The amount paid for stock is the most a shareholder can lose in the corporate form of ownership.
a. True
b. False

Answers

Answer 1

This statement is true. The amount the shareholder has paid for the stock he owns is the amount of potential loss he can incur as a result of being an owner in a corporation. The creditor of the company cannot run to the personal properties of each shareholder. This condition makes the corporation differ from partnership.

Answer 2

Answer:

True

Explanation:

here you go annaruffin7692

this is not my answer

credits to: rubennayanga


Related Questions

Tim is a member of the sales department at freshoveggie, a gourmet grocery store. one of his major tasks includes sending e-mails to customers, who have taken membership at the store, about the latest discounts and new products on sale every week. thus, tim can be considered a(n) _____.

Answers

Tim can be considered as "order-taker".


Order taker can be characterized as a sort of sales representative who gathers requests of merchandise and products yet he doesn't make any endeavors to make the increment in existing deals, increment in the recurrence of requests or to find new clients. 

Harold and elaina are being considered for a car loan. the banker looks at their creditworthiness because he wants to be sure the bank will get the loan payments on time and that the loan will be paid back in full. the table below summarizes the information that was on their applications. application information questions harold elaina how many years have you had your job? 3 7 what is your monthly salary? $2,600 $2,250 how many credit cards do you have? 2 6 how much debt do you have? $3,000 $12,000 how many times were you late with payments on credit cards in the past year? 1 8 who will get the better loan rate from the banker and why? elaina because she has more credit cards available to her. elaina because she has had her job longer, which makes her look more stable. harold because he makes more money per month. harold because he pays his bills on time and does not have too much debt compared to his income.

Answers

Harold because he pays his bills on time and does not have too much debt compared to his income.

Answer:

Harold because he pays his bills on time and does not have too much debt compared to his income.

Explanation:

the income for both persons is quite similar but their credit history is substancially different.

Eliana has a lower salary but higher debt than Harold thus, his debt to income is higher. Elaina also fails in their payment. From the credit card we can assume is paying one by transferring to another credit card.

While Harold is a more reliable borrower as it has lower debt and pays on time for most of the time.

(03.04 LC) What is not a smart way to look for jobs?

Answers

Hello,

Here is your answer:

The proper answer to this question is "not trying to look for a job".

Here is how:

There are many smart ways you can look for a job for example: using a app that tells you when there are new job openings but if you do not look for a job you (or don't try) you will not find a job therefore that's is not a smart way to find one.

Your answer is not try to look.

If you need any or help feel free to ask me!

Hope this helps!
Hello there!

One way that would not be a smart way to look for a job is to "ask the job, but with bad representation".

Reason/Justification: 

When looking for a job, you would want to look as great as possible. When you look for a job, you do not come there with slacks, or with baggy pants and some ripped shirt, you would want to look as neat as possible, because in this sense, you would most likely be hired. Why so? Your appearance is what people some what rely on. By you looking great, great hygiene, and well attitude with a useful resume, you would be hired, but doing the opposite as we considered would not be the best intention to make.

I hope this helps you!


"​_____ is the process of presenting computing resources that are accessed in ways that appear to not be restricted by physical configuration or geographic location."

Answers

The answer is:  "virtualization" .
_________________________________________________________
      "  Virtualization  is the process of presenting computing resources that are accessed in ways that appear to be restricted by physical configuration or geographic location." 
_________________________________________________________  

Which factor sets the floor on setting a​ product's price?
a. ​customer's value perceptions
b. competitors
c. demand
d. product costs
e. revenue?

Answers

The customer's value perceptions sets the floor on setting a product's price. 

If a customer perceives something to have a lot of value (be considered an 'expensive' item) then it typically will hold more value to them. When looking at a customer's perceived value, marketers are looking at what a customer thinks the benefits/values of that product is in comparison with another. 

The contract will be awarded to ____ meets our qualifications. whomever whoever

Answers

Answer will be whoever

The management of elaka air, an airline company, has set a mandatory retirement age for its flight attendants. this is because the management strongly feels that with age, flight attendants find it difficult to work in a pressurized cabin for extended periods. in the context of federal employment laws, this scenario exemplifies a(n) _____.

Answers

Final answer:

The mandatory retirement age set by Elaka Air for its flight attendants is an example of age discrimination, which could contravene the Age Discrimination in Employment Act (ADEA) enforced by the U.S. Equal Employment Opportunity Commission (EEOC), unless it can be justified as a bona fide occupational qualification.

Explanation:

The scenario described by the student, where Elaka Air has set a mandatory retirement age for its flight attendants, exemplifies a case of age discrimination in the context of federal employment laws. The U.S. Equal Employment Opportunity Commission (EEOC) enforces laws that make it illegal to discriminate against employees based on several criteria, including age. According to the Age Discrimination in Employment Act (ADEA) of 1967 and its amendments, workers are protected from termination or discrimination in employment decisions based on age, specifically for those 40 years or older. Therefore, mandatory retirement policies could potentially violate the ADEA unless there are specific safety-related reasons that justify such a policy.

Indeed, it is essential to recognize that while management might have concerns about the capabilities of older flight attendants in pressurized cabins, these concerns must align with ADEA regulations. Employers are required to provide evidence that an age limit is a "bona fide occupational qualification" necessary to the operation of the business, a criterion that can be quite strict to meet. Therefore, the imposition of a mandatory retirement age could be subject to legal scrutiny and challenge if it is deemed unnecessarily discriminatory.

Which of these are loans to businesses or governments?

Bonds

IRAs

Mutual funds

Stocks

(My answer would be Bonds , is that correct? )

Answers

Bonds are actually a type of borrowing or loans most businesses and governments use. They represents an alternative to the common bank loans, however they enable loan of higher amounts of money, that governments need but ordinary banks are not able to provide.

Phishing is looking for and reporting online scams.

True or
False

Answers

it would be false....

Phishing is looking for and reporting online scams. This statement regarding Phasing is false. The correct option is (B).

What do you mean by Phishing?

A form of cybersecurity attack known as phishing involves malicious actors sending messages while posing as reliable individuals or organizations.

Since hackers frequently use the letter "ph" instead of the letter "f," at first they were called "phreaks."

Phishing is a form of social engineering attack that is frequently employed to steal user information, such as login credentials and credit card numbers.

It happens when an attacker deceives a victim into opening an email, instant message, or text message by disguising themselves as a reliable source.

Therefore, this statement regarding Phasing is false. Phishing is looking for and reporting online scams.

To know more about the Phishing, visit:

https://brainly.com/question/28501859

#SPJ2

"according to the business process modeling notation standard, the start of a business process is symbolized by a ________."

Answers

The answer is:  "circle having a narrow border" .
__________________________________________________________
       "According to the business process modeling notation standard, the start of a business process is symbolized by a   circle having a narrow border . "
__________________________________________________________

Transfer pricing is defined as ________. the means by which subsidiaries and affiliates charge each other as they exchange goods and services compensation paid to owners of intellectual property the process through which a parent deposits a large sum in a foreign bank, which transfers it to a subsidiary as a loan methods for transferring funds exclusively from foreign subsidiaries to parent corporations

Answers

Transfer price is a price charged for a good or service by one part of a company(segment) to another part of a company(segment). 

When charging transfer pricing no profits are made because they are moving it within the same company. The smaller companies(segments) within a larger one are working together to develop their end good or service.

The partnership of Brandon and Ryan is being liquidated. All gains and losses are shared in a 3:1 ratio, respectively. Before liquidation, their balance sheet balances are as follows:

Answers

The answers are the following:
a. 
Brandon:
$7,000 + [($10,000/4)×3¿= $8,500
Ryan:
$7,000 + [($10,000/4)×1¿= $7,500

b.
Brandon $7,000
Ryan $7,000

The partnership of Brandon and Ryan is being liquidated. All gains and losses are shared in a 3:1 ratio, respectively. Before liquidation, their balance sheet balances are as follows:

Cash $10,000

Other Assets 8,000

Liabilities 4,000

Brandon, Capital 7,000

Ryan, Capital 7,000

a. If the Other Assets are sold for $10,000, how much will each partner receive before paying liabilities and distributing the remaining assets?

b. If the Other Assets are sold for $8,000, how much will each partner receive before paying liabilities and distributing remaining assets?

Answer:

a; Brandon will receive $1500

    Ryan will receive $500

Explanation:

The Gain from sales of other assets of $2000 will be shared in the agreed ration 3/4 for Brandon and 1/4 for Ryan.

After which the liabilities will be settled and the balance cash shared in the ration of the Partners capital.

Answer:

b; Brandon will receive $0

    Ryan will receive $0

Explanation:

No gains from the sales of other assets which means nothing to receive.

Liabilities will  be settled and the remaining cash distributed in the ration of the partner's capital contributions

Investments in information systems projects today are evaluated in the context of an entire portfolio of projects.
a. True
b. False

Answers

this statement is true

im 100% correct that its true

________ consists of the official and defined structures and systems related to decision making, communication, and control in the organization.

Answers

Formalization consists of the official and defined structures and systems related to decision making, communication, and control in the organization. 

Managers perform formalization to make sure these processes are put in writing to help processes, relationships and operation run smoothly. 

Accumulated depreciation is​ a(n) ________ account and carries a normal​ ________ balance.

Answers

Accumulated depreciation is​ a "contra asset" account and carries a normal​ "credit" balance.

Accumulated depreciation refers to the aggregate sum of a plant resource's cost that has been dispensed to deterioration cost since the benefit was put into service. Accumulated depreciation is related with built resources, for example, structures, apparatus, office gear, furniture, installations, vehicles, and so on. 

Select all that apply.

What type of positions will an employment agency help you find?

temporary part time
permanent full time
temporary full time
permanent part time

Answers

Final answer:

Employment agencies can assist with finding temporary part-time, permanent full-time, temporary full-time, and permanent part-time positions. They offer flexibility and act as a stepping-stone to more stable employment opportunities, contributing to the reduction of frictional unemployment.

Explanation:

An employment agency can help you find various types of job positions, including temporary part-time, permanent full-time, temporary full-time, and permanent part-time jobs. These agencies act as a bridge between employers and job seekers, offering opportunities for work that can range from short-term assignments to long-term careers. Whether you are seeking a temporary role that could lead to permanent employment or a flexible part-time position, employment agencies can provide valuable assistance in your job search.

The second scenario presented describes a job that offers very short-term employment, which allows you to be less selective and provides the flexibility to transition to other opportunities if desired. In contrast, professional positions that are more permanent require careful consideration due to the involved costs and time associated with changing jobs. Overall, the role of employment agencies helps to reduce frictional unemployment by providing temporary positions that can serve as stepping-stones to more stable employment, which has contributed to the growth of the temporary worker industry.

Final answer:

Employment agencies assist with finding temporary and permanent positions, which can be part-time or full-time. They act as a bridge to permanent employment and help reduce frictional unemployment.

Explanation:

An employment agency can help you find various types of job positions. These include temporary part-time, permanent full-time, temporary full-time, and permanent part-time roles. Temporary positions, whether part-time or full-time, offer short-term employment opportunities, which can sometimes serve as stepping-stones to permanent positions. Meanwhile, permanent job offerings are for more long-term and stable opportunities, whether on a full-time or part-time basis.

Employment agencies act as a clearinghouse for job seekers, providing a means to secure employment while searching for more permanent work. They can also give workers a tryout with potential employers, thus reducing frictional unemployment and facilitating job market mobility.

"why is it important for business professionals to take an active role in developing and managing information systems?"

Answers

It is important for business professionals to take an active role in developing and managing information systems because of the fact that they have the knowledge of determining whether the system that has been created is sufficient and that it has the capacity to provide the needs and reach the requirements needed.

It is very significant for the business professionals to take the role actively to be able to let them know if whether the information systems are sufficient enough to meet the needs and requirements.  Information systems should be managed dynamically so that its information can provide the user what it really needs. And can let the user do the task efficiently and effectively.

What are two variables needed to calculate demand?

Answers

"Price and quantity" are the two variables that are needed to calculate demand.


Demand refers to the amount or quantity that a man is both willing and ready to consume at each cost in a given time period, by keeping every single other thing consistent. When Price and quantity shift conversely by keeping all different things constant, it refers to the law of demand. 

The two variables needed to calculate demand are: At a given point in time, the price of a product and quantity that would be purchased at that price. Therefore, the correct option is B.

The price and quantity demanded are the variables that are essential in building the relationship between price and demand for any good , The demand curve depicts this relationship.

By analyzing the various price and quantity combinations, economists can determine and make analyzes  on demand that by how changes in price can affect the quantity of a product that consumers are willing to buy.

Thus, the ideal selection is option B.

Learn more about demand here:

https://brainly.com/question/1960580

#SPJ6

The complete question might be:

What are the two variables needed to calculate demand?

A. The desire and ability to buy a product

B. At a given point in time, the price of a product and quantity that would be purchased at

that price

C. The number of people willing to buy a product and the number and type of competing

products

D. Previous number of purchases and the likelihood of future purchases

Asking potential dating partners for a date is most likely to be reinforced on a ________ schedule. variable-interval variable-ratio fixed-interval fixed-ratio

Answers

Answer:

Variable-ratio

Explanation:

A variable-ratio reinforcement schedule occurs when a behavior is reinforced based on a random number of displays. Thus, unlike fixed schedules, asking for dating partners do not always elicit a positive reward - which is why it is categorized as variable; the response can be positive or negative. It is also not an interval-based reinforcement schedule, since it is not based on time period. Variable-ratio schedules fit this behavior since asking someone out can get you a positive response once you tried hard enough or with enough people - but when it would happen, you cannot predict.

Final answer:

Asking for dates is most likely to be reinforced on a variable-ratio schedule, as it is similar to gambling where reinforcement is unpredictable, leading to a high and consistent response rate.

Explanation:

Asking potential dating partners for a date is most likely to be reinforced on a variable-ratio schedule. This type of reinforcement schedule provides reinforcers after an unpredictable number of responses, which is akin to gambling or playing slot machines. Just as a gambler continues to play due to the unpredictable nature of winning, a person asking for dates may continue to ask because the reinforcement (acceptance of the date) is unpredictable and occurs after an irregular number of attempts. This schedule tends to produce a high rate of response because the reinforcement is not predictable, so the behavior is repeated more frequently in hopes of encountering the reinforcement.

Paul makes an offer to lynn in a written purchase order, saying nothing about how her acceptance should be sent. lynn indicates her acceptance by signing and returning the purchase order. lynn's acceptance is effective
a. when lynn decides to accept.
b. when lynn sends the signed purchase order.
c. when paul receives the signed purchase order.
d. in none of the above situations.

Answers

Lynn’s acceptance is effective when she decides to accept. By the time she decided to accept the offer, there was already meeting of the minds between Paul and Lynn. Therefore, the acceptance of Lynn is effective from the time she decided to herself that she would accept the offer regardless of the time when the acceptance was received by the other party.

Lynn's acceptance of Paul's offer is effective C. when Paul receives the signed purchase order. This is because the acceptance must be communicated to the offeror to be effective.

In contract law, the effectiveness of an acceptance depends on the circumstances and the method used to communicate that acceptance.

In Paul's case, he makes a written offer to Lynn without specifying how the acceptance should be sent. Since Lynn accepts the offer by signing and returning the purchase order, her acceptance is effective when Paul receives the signed purchase order.

This follows the principle that acceptance must be communicated to the offeror, thus making it effective upon receipt.

Help please!!!
11. What is a factory building an example of? (1 point)
human capital
physical capital
an economic trade-off
technology
12. Which of the following is NOT a key economic question? (1 point)
What goods and services should be produced?
How should these goods and services be produced?
Who consumes these goods and services?
How should it be ensured that goods and services are paid for?,

Answers

11. A factory building is an example of Physical capital .  A physical capital is the things that are tangible and they are used as an asset to the business. A building needs to have investments that is why the owner needs to make a capital for it.

12. The statement which is NOT a key economic question is "How should it be ensured that goods and services are paid for?"

In the state of florida, for example, homeowners may qualify for a tax exemption in which up to $50,000 will be deducted from the assessed value of the property before taxes are calculated as long as the property owner occupies a home as the family's principal residence and has claimed residency within the state. this exemption is better known as the

Answers

Homestead Exemption

_________ seeks to minimize resource costs
a. effectiveness
b. efficiency
c. goal attainment
d. controlling

Answers

The answer is b. Efficiency. Something is effiicient when it is able to be done with the least amount of cost and resources. On the other hand, something is effective when it is able to achieve its objective.

In terms of distribution, when marketing channel members are engaged in financing, grading, and providing marketing information and research, they are performing the __________ function

Answers

The answer is "Facilitating," the function would be labelled as facilitating function.

In addition to making shopping easy and convenient for the customer, an effective layout can?

Answers

Easy to locate merchandise
-Does not encourage customers to explore store. Not exciting.
-Limited site lines to merchandise.
-Allows more merchandise to be displayed.
-Maximizes space - vertical and linear.

The caravan trade business made many people in mecca rich true or false

Answers

I believe the answer is true.

Answer: True is the Answer

Explanation:

Egan is very skilled at budgeting his money, he is very patient, he understands how to track his own financial records, and he keeps calm and collected during stressful occasions. In which Finance career would Egan be most successful?


A) Business Finance Management

B) Financial Investment Planning

C) Insurance Services

D) Banking and Related Services

Answers

The Financial career in which Egan would be most successful is:

A)   Business Finance Management

 

Explanation: The Business Finance Management requires a lot of skill in planning and budgeting money. This career requires patience knowledge and understanding in tracking financial transactions. And all of these skills and knowledge are possessed by Egan that is why he can be most successful in Business Finance Management career.

The answer is: B) Financial Investment Planning

People who choose a career in financial investment planning need to be able to plan how to allocate other people's earning methodically so it could grow exponentially in the long run. This require deep skill in budgeting, patience, and ability to be calm in stressful occasions since financial investment planners would most likely have to face fluctuating market value that might not always be favorable.

_________ data includes sentiment mining in social media and tracking shopper behavior in stores.

Answers

Big Data encompasses sentiment mining in social media and tracking shopper behavior. It is utilized for extracting insights from large data sets, with sentiment analysis being a key tool for businesses and PR professionals to engage with audiences and adapt to market trends.

The type of data that includes sentiment mining in social media and tracking shopper behavior in stores is commonly referred to as Big Data. This data is characterized by its large volume, velocity, and variety, involving complex and sophisticated analyses. Businesses and organizations leverage Big Data to extract meaningful insights from patterns in social media, consumer behavior, and other sources. Techniques like data mining, sentiment analysis, and social listening are critical for understanding audience preferences and trends in real time.

Sentiment analysis, also known as opinion mining, is a valuable tool for companies and public relations (PR) professionals. It involves analyzing social media posts to gauge public opinion and react proactively to emerging trends. For example, real-time sentiment analysis helped L'Oreal Paris engage with consumers by responding to Tweets during the Golden Globe Awards, showing how data analysis can provide immediate marketing opportunities.

Data mining and statistical analysis play a crucial role in sifting through big data sets to discover usage patterns and consumer sentiments. This information is vital for industries to refine their marketing strategies, improve products, and even locate issues such as theft or counterfeit goods.

Macy's buys white, pinpoint oxford blouses at $14 each and sells them at $30 each. macy's percentage (of cost) markup is ________ percent.

Answers

To find Macy's percentage of cost mark up:

First; we need to find the Gross Profit Margin
Gross profit margin = sales price - unit cost
Gross profit margin = $30 - $14 
Gross profit margin = $16

Then; we will find the mark up percentage:
Markup percentage = gross profit margin/unit cost
Markup percentage = ($16/$14)(100) = 114.29%

which business type is notably the easiest to acquire ?

A. Licensing
B. Franchise
C. Sole proprietorship
D. C corporation

Answers

Answer:

sole proprietorship

Explanation:

Final answer:

A sole proprietorship is the easiest business type to acquire among the given options because it involves fewer legal complexities and paperwork than establishing a franchise, licensing or a C corporation. However, the owner also has unlimited personal liability for the business's debts or obligations.

Explanation:

Among the options provided, a sole proprietorship is notably the easiest to acquire. This is because setting up a sole proprietorship typically involves less paperwork and fewer legal intricacies than establishing a franchise, licensing, or a C corporation. Sole proprietorship is a business structure owned by a single individual who has full control over all the business operations and decisions.

Another advantage of a sole proprietorship is that the owner gets to keep all the profits. But, it also means the owner has the unlimited personal liability for any debts or obligations of the business. Therefore, while it's the easiest to acquire, it might not always be the best choice depending on the circumstances.

Learn more about sole proprietorship here:

https://brainly.com/question/33722313

#SPJ2

Other Questions
The sum of two angles in a triangle totals 117 degrees, what is the measure of the third angle What types of anthropologists explore all aspects of living human culturefrom war and violence to love, sexuality, and child rearingand look at the meanings that people from all over the world place on these things? Read this excerpt from "Goodbye to All That" by Joan Didion.We stayed ten days, and then we took an afternoon flight back to Los Angeles, and on the way home from the airport that night I could see the moon on the Pacific and smell jasmine all around and we both knew that there was no longer any point in keeping the apartment we still kept in New York.Which statement best explains how the imagery in the excerpt affects the meaning of the text?It highlights the isolation and loneliness of life in Los Angeles, demonstrating that Didion faces the same problems there that she faced in New York.It captures the beauty and serenity of life in Los Angeles, suggesting why Didion feels more content living there than she did in New York.It provides an unrealistic and idealized impression of Los Angeles, showing that Didion has not changed at all.It depicts the dark and mysterious atmosphere of Los Angeles, indicating why Didion is drawn to this new, exciting city. What is the equation, in slope-intercept form, of the line that is perpendicular to the line y 4 = 2/3(x 6) and passes through the point (2, 2)? y = 2/3x 10/3 y = 2/3x +10/3 y = 3/2x 1 y = 3/2x + 1 Your gross pay on your paycheck is $400. your deductions are as follows: federal income tax - $50.00 state income tax - $20.00 social security tax - $7.00 medicare tax - $3.50 please calculate your net pay (in dollars). question 2 options: Which statement accurately describe the role of decomposers in the carbon cycle? When parking downhill on a road with a curb, you should turn your front wheels __________ .A. parallel to the curbB. towards the curbC. towards the street Which of the following terms describes the primary core of a comet? two cards are drawn without replacement from a standard deck of 52 playing cards. find the probability that both are odd numbers (aces are considered odd because they have a value of 1 or 11). 14) Which BEST describes the way the Fourteenth Amendment affected the states?A)States had to give all citizens, regardless of their race or religion, equal protection under the law.B)States could no longer make any laws that were not approved by the federal government.C)States had to pass laws that gave more rights to freed slaves than to other citizens.D)States could no longer institute poll taxes or tests for citizens before they voted.2) The term "Reconstruction" in United States history refers to the period after what event?A)the Civil WarB)the Revolutionary WarC)the Constitutional ConventionD)the Declaration of Independence The major problem with hydrogen as an alternative source of energy is that none exists on the surface of the earth. a. True b. False Analyze the following statement: Marcus notices that he runs faster in the mornings rather than the evenings. Is the statement an example of correlation or causation? A. Correlation, because time of day doesn't cause a person to run faster or slower B. Causation, because Marcus has noticed this over several trials C. No relationship, because time of day has nothing to do with how fast a person runs D.There is not enough information to make a conclusion Which head glands secrete sucrase, lipase, amylase, and invertase? What is the measure of an angle that turns through 3/4 of a complete circle What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatctcatccagcattctgaaagggtaatgaataattattccgctgagttcatgaggtatccgaaggaggagcaacacttaggctataagagtatcatgcacatagatcgggataaatcgcctatcatatgtgacaacaatttcatgattaaaagt code for? Which is a pro-election of federal judges argument?A. When judges are elected they can be biased by party politics. B. When judges are elected there they can focus more time on reviewing law.C. Judges are more accountable to the people and what they think is just when they are elected Which statement displays an effect of developing a successful atomic bomb? Question 11 options: A.encouraged private sector employees to not share their discoveries with the government B.was the final time that the government and private sector combined to form any great invention C.served as a model for future government or private research and development labs to create innovationsD.proved that military innovation is always ahead of private innovation the graph shows the percentage of dog breeds affected by elbow dysplasia, which causes dogs to limp. What???s the most likely explanation for the mixed breed???s disease incidence? The probability is 0.2 that a person shopping at a certain store will What is the differecne of the following polynomials? (6x^2 - 3x^3) - (2x^3 + 4x^2 -5)