 2·4 + 3 = 11
These values correspond to those in the table.
Let's just list the coordinats first.
(1,5)
(2,7)
(3,9)
(4,11)

When you see 3 and 9, you sometimes immediately think it is 3x=y, but you have to look at the other coordinates as well. This can be show in option a, 5x=y. This can not be the anser because 3×5=15≠9. We can eliminate that answer. Option B says that you are adding 2, but when you add 2 to 4, it equals 6 and not 11. The same for C, 4 added to 4 equals 8, not 11.

The one left, D, is the answer. When you put each x value in, you do get the corresponding y value as well. To even make sure, I made a graph with 2x+3=y as the function to see if those values/coordinates would pop up.

A diner has a breakfast special. A customer can chose scrambled, fried, or poached eggs. The breakfast comes with a side of bacon, sausage, or fruit salad. The customer can choose coffee, tea, or milk. How many different combinations of eggs, side, and drink does a customer have to choose from?

Answers

3x3x3=27

So, there are 27 combinations.

A diner has a breakfast special. A customer can chose scrambled, fried, or poached eggs. The breakfast comes with a side of bacon, sausage, or fruit salad. The customer can choose coffee, tea, or milk. How many different combinations of eggs, side, and drink does a customer have to choose from?

Solution:

Number of ways the customer can choose eggs=3

Number of ways the customer can choose side=3

Number of ways the customer can choose drinks=3

So, total number of combinations for choosing eggs and side and drinks

=3(for eggs) and 3(for sides) and 3(for drinks)

=3 * 3 *3

=27

A customer has 27 combinations of eggs, side, and drink available.

How many pounds of peanuts will each person get if 3 people share 1/5 pounds of peanuts equally?

Answers

3 people share 1/5 pound

1 person = 1/5 ÷ 3 = 1/5 x 1/3 = 1/15 pound


Answer: 1 person gets 1/15 pounds of peanuts.

Fernando poured water from one-pint bottles into a three-gallon bucket. How many pints of water could the bucket hold? 

Answers

24 pints is the answer
24

One gallon holds eight pints. 8 x 3 = 24

you need to count all of the loaves of bread in the front area . there are 22 loaves of white bread, 17 loave of wheat bread, and 19 gourmet breads.what is the total number of loabes?

Answers

19+17=36
36-22=14
the answer is 14
this is a very simple problem if you need to know the amount of loaves of bread in the front area it is a simple addition problem 22+17+19=__ using the formula we find the answer is 58 loaves of bread
 

This is right or wrong, please anyone

Answers

Wrong,

You added when you were supposed to divide.

24/30 = 0.8


I believe the answer should be 0.8

I hope that this is right and sorry if I'm wrong  

HELP NEEDED

Use the functions h(x) = 5x − 2 and t(x) = 4x + 6 to complete the function operations listed below.

Part A: Find (h + t)(x). Show your work.

Part B: Find (h ⋅ t)(x). Show your work.

Part C: Find h[t(x)]. Show your work.

Answers

Part A: Find (h + t)(x). Show your work. 
h(x) = 5x − 2 and t(x) = 4x + 6
so
(h + t)(x) = 5x − 2 + 4x + 6
(h + t)(x) = 9x +4



Part B: Find (h ⋅ t)(x). Show your work. 
h(x) = 5x − 2 and t(x) = 4x + 6
so
(h ⋅ t)(x) = (5x − 2) (4x + 6)
(h ⋅ t)(x) = 20x^2 + 30x - 8x - 12
(h ⋅ t)(x) = 20x^2 + 22x - 12



Part C: Find h[t(x)]. Show your work. 
h(x) = 5x − 2 and t(x) = 4x + 6
so
h[t(x)] = 5(4x + 6) − 2
h[t(x)] = 20x + 30 - 2
h[t(x)] = 20x + 28

hope all help.


A cone has a volume of about 235.5 cubic centimeters. If the height is 9 centimeters what is the radius of the cone?

Answers

r≈5cm

hHeight: 9


VVolume: 235.5

Can please help!
10. Write an inverse variation to model the situation and answer the question. Two rectangular fields have the same area. One measures 75 yd by 60 yd. If the other has a length of 72 yd, what is its width?. Show your work

Answers

Answer:
equation is: width = area / length
width = 62.5 yd

Explanation:
For the first rectangle:
We have:
length = 75 yd and width = 60 yd
Therefore:
area = length * width 
area = 75 * 60
area = 4500 yd²

For the second rectangle:
We have:
area = area of first rectangle = 4500 yd²
length = 72 yd
area = length * width
width = area / length ............> The required equation
width = 4500 / 72
width = 62.5 yd

Hope this helps :)

Suppose q and r are independent events, and P(Q)= 0.39, P(R)= 0.85. Find P(q and r)

Answers

Answer:
P (q and r) = 0.3315

Explanation:
We are given that:
P (q) = 0.39
P (r) = 0.85

Since the two events are independent, therefore, the formula that we will use to get P (q and r) is as follows:
P (q and r) = P (q) * P (r)

Based on the givens:
P (q and r) = 0.39 * 0.85 = 0.3315

Hope this helps :)

Answer:

0.3315

Step-by-step explanation:

dividing whole numbers 22 divided by 300

Answers

Answer:

22 divided by 300 will be equal to 0.07333.

Step-by-step explanation:

Dividing 22 by 300

[tex]\frac{22}{300}=\frac{2\times 11}{2\times 2\times 5\times 5\times 3}[/tex]

[tex]\frac{22}{300}=\frac{11}{2\times 5\times 5\times 3}=\frac{11}{150}[/tex]

[tex]\frac{11}{150}=\frac{11}{15}\times \frac{1}{10}[/tex]

The value of [tex]\frac{11}{15}=0.7333[/tex]

[tex]\frac{22}{300}=\frac{11}{150}=0.7333\times \frac{1}{10}=0.07333[/tex]

So, the value of 22 divided by 300 will be equal to 0.07333.

Final answer:

Dividing 22 by 300 gives a quotient of 0.0733, representing the proportion of 22 out of 300.

Explanation:

To perform the division of the whole numbers 22 and 300, you simply divide 22 by 300 using long division or a calculator. However, since 300 is larger than 22, the result will be a decimal or fraction that is less than 1. Mathematically represented as:

22 ÷ 300 = 0.0733

In a real-world scenario, this number could be interpreted as the proportion or percentage of a whole that the number 22 represents out of 300.

Learn more about Division of Whole Numbers here:

https://brainly.com/question/29885808

#SPJ3

Jerome bought a book on sale at the store. The sale price of the book was $8.96. Write and solve an equation to determine the regular price of the book to the nearest cent

Answers

Final answer:

The regular price of the book is $8.96.

Explanation:

To determine the regular price of the book, we can set up an equation using the sale price and the regular price. Let's say the regular price is 'x'.

So the equation becomes:

8.96 = x

To solve for 'x', we can simply state that the regular price of the book is $8.96.


Find the Distance, d, across the lake

Answers

The answer is 11.25 ft. 
You have to use similar figures to work this out.
15 ft / 8 ft has to equal d ft  / 6 ft
So, you divide 15 by 8, which equals 1.875
You then times 1.875 by 6 = 11.25


The Distance, d, across the lake is 26.25 feet.

Similar Triangles

When two triangles have all the corresponding angles equal to each other, then their sides are in a ratio.

Given to us,

AB = 8 feet,

BC = 15 feet,

BP = 6 feet,

PQ = d,

AP = AB + BP = 8 + 6 = 14 feet

In the figure, [tex]\triangle ABC \sim \triangle APQ[/tex]

[tex]\dfrac{BC}{AB}=\dfrac{PQ}{AP}[/tex]

[tex]\dfrac{15}{8}=\dfrac{d}{14}[/tex]

[tex]d = \dfrac{15\times 14}{8}[/tex]

[tex]d = 26.25[/tex]

Hence, the Distance, d, across the lake is 26.25 feet.

Learn more about Similar triangles:

https://brainly.com/question/25882965

which of the following functions is continuous between x=-3 and x=0? choices on attachment

Answers

When we say that a function is continuous between x = -3 and x = 0 it means that it exists for all values of x in between -3 and 0. Let's take a look at each choice individually:

A: f(x) = (-x + 1)/(x + 2)
Now we don't actually need to know what the graph of this function looks like to see which values it is continuous for, instead we should look at which values of x will make this function undefined - in this case that would be x = -2. The reasoning behind this is that a number divided by 0 would be undefined, so when we search for which value of x would make the denominator of the equation 0, we get:
x + 2 = 0
x = -2
Since x = -2 is within the interval [-3, 0] we cannot say the function is continuous over this interval

B: f(x) = -2/(x + 1)
Using the same method as above we get:
x + 1 = 0
x = -1
x = -1 is again within the interval [-3, 0] and so the function is not continuous within this interval

C: f(x) = 3x/(x - 2)
x - 2 = 0
x = 2
x = 2 is outside the interval of [-3, 0] and so the function is continuous within this interval and C is the correct answer.

Just for the sake of it however we can look at D as well:
D: f(x) = 1/(2x + 1)
2x + 1 = 0
x = -1/2
-1/2 is within [-3, 0] and so D is not continuous over this interval

The owner of a bookstore predicts that 30% of the books she sells each week are self-help books. To test this prediction, the owner randomly selects 150 books out of the total number of books sold for a week and records the type of each book. The table shows the results of samples taken for 2 separate weeks. Sample Fiction History Cooking Self-help Total week 1 50 29 37 34 150 week 2 55 31 34 30 150 Based on these samples, is the owner's prediction correct? Select from the drop-down menus to correctly answer the question. The owner's prediction is . Based on the samples, about of the books sold each week are self-help books.

Answers

The owner's prediction is incorrect.  About 23% of the books sold are self-help books.

34 out of the 150 sold in week 1 were self-help books.
34 out of the 150 sold in week 2 were self-help books.

This gives us 68 self-help books out of 300 books sold.

68/300 = 0.2267 ≈ 0.23 = 23%

Based on the samples, the owner's prediction of 30% is not correct; approximately 21.34% of the books sold each week are self-help books.

The bookstore owner predicts that 30% of the week's book sales are self-help books. To evaluate this prediction, we need to look at the number of self-help books sold in the samples provided for two separate weeks. In week 1, 34 out of 150 books sold were self-help books, which is 22.67%. In week 2, 30 out of 150 books sold were self-help books, which is 20%. To determine the average percentage of self-help books sold over the two weeks, we average these two percentages: (22.67% + 20%) / 2, which gives us 21.34%.

A prism is filled with 44 cubes with 1/2 units side lengths. What is the volume of the prism in cubic units?

Answers

The volume would be 5.5 cubic units.

First, we need to find the volume of one cube. It would be LWH.
0.5 x 0.5 x 0.5 = 0.125

Now, just multiply that volume by 44.
0.125 x 44 = 5.5

the goalie ate half of a pizza that had a diameter of 20 inches! what was the area of pizza that she ate? what was the length of crust she ate?

Answers

Area= pie • radius square

Since it’s diameter you divide it by 2 so it would 10. 10= radius, now does you multiply it by its self so 10•10= 100. Now multiply it but pie which it 3.14. 100•3.14= 314. 314 should be your answer!

Sorry if you get this wrong :( but I’m learning this and I usually get these right but best of luck! :)

13 percent of what is 78

Answers

13% of what is 78

"what" is the unknown, so use x for what.
"of" in math usually means a multiplication.
"is" means "="

13% * x = 78

0.13x = 78

x = 78/0.13

x = 600

Answer: the number is 600
i think the answer is 600

Jamelia estimates the square root of 72 in the following way:
√72 = 2√36 = 2*6 = 12

(a) Explain why her reasoning is incorrect.

(b) Estimate the square root of 72 to the nearest tenth. Show your work.

Answers

Part a)
we have that
√72
√72-----> √(2*36)=√2*√36 is not 2*√36------> this is the error
√2*√36=√2*√6²-----> √2*(6)----> 6√2

alternative method
72 is equal to-------> 2³*3²
therefore
√72-----> √[2³*3²]----->√ 2³*√3²-------> (2√2)*(3)-----> 6√2

Part b)Estimate the square root of 72 to the nearest tenth

we know that
√2 is equal to 1.41
so
√72=6√2------> 6*1.41-----> 8.46----> 8.5

the answer Part b) is 8.5

How can we get the answer for...Decrease £8 by 20%

Answers

multiply by 0.8. do 8×.8
20/100 x 8 = 1.6
8-1.6= 6.4
therefore the answer is £6.40

A college entry exam has 38 questions worth 200 points. The test consists of multiple-choice questions, x, worth 4 points each and essay questions, y, worth 10 points each. Which system of equations can be solved to find the number of multiple-choice questions on the test?

Answers

A system of equations is a set of equations to be solved by elimination or substitution.

There are no options listed in the question to choose from, but the equations should look like the following:

x= # multiple choice questions
y= # essay questions

QUANTITY EQUATION:
x + y= 38

VALUE EQUATION:
4x + 10y= 200

If we solved these two equations by elimination or substitution, we would find the number of multiple choice (x) and the number of essay (y) questions on the test.


ANSWER: x + y= 38; 4x + 10y= 200

Hope this helps! :)

Answer:

Let's use the variables x and y to represent the number of multiple-choice and essay questions on the test, respectively.

The total number of questions is 38, so we can write:

x + y = 38

The total number of points is 200, so we can write:

4x + 10y = 200

This gives us a system of equations:

x + y = 38

4x + 10y = 200

We can solve this system of equations to find the number of multiple-choice questions on the test.

Plzz help me im giving 12 points

Answers

this Is very simple.

30m + 50 = 20m + 100

This is the new equation needed to solve for m.
first we must isolate "m".

30m + 50 = 20m + 100
        - 50             - 50

30m = 20m + 50
-20m   -20m

10m = 50

divide both sides by 10 to isolate "m".

m = 5

hope this helps!





What is the volume of the triangular prism ?

Answers

The volume of the rectangular pyramid is 640 cm³.

What is the volume of a pyramid?

The volume of a pyramid is [tex]\frac{1}{3} Ah[/tex] where A is the area of the base of the pyramid and h is the height.

Area of the base = area of a rectangle with dimensions 12cm*10cm

Area of the base =12*10 =120 cm²

Height of the pyramid =16cm

So, the volume of the pyramid = [tex]\frac{1}{3}*120*16[/tex] cm³

The volume of the pyramid =640 cm³

Hence, the volume of the rectangular pyramid is 640 cm³.

To get more about pyramids visit:

https://brainly.com/question/12903285

Other Questions
Which two measures did the United States take to counter terrorism after the September 11 attacks?A)withdrew support for IsraelB)passed the Patriot ActC)banned immigrationD)increased airport securityE) denied entrance to foreigners The U-Drive Rent-A-Truck company plans to spend $15 million on 310 new vehicles. Each commercial van will cost $35 comma 000 , each small truck $70 comma 000 , and each large truck$60 comma 000 . Past experience shows that they need twice as many vans as small trucks. How many of each type of vehicle can they buy? How is augmented reality used A) to integrate 3-D graphics for providing a live, direct, or indirect view of a physical real-world environmentB) to gather and analyze digital data using special software toolsC) to provide up-to-the-minute information for decision-making processesD) to monitor employee movement during working hours Compare and Contrast topics and themes of writers from Americas and Europeans Predict where the Katydid would hide from danger? Draw a picture of what you predict, help please The Silk Road was discovered by __________. A. Marco Polo B. Genghis Khan C. General Zhang Qian D. Kublai Khan Calcium carbonate reacts with hydrobromic acid to form calcium bromide, carbon dioxide, and water according to the reaction below. what is the molarity of the hydrobromic acid if 250.0 ml of it reacts with 5.64 grams of calcium carbonate? Explain why the equation (x-4)^2-10=15 has two solutions. Then solve the equation to find the solutions. Please show all your work! (30 points) A standard number cube with the numbers 1 through 6 is rolled. Find the probability of rolling a number greater than 5 .1. 1 / 62. 1 / 33. 1 / 44. 2 / 3 If a = 0.3 with a line over 3 and b = 0.5 with a line over 5, what is the value of a + b?8/108/988/10080/99 75 points Write and solve an equation to find the measure of NEP. Make sure you show all work. A ladder leans against a building. The angle of elevation of the ladder is 70. The top of the ladder is 25 ft from the ground. To the nearest tenth of a foot, how far from the building is the base of the ladder?20.5 ft30.5 ft32.3 ft39.5 ft Three positions of praying mentioned in the Old Testament are:kneeling and sittingkneeling, standing, and falling face downstanding and sittingkneeling, sitting, and lying on one's side Andrew drove 55 mph on his trip. Which of the following equations best represents the distance he drove if x stands for the number of hours? Two people start walking at the same time in the same direction. One person walks at 8 mph and the other person walks at 2 mph. In how many hours will they be 4.5 miles apart? Rowland and molina's work showed that ultraviolet light in the stratosphere causes cfcs to release ________ atoms. Why is this cover letter inappropriate? Genetic disorders caused by multiple genes interacting with the environment are called Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? view available hint(s) where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? it would not bind the target dna. ttttagccatttacgattaatcg ttttagccatttacgattaatcg ttttagccatttacgattaatcg? Find the product.y 4 y 6