Sleep disorder in which a person experiences terrifying sensations during nrem sleep

Answers

Answer 1
I believe the answer you are looking for is Night Terroirs. hope this helps.

Related Questions

Soldiers were given ______ not only to ease the pain of their injuries but also to relieve the symptoms of dysentery. heroin steroids methamphetamine morphine

Answers

Soldiers were given Morphine not only to ease the pain of their injuries but also to relieve the symptoms of dysentery. Morphine is the most active substance in opium, it is a powerful painkiller that was used by many US civil war soldiers. it is during this civil war that the first major wave of Morphine addiction occurred due to continuous use. 

What organs are the biggest producers of lymph?

Answers

Lymph is the fluid formed from the interstitial fluid, collected through lymph capillaries that circulates throughout the lymphatic system. There are two types of lymphoid organs involved in the production of lymph:
  1. Primary- for the formation and maturation of lymphocytes which are components of lymph (bone marrow and thymus)
2.Secondary-for filtering the blood to form lymph (lymph nodes, tonsils, spleenPeyer's patches and mucosa-associated lymphoid tissue-MALT).

Balthazar's depression is being treated through a procedure in which electrodes are placed on both sides of his head and a brief current is turned on. the current triggers a seizure that lasts about a minute, causing his body to convulse. his treatment is known as:

Answers

electroconvulsive therapy is the answer. It's an alternative therapy for depression.

This treatment is known as electroconvulsive therapy (ECT)

Electroconvulsive therapy (ECT) is a procedure, in which small electric currents are passed through the brain, with the intention of triggering a brief seizure to provide relief from mental disorders. ECT may not work for everyone and it is frequently used when other treatments are unsuccessful. ECT is used to treat severe depression, catatonia and agitation and aggression in people with dementia .


During the elongation phase of translayion which site in the ribosome represemts thw location where a codon is being read

Answers

The P site of the ribosome is where codon is read during elongation.

In what part of the female reproductive tract does fertilization typically occur?

Answers

along the oviduct or fallopian tube when the egg is traveling through the tube it is fertilized by a sperm during intercoarse.

A density independent limiting factor is a limiting factor of a population that can affect population growth no matter what the population density. what is a density independent limiting factor that can affect the human population growth of north carolina?

Answers

Answer:hurricanes and flooding

Explanation: Due to the location of North Carolina being along a coastal line they are susceptible to hurricanes and as a resultant inland flooding

Answer:

Hurricanes

Explanation:

I just took a benchmark and i got that question correct

The proteins that bind to the dna near regions where gene transcription begins are called the proteins that bind to the dna near regions where gene transcription begins are called homeobox genes. mrna. the gray crescent. transcription factors. promoter genes.

Answers

The answer is transcription factors. These proteins bind to the promoter region and either enable the polymerase protein to bind to the promoter and start transcription (enhancers) or inhibit the binding of the polymerase to the promoter hence repress transcription (silencers).  

Why is the process of nuclear fusion important to life on earth?

Answers

Nearly all life on Earth ultimately gets its energy from the sun, which gets "its"energy through nuclear fusion. With the exception of hydrogen, all of the chemical elements needed for life were produced by nuclear fusion of lighter elements, either in the cores of stars or in the shock waves of supernova explosions.

Answer:

Earth gets energy from sun which in turn produces energy through nuclear fusion.

Explanation:

[tex][/tex]

When can confidentiality be breached in health and social care?

Answers

HIPAA violations. Including the discussing or accessing of patient information without their consent.

Example: A doctor/social worker discusses a patient’s information with colleagues or friends who are not involved with the treatment of patient and don’t have the patient’s consent.

Once oil is formed it must accumulate in concentrations that can be drilled and pumped, these concentrations are called

Answers

Once oil is formed it must accumulate in concentrations that can be drilled and pumped, these concentrations are called
traps

Physical and chemical barriers prevent pathogens from getting into our body. the most comprehensive barrier is the waterproof layer of _______ that covers the body's surface.

Answers

Picture below shows that the most comprehensive barrier is the waterproof layer of skin that covers the body’s surface. If human skin is intact, it keeps the body out of the reach of infections. The picture summarizes physical and chemical barriers against infection. 

A particular species of unicellular organism inhabits the intestines of termites, where the unicellular organisms are protected from predators. wood that is ingested by the termites is digested by the unicellular organisms, forming food for the termites. the relationship between these two species can be described as

Answers

Mutualism

Mutualism is a relationship between organisms of two different species in which each benefits. From the question given above, the relationship between the termites and the unicellular organism can be described as mutualism because both organisms benefit from each other.






Final answer:

The relationship between the termites and the unicellular organisms in their intestines is an example of mutualism, a type of symbiotic relationship where both organisms benefit. The protists help digest cellulose from the termite's wood diet, providing nourishment for both organisms.

Explanation:

The relationship between the termites and the unicellular organisms in their intestines is an example of mutualism. In this symbiotic relationship, both organisms benefit. The unicellular organism known as protists, which survives in the termite's gut, assist the termites in breaking down the ingested cellulose from their wood-based diet into a digestible form that provides nourishment for both the termite and the protists.

This process represents a mutualistic relation because while the protists are obtaining a safe habitat and a constant supply of food from the termite, they are also essential in processing cellulose from the wood, aiding the termite in deriving essential nutrients. Without this digestive assistance by the protists, the termite cannot obtain energy from its food.

Furthermore, the protists themselves are able to digest cellulose due to the presence of symbiotic bacteria within their cells that produce the cellulase enzyme. This results in a complex mutualistic interaction where both the termite and the protists (and the bacteria within the protists) derive strategic survival advantages from each other.

Learn more about Mutualism here:

https://brainly.com/question/13800737

#SPJ11

Why do plant cell possess large size vacuole?

Answers

Plant cells possess large sized vacoules because they need a lot of water to function. Since the vacuole is used for storing water, the large sized vaculoes help the plant to store water, so they are essential for the survival of the plant.

Hope this helps!

Brainliest please.

why do two-dimensional maps of earth have distortions? A. Earth is three-dimensional, but maps are two-dimensional B. cartography is an inexact science C. cardinal directions do not apply to two-dimensional maps D. They do not include lines of longitude

Answers

A. earth is 3d and maps are 2d

Answer: Option (A)

Explanation: It is because we cannot represent a three-dimensional object in a two-dimensional maps, without distortion. So in order to reduce this distortion various types of projections are being used such as Mercator projection, Interrupted map projection and Azimuthal projection that helps us in reducing distortion and transform a 3-D object to 2-D.

Which mechanism restricts the expression of leptin to adipocytes?

Answers

Only adipocytes contain nuclear factors for the expression of the ob gene. Nuclear factors are the only elements that are in different cells and therefore can confer both temporal and spatial regulation of their target genes. Leptin hormone is made up mainly by the adipose cells and helps to regulate energy balance by inhibiting hunger. It regulates energy intake and fat stores such that the weight is maintained within a narrow range.

What is the name of the condition in which tissue from the lining of the uterus grows outside the uterus answers?

Answers

Endometriosis. is where the lining of the uterus develops on the outside of the uterus

Sodium hypochlorite, naocl, is household bleach. it removes stains from clothing through a redox reaction in which the stain molecules are oxidized. sodium hypochlorite acts as a(n)

Answers

The answer is reducing agent.  Sodium hypochlorite, naocl, is household bleach. it removes stains from clothing through a redox reaction in which the stain molecules are oxidized. sodium hypochlorite acts as a reducing agent.

Final answer:

Sodium hypochlorite is a commonly used household bleach and disinfectant, acting as an oxidizing agent in removing stains. It is produced via the electrolysis of diluted sodium chloride solutions. Sodium hypochlorite solutions tend to decompose, releasing chlorine which contributes to their effectiveness.

Explanation:

Sodium hypochlorite, commonly known as household bleach or simply bleach, is widely used as a disinfectant and a bleaching agent. This chemical compound, with the formula NaOCl, is known for its ability to remove stains from clothing through a redox reaction where the sodium hypochlorite acts as an oxidizing agent. In this reaction, the stain molecules are oxidized, effectively breaking down the color-causing molecules and lifting the stains.

The production of sodium hypochlorite involves the electrolysis of cold, dilute sodium chloride solutions which lead to the formation of chlorine and hydroxide ions. These ions subsequently react to produce NaOCl. Sodium hypochlorite solutions can be unstable and decompose, releasing chlorine as the active ingredient, which explains its effectiveness in both cleaning and disinfection processes.

While historically liquid chlorine was used in the production of sodium hypochlorite by companies such as Clorox, there has been a shift towards shipping concentrated solutions and diluting them as needed. This change reflects advancements in production and distribution methods, making the use of sodium hypochlorite more efficient and sustainable. Furthermore, this chemical is not only limited to household use but also plays an important role in water treatment facilities.

Dna encodes the information necessary to produce the proteins needed by your body. to makes these proteins, dna first undergoes a process known as transcription. this is when information on a dna is transferred to a mol;ecule very similar to dna, known as

Answers

RNA. RNA helps the production process of proteins.

Once meiosis occurs gametes are formed with a reduced number of chromosomes. The gametes are

A. haploid.
B. uniploid.
C. homologous.
D. diploid.

Answers

I think its A. but I'm not sure so sorry if I'm wrong

A plant lacking a mineral or failing to make a needed vitamin dies before it can bear food for human consumption.
a. True
b. False

Answers

True, I believe this is right because it is also common sense in some way, if it is lacking something it will not grow or produce properly.

Determination of the incubation period for a disease outbreak helps to: demonstrate the location of the outbreak show the distribution of cases by time of onset verify that an epidemic has occurred identify possible infectious agents

Answers

The right option is show the distribution of cases by time of onset

Determination of the incubation period for a disease outbreak helps to show the distribution of cases by time of onset. Incubation period is the time from the moment of exposure to a pathogenic organism to the time that signs and symptoms of the disease appear. For example the incubation period of Salmonella that causes typhoid fever is between 6 to 72 hours.







If one strand of a dna molecule has the sequence 5'tccgaat3', what is the sequence of the other, complementary strand?

Answers

Line them up (easiest) and remember A pairs with T and C pairs with G:

5'-TCCGAAT-3'
3'-AGGCTTA-5'

An ecosystem is effected by many factors. Oxygen, soil, water, amount of sunlight, and temperature are some examples. What type of factor are these examples?

Answers

I believe that these are ABIOTIC factors since they are not living.
The answer to this is abiotic.

The reason it is abiotic is because they are consider non- living things which includes temperature, sunlight, oxygen, soil and water. 

Hope this helped :)
Have a great day 

Which of the following plants is an angiosperm? fern moss pine rose

Answers

The correct answer is ROSE.
Angiosperm are plants that have flowers and produce seeds; their seeds are usually enclosed within carpels. The rose plant fall under the angiosperm classification because, the plant protect its seeds within two fruits and it produces flowers.
rose is the right answer
have fun :))))))))))))))

Both animals and fungi are heterotrophic. what distinguishes animal heterotrophy from fungal heterotrophy is that most animals derive their nutrition by ________. both animals and fungi are heterotrophic. what distinguishes animal heterotrophy from fungal heterotrophy is that most animals derive their nutrition by ________. ingesting materials using enzymes to digest their food consuming living, rather than dead, prey preying on animals

Answers

Both animals and fungi are heterotrophic. what distinguishes animal heterotrophy from fungal heterotrophy is that most animals derive their nutrition by ingesting materials.  

Fungi are heterotrophic organisms which feed by absorption. Their structures hyphae secrete digestive enzymes, which break down the substrate. Their nutrition is parasitic (obtaining food from the host) or saprobic (feeding on dead organic remains).
Animals use holozoic nutrition meaning that they eat their food whole. They processed the food via a special digestive system and this consists of 5 stages, ingestion, digestion, absorption, assimilation and egestion.

Bacterial cells protect their own dna from restriction enzymes (endonucleases) by _____.

Answers

This occurs through DNA methylation which involves adding methyl groups to cytosines and adenines. This process allows the bacterial cells to protect their own DNA from restriction enzymes. 

Let me know if you need anything else. 
 
                  - Dotz  

Bacterial cells protect their own DNA from restriction enzymes (endonucleases) by methylation.

What is methylation?

Methylation is a process by which a methyl group is added to a DNA molecule, which can affect its structure, function, and activity.

In DNA methylation, a methyl group is added to a cytosine base in the DNA sequence. It is a key epigenetic modification that plays an important role in regulating gene expression, chromatin structure, and cellular differentiation during development. It tends to be associated with gene silencing, as it can prevent transcription factors from binding to DNA and activating gene expression.

Methylation is carried out by a group of enzymes called methyltransferases, which transfer a methyl group from a donor molecule to the target molecule. Methylation is a reversible process. The removal of methyl groups is catalyzed by demethylases. Thus, Bacterial cells protect their own DNA from restriction enzymes (endonucleases) by methylation.

Learn more about methylation, here:

https://brainly.com/question/6612810

#SPJ2

Which is visible evidence of energy passing through water?

a sea arch

a density tide

a wave

the Coriolis effect

Answers

ANSWER
A wave
EXPLANATION
Due to the earths moon, tidal waves increase in energy.
#mark me brainliest please

The correct answer is option C, A wave

Reason -

Waves in water bodies are produced by the entrapped solar energy as of due to the wind blowing across the surface of a water body. These waves are used as a renewable source of energy. The water particles vibrate to transfer the energy in the form of wave which generally move in the forward direction.

The days are getting shorter and the temperature is dropping. The squirrel responds to these cues by A) migrating. B) hibernating. C) shedding fur. D) gathering food.

Answers

The correct answer is D) gathering food.

Caching or hoarding food, is a behavior characteristic for squirrels during winter. They usually do this by putting their food in a shallow hole which will serve as food when resources are scarce in winter. Also, squirrels maximize their food consumption and body mass making the reserves that will help the animals survive.

Answer:

Gathering food.

Explanation:I know cause I did it.

Making a group appear different from what is normally accepted is called _____.

Answers

The answer is - subculture.
The subculture is a group of people within a culture that differentiates itself from the parent culture to which it belongs, but it often maintains some of its founding principles. Subcultures develop their own norms and values regarding cultural, political and sexual matters.
Making a group appear different from what is normally accepted is called exotification.  It is the treatment of someone as different, or exotic from what is accepted as normal. That person's value is regarded as stemming from her/his difference, rather than from  humanity. It is also a form of stereotyping someone after percieving them as different.

Meiosis produces..?
A.) gametes
B.) somatic cells
C.) body cells
D.) mitotic cells

Answers

The answer would be d
The answer from this question is  D.) mitotic cells
hoped this helped

Other Questions
Describe the effects of Eastern Europes economic problems and ethnic and religious tensions What term refers to the coldest and densest zone, deep below the surface of a lake? Tyree is a skilled cyclist. when practicing on a stationary bike, his coach finds that when the women's cycling team enters the gym, his speed seems to increase significantly. tyree's increase in speed illustrates What factors are associated with recent intimate partner violence? findings from the who multi-country study on women's health and domestic violence? BY THE PRESIDENT OF THE UNITED STATES OF AMERICA. A PROCLAMATION. I, ABRAHAM LINCOLN, President of the United States of America, and Commander-in-Chief of the Army and Navy thereof, do hereby proclaim and declare that hereafter, as heretofore, the war will be prosecuted for the object of practically restoring the constitutional relation between the United States, and each of the States, and the people thereof, in which States that relation is, or may be, suspended or disturbed. That it is my purpose, upon the next meeting of Congress to again recommend the adoption of a practical measure tendering pecuniary aid to the free acceptance or rejection of all slave States, so called, the people whereof may not then be in rebellion against the United States and which States may then have voluntarily adopted, or thereafter may voluntarily adopt, immediate or gradual abolishment of slavery within their respective limits; and that the effort to colonize persons of African descent, with their consent, upon this continent, or elsewhere, with the previously obtained consent of the Governments existing there, will be continued. That on the first day of January in the year of our Lord, one thousand eight hundred and sixty-three, all persons held as slaves within any State, or designated part of a State, the people whereof shall then be in rebellion against the United States shall be then, thenceforward, and forever free; and the executive government of the United States, including the military and naval authority thereof, will recognize and maintain the freedom of such persons, and will do no act or acts to repress such persons, or any of them, in any efforts they may make for their actual freedom. That the executive will, on the first day of January aforesaid, by proclamation, designate the States, and part of States, if any, in which the people thereof respectively, shall then be in rebellion against the United States; and the fact that any State, or the people thereof shall, on that day be, in good faith represented in the Congress of the United States, by members chosen thereto, at elections wherein a majority of the qualified voters of such State shall have participated, shall, in the absence of strong countervailing testimony, be deemed conclusive evidence that such State and the people thereof, are not then in rebellion against the United States. That attention is hereby called to an Act of Congress entitled "An Act to make an additional Article of War" approved March 13, 1862, and which act is in the words and figure following: Be it enacted by the Senate and House of Representatives of the United States of America in Congress assembled, That hereafter the following shall be promulgated as an additional article of war for the government of the army of the United States, and shall be obeyed and observed as such: Article . All officers or persons in the military or naval service of the United States are prohibited from employing any of the forces under their respective commands for the purpose of returning fugitives from service or labor, who may have escaped from any persons to whom such service or labor is claimed to be due, and any officer who shall be found guilty by a court-martial of violating this article shall be dismissed from the service. SEC. 2. And be it further enacted, That this act shall take effect from and after its passage." What is the effect of the following passage on the U.S. government? ...and the executive government of the United States, including the military and naval authority thereof, will recognize and maintain the freedom of such persons, and will do no act or acts to repress such persons, or any of them, in any efforts they may make for their actual freedom.A) It intends to conscript former slaves into the military.B) It intends to prosecute former slave owners.C) It will not stop any slave from moving toward freedom.D) It will use its military and naval authority to stop the war. Which of the following words has the same root as the word biology? a zoology b geology c bibliography d biograph Which expression is equivalent to (2x^5+7x^3)-(5x^2-4x^3) What is the length of chord JK? Who was the first northern democrat elected to the presidency since 1968? determine the qotient of 7,684 and 78 Choose the sentence that best describes the history of Guatemala's capital city.The capital has always been Guatemala City.The capital has always been Antigua.The capital used to be Antigua, but is now Guatemala City.The capital used to be Guatemala City, but is now Antigua. As a healthier alternative to french fries, some fast food outlets offer pre-sliced, bagged apples as a side option. the ingredients list often reads, "apples and ascorbic acid." ascorbic acid is another name for vitaminc. what role does the ascorbic acid play in the product? ascorbic acid is a sequestrant that binds free metal ions and reduces the rancidity of fat in the apples. ascorbic acid is an antioxidant that prevents discoloration when the apples are cut and exposed to oxygen. ascorbic acid is a curing agent that prevents the growth of clostridium botulinum. ascorbic acid is a color additive that makes the color of the apples appear more vibrant. What are the causes of problems the milers and other Native American groups face in Guatemala how are people trying to solve these problems Which diagram shows the most useful positioning of a rectangle in the first quadrant of a coordinate plane? Answers are in the pictures. In an attempt to stem the rising tide of illegitimacy rates and single-parent families among the poor, which act mandated two-parent coverage for all state afdc programs? the family support act in 1988 the supplemental security income the affordable care act temporary assistance to needy families Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? view available hint(s) where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? it would not bind the target dna. ttttagccatttacgattaatcg ttttagccatttacgattaatcg ttttagccatttacgattaatcg? For the electric field shown, which of the following statements describes an increase in voltage?A) A negative charge crosses an equipotential line toward the source charge.B) You cannot tell from the information given.C) A positive charge crosses an equipotential line toward the source charge.D) A positive charge moves along an equipotential line.UPDATE: ANSWER IS C Which organisms are both secondary and tertiary consumers in the food web Laura is completing a craft project that involves covering only the lateral surface of a cylindrical container with fabric. The cylinder has a height of 16.8 in. and a radius of 14.6 in. To the nearest square unit, how much fabric does she need for this project? Use a calculator. Marie has left written instructions directing doctors and family members to avoid or stop using life-sustaining procedures in the event of a terminal condition. such an instrument is called the