The equation y = 3.5x represents the rate, in miles
per hour, at which Laura walks.
The graph at right represents the rate at
which Piyush walks. Determine who walks
faster. Explain.

The Equation Y = 3.5x Represents The Rate, In Milesper Hour, At Which Laura Walks.The Graph At Right

Answers

Answer 1

Answer:

Piyush walks faster than Laura

Step-by-step explanation:

we know that

The rate or speed is equal to the slope of the linear equation

Laura

y=3.5x

The slope is [tex]3.5\ \frac{mi}{h}[/tex]

Piyush

Determine the slope of the line

we have the points

(0,0) and (4,18)

The line represent a direct variation (because passes through the origin)

so

[tex]m=\frac{y}{x}[/tex]

For x=4 h, y=18 mi

substitute

[tex]m=\frac{18}{4}=4.5\ \frac{mi}{h}[/tex]

Compare the slopes

[tex]4.5\ \frac{mi}{h} > 3.5\ \frac{mi}{h}[/tex]

therefore

Piyush walks faster than Laura

Answer 2

Answer:

Piyush walks faster than Laura

Step-by-step explanation:

Piyush walks faster than Laura


Related Questions

11. Is the fraction 1/3 equivalent to a terminating
decimal or a decimal that does not terminate?

Answers

Answer:

It is equivalent to a decimal that does not terminate.

Step-by-step explanation:

When you divide 1 by 3, you get 0.33333333333333333333333333333333333333333333333333333 forever. The decimal never ends.

13822 to 1 significant figure

Answers

If you wanna round 13822 to 1 significant figure you will need to find the nearest 10k, which is 10000 in this case

10000 = 1 . 10^4

That means

13822 ≈ 1 . 10^4 = 1(overline)0000

The Significant Figures will be 5 if the number is 13822 after using the definition of the Significant Figures the answer is 5.

What are significant figures?

Significant digits are the figures in a number that express the value -the size of a quantity to a specified degree of accuracy.

It is given that:

13822 to 1 significant figure

The number is 13822

Answer: 13822  

Significant Figures: 5

Decimals: 0

Scientific Notation: 1.3822e+4

Thus, the Significant Figures will be 5 if the number is 13822 after using the definition of the Significant Figures the answer is 5.

Learn more about the significant figures here:

brainly.com/question/14359464

#SPJ2

5. A grocer wishes to mix two kinds of nuts costing
$2.41 per pound and $3.65 per pound to make a
248 pounds of mixed nuts costing $2.51 per pound.
To determine the number of pounds of the $2.41
per pound nuts in the mixture, solve for x in the
equation 2.41x +3.65(248 - x) = 622.48. How
many pounds of the $2.41 per pound nuts should
included in the mixture?​

Answers

Ans:

The solve for x:

2.41x+3.65(248-x)=622.48

2.41x+3.65×248-3.65x=622.48

2.41x-3.65x+905.2=622.48

-1.24x=622.48-905.2

-1.24x= -282.72

x= -282.72÷ -1.24

x=228

Pounds of nuts nper pound $2.41should be included:

228× $2.41

=549.48

Hope it Helps!

The grocer should include approximately 227.84 pounds of the nuts that cost $2.41 per pound.

The grocer is trying to find the right balance of two kinds of nuts to reach a desired price point for a mix. The equation provided should be solved for x, which represents the number of pounds of nuts costing $2.41 per pound. Here is a step-by-step solution:

Begin with the given equation: 2.41x + 3.65(248 - x) = 622.48.

Distribute 3.65 across the parentheses: 2.41x + 3.65 * 248 - 3.65x = 622.48.

Combine like terms: -1.24x + 904.80 = 622.48.

Subtract 904.80 from both sides of the equation: -1.24x = -282.32.

Divide both sides by -1.24 to find x: x = 227.84.

So, the grocer should include approximately 227.84 pounds of the nuts that cost $2.41 per pound.

Six more than the product of a number and 7 is 4.

Answers

Answer:

[tex]- \frac{1}{2}[/tex]

Step-by-step explanation:

6x+7=4

6x+7-7=4-7

6x=-3

[tex]\frac{6x}{6}[/tex]=[tex]\frac{-3}{6}[/tex]

x=[tex]-\frac{1}{2}[/tex]

The length of a rectangle is 6 inches longer than it’s width. The perimeter is 96 inches. Find the dimensions (length and width) is the rectangle

Answers

Final answer:

To find the dimensions of the rectangle, we used the perimeter formula and set up equations to solve for the width (21 inches) and length (27 inches), given that the length is 6 inches longer than its width and the perimeter is 96 inches.

Explanation:

To solve for the dimensions of the rectangle when the length is 6 inches longer than its width and the perimeter is 96 inches, we need to set up two equations based on the perimeter formula for a rectangle, which is P = 2l + 2w, where P is the perimeter, l is the length, and w is the width.

Let w represent the width of the rectangle. Then, the length of the rectangle is w + 6 inches. By substituting these into the perimeter formula, we get:

96 = 2(w + 6) + 2w96 = 2w + 12 + 2w96 = 4w + 1284 = 4ww = 21

Now that we know the width is 21 inches, we can find the length by adding 6 inches to the width:

Length = Width + 6 = 21 + 6 = 27 inches

Therefore, the dimensions of the rectangle are 27 inches in length and 21 inches in width.

Final answer:

To find the dimensions of the rectangle, we used the perimeter formula and set up equations to solve for the width (21 inches) and length (27 inches), given that the length is 6 inches longer than its width and the perimeter is 96 inches.

Explanation:

To solve for the dimensions of the rectangle when the length is 6 inches longer than its width and the perimeter is 96 inches, we need to set up two equations based on the perimeter formula for a rectangle, which is P = 2l + 2w, where P is the perimeter, l is the length, and w is the width.

Let w represent the width of the rectangle. Then, the length of the rectangle is w + 6 inches. By substituting these into the perimeter formula, we get:

96 = 2(w + 6) + 2w

96 = 2w + 12 + 2w

96 = 4w + 12

84 = 4w

w = 21

Now that we know the width is 21 inches, we can find the length by adding 6 inches to the width:

Length = Width + 6 = 21 + 6 = 27 inches

Therefore, the dimensions of the rectangle are 27 inches in length and 21 inches in width.

Solve the equation-2x+8=-3x+14

Answers

Answer:

x = 6

Step-by-step explanation:

-2x + 8 = -3x + 14

Add 3x to both sides.

x + 8 = 14

Subtract 8 from both sides.

x = 6

Both sides of the equation are equal, the solution [tex]x = 6[/tex] is correct.

To solve the equation [tex]-2x + 8 = -3x + 14[/tex], you can follow these steps:

Move the variables to one side of the equation:

Add 3x to both sides of the equation to get the variables on one side:

[tex]-2x + 8 + 3x = -3x + 14 + 3x[/tex]

Simplify:

[tex]x + 8 = 14[/tex]

Isolate the variable:

Subtract 8 from both sides to isolate [tex]x[/tex]:

[tex]x + 8 - 8 = 14 - 8[/tex]

Simplify:

[tex]x = 6[/tex]

Check your solution:

Substitute [tex]x = 6[/tex] back into the original equation to ensure it satisfies the equation:

[tex]-2(6) + 8 = -3(6) + 14[/tex]

Simplify both sides:

[tex]-12 + 8 = -18 + 14[/tex]

[tex]-4 = -4[/tex]

the volume of a cylinder is about 1632 in. the height of the cylinder is 24 in. what is the area of the base?

Answers

Answer:

68 square inches

Step-by-step explanation:

Volume = Area × height

1632 = A × 24

A = 1632/24

= 68 inches squared

The area of the base of the cylinder is 68 inches².

What is a cylinder?

A cylinder is a three-dimensional figure that has a radius and a height.

The volume of a cylinder is given as πr²h.

Example:

The volume of a cup with a height of 5 cm and a radius of 2 cm is

Volume = 3.14 x 2 x 2 x 5 = 62.8 cubic cm

We have,

Volume = 1632 inches

Height = 24 inches

Volume = 1632

πr²h = 1632

πr² = 1632 / 24 = 68

Area of the base.

= πr²

= 68 inches²

Thus,

The area of the base is 68 inches².

Learn more about cylinder here:

https://brainly.com/question/15891031

#SPJ2

find the width and height of an older 40 inch television that has an aspect ratio of 4:3 find the area of this screen

Answers

Answer:

768 square inches

Step-by-step explanation:

see attached

Final answer:

The width and height of the 40 inch television with a 4:3 aspect ratio are 32 inches and 24 inches respectively. The area of the screen is 768 square inches.

Explanation:

To find the width and height of an older 40 inch television with an aspect ratio of 4:3, we can use the formula:
Width = aspect ratio * height
Since the aspect ratio is 4:3, we divide the width by 4 and multiply by 3 to find the height.
Therefore, the width of the television is 32 inches and the height is 24 inches.

To find the area of the screen, we use the formula:
Area = width * height
Substituting the values, we get:
Area = 32 inches * 24 inches
Therefore, the area of the screen is 768 square inches.

Learn more about Aspect ratio here:

https://brainly.com/question/35862758

#SPJ11


The length of a rectangle is 10 units longer than its width. If the total perimeter of the
rectangle is 44 units, what is the width?

Answers

2l + 2w = P
2(10) + 2w = 44
20 + 2w = 44
2w = 24
w = 12
The width is 12 units.

The width of the rectangle will be equal to 12 units.

What is a perimeter?

Perimeter is defined as the sum of all the sides of the given shape. The rectangle has four sides then the perimeter of the rectangle will be the sum of all the sides of the rectangle.

Given that length of a rectangle is 10 units longer than its width. The total perimeter of the rectangle is 44 units.

The width of the rectangle will be calculated as below:-

2l + 2w = P

2(10) + 2w = 44

20 + 2w = 44

2w = 24

w = 12

Therefore, the width of the rectangle will be equal to 12 units.

To know more about the perimeter of the rectangle follow

https://brainly.com/question/19819849

#SPJ2

What is the answer to -2+25x+17=-35

Answers

Your Answer is x = −2

Hope this Helps.

On a coordinate plane, parallelogram P Q R S is shown. Point P is at (negative 2, 5), point Q is at (2, 1), point R is at (1, negative 2), and point S is at (negative 3, 2). In the diagram, SR = 4 StartRoot 2 EndRoot and QR = StartRoot 10 EndRoot. What is the perimeter of parallelogram PQRS? StartRoot 10 EndRoot units 8 StartRoot 2 EndRoot + 2 StartRoot 10 EndRoot units 16 StartRoot 2 EndRoot units 8 StartRoot 2 EndRoot + 8 units

Answers

Answer:

The perimeter of parallelogram PQRS = [tex]2\sqrt{10}+8\sqrt{2}[/tex] ⇒

2nd answer

Step-by-step explanation:

* Lets revise some properties of the parallelogram

- Each two opposite sides are parallel

- Each two opposite sides are equal

- Its perimeter is the twice the sum of two adjacent sides

* Lets solve the problem

∵ PQRS is a parallelogram

∵ The length of side SR is [tex]4\sqrt{2}[/tex]

∵ The length of side QR is [tex]\sqrt{10}[/tex]

SR and RQ are two adjacent sides

∵ The perimeter of parallelogram PQRS = 2(RQ + SR)

∴ The perimeter of parallelogram PQRS = [tex]2(\sqrt{10}+4\sqrt{2})[/tex]

∵ [tex]2*\sqrt{10}[/tex] = [tex]2\sqrt{10}[/tex]

∵ [tex]2*4\sqrt{2}[/tex] = [tex]8\sqrt{2}[/tex]

∴ The perimeter of parallelogram PQRS = [tex]2\sqrt{10}+8\sqrt{2}[/tex]

The required perimeter of parallelogram PQRS is [tex]8\sqrt{2} + 2\sqrt{10}[/tex] units.

Given that,

On a coordinate plane, parallelogram PQRS,

There points are P is at (-2, 5), point Q is at (2, 1), point R is at (1, -2), and point S is at (-3, 2),

Length of SR = [tex]4\sqrt{2}[/tex] and QR = [tex]\sqrt{10}[/tex].

We have to find,

The perimeter of parallelogram PQRS.

According to the question,

The properties of the parallelogram is  each two opposite sides are parallel and each two opposite sides are equal.

Its perimeter is the twice the sum of two adjacent sides

Then,  PQRS is a parallelogram,

 SR and RQ are two adjacent sides,

The perimeter of parallelogram PQRS = 2(RQ + SR)

The perimeter of parallelogram PQRS = [tex]2 ( 4\sqrt{2} + \sqrt{10} )[/tex]

The, The perimeter of parallelogram PQRS = [tex]8\sqrt{2} + 2\sqrt{10}[/tex].

Hence, The required perimeter of parallelogram PQRS is [tex]8\sqrt{2} + 2\sqrt{10}[/tex] units.

For the more information about Parallelogram click the link given below.

https://brainly.com/question/15771657.

What is the simplified form of the fraction 108/162 ?

Answers

Answer:

Reduced fraction: 2/3

Answer: 2/3

Step-by-step explanation:

Find the GCD (or HCF) of numerator and denominator

GCD of 108 and 162 is 54

Divide both the numerator and denominator by the GCD

108 ÷ 54

162 ÷ 54

Reduced fraction:

2

3

Therefore, 108/162 simplified to lowest terms is 2/3.

Donna was playing a trivia game where you gained points for correct answers and lost points for incorrect answers. At the start of round 2 she was at −300 points. During round 2 she answered twelve 50 point questions correct and she answered four 50 points questions incorrect. What was her score at the end of the round 2? A) 50 B) 100 C) 200 D) 400

Answers

Step-by-step explanation:

B 100

Answer:

B

Step-by-step explanation:

Zenin earns $142 per shift at his new job. During a pay period, he works 12 shifts. What would his pay be for that period?

Answers

Answer:

total pay for his work is $1704

Step-by-step explanation:

given data

Zenin earns =  $142 per shift

total shifty = 12

to find out

What would his pay for 12  shift

solution

we have given per shift charge and total shift

so

total pay for his work = total shift × per shift charge    ................1

put here value

total pay for his work = 12 × $142

total pay for his work = $1704

Question:

15 5/12 - 11 1/8


A. 4 7/28

B. 4 7/12

C. -4 1/3

D. -4 7/24

Answers


The answer is 4 7/28. So it’s a

Solve for xxx.
-9x+5< 17\quad \maroonC{\text{ AND}} \quad 13x+25<-1−9x+5<17 AND13x+25<−1

Answers

Final answer:

To solve the inequalities, isolate x in each. The solution for -9x + 5 < 17 is x > -4/3 and the solution for 13x + 25 < -1 is x < -2. The intersection of these solutions, and thus the solution to the compound inequality, is x < -2.

Explanation:

We can solve the inequalities separately, then find the intersection of their solution sets. First, let's solve the inequality -9x + 5 < 17. To do this, we subtract 5 from both sides to isolate the term with x which gives -9x < 12. Finally, we divide both sides by -9, remembering to flip the inequality sign since we divided by a negative. This gives x > -4/3.

The second inequality 13x + 25 < -1 can be solved similarly. Subtracting 25 from both sides will get 13x < -26. Divide both sides by 13 to find that x < -2.

The final answer will be the intersection of the two solutions. Since x < -2 is a stricter condition than x > -4/3, the solution to the compound inequality is x < -2.

Learn more about Inequalities here:

https://brainly.com/question/30231190

#SPJ12

I’m looking for the answer to number 2

Answers

Answer: w = a/l

Step-by-step explanation:

If a = lw, then w = a/l

W = a/l is an equation to find the width if you already know both the a and l

7.21 repeating as a fraction

Answers

Answer: 721/100 is 7.21 as a simplified fraction.

Answer:

7.21 as a numerator and put 1 as a denominator now you multiply numerator and denominator by 10 as long as get in numerator the whole number 7.21=7.21 /1=7.21/10=7.21/100 and finally we have 7.21 as a fraction equals 7.21/100

Step-by-step explanation:

For a field trip 20 students rode in cars and
the rest filled nine buses. How many
students were in each bus if 236 students
were on the trip?

Answers

it is 11 students in the bus

Help me out. Can you figure this one out?

Answers

Answer:

x = 62

Step-by-step explanation:

Given that 2 sides of the triangle are congruent ( both 6 ), then the triangle is isosceles and the 2 base angles are congruent, thus

x = 0.5( 180 - 56)° = 0,5 × 124° = 62°

write 32/10 as a whole or mixed number in simplest form​

Answers

Step-by-step explanation:

To get the simplest form keep dividing until you can't anymore. So first I'll divide by 2 which equals 16/5 which can't be divided anymore because there is no common denominator.

32/10 = 16/5 = 3 1/5

What is the unit and standard form for 10 x 3 tens

Answers

Answer:

300

Step-by-step explanation:

All you do is multiply 10 by 30 [3 tens] to get three hundred.

I am joyous to assist you anytime.

Consider the following system of equations.

y=6x^2+1
y=x^2+4

Which statement describes why the system has two solutions?
Each graph has one y-intercept, which is a solution.
Each graph has one vertex, which is a solution.
The graphs of the equations intersect the x-axis at two places.
The graphs of the equations intersect each other at two places.

Answers

D.)  "The graphs of the equations intersect each other at two places."

Write a rule for the linear function with the following description. The graph contains the points (-3,-2) and (3, 0).

Answers

Answer:

[tex]y = \frac{1}{3} x -1[/tex]

Step-by-step explanation:

1. find the slope that includes the points (-3,-2) and (3,0)

[tex]\frac{y2-y1}{x2-x1} =m[/tex] ->slope

0-(-2)/3-(-3) = [tex]\frac{2}{6} (simplify) = \frac{1}{3}[/tex]

2. find the y-intercept

[tex]y = mx +b[/tex] -> slope-intercept form

plug in the y-coord. and the x-coord along with the slope you found (or rather I found) and solve. It could be from either coordinate given.

[tex]0=\frac{1}{3} (3)+b[/tex]

3. solve.

[tex]0 = 1 +b[/tex]

[tex]-1 = b[/tex]

4. write the equation with the slope and y-int you found and voila!

X divided by 6 is 4. What is Z?

Answers

Answer:

this is so hard

Step-by-step explanation:

What is 2.6666 as a fraction

Answers

To write 2.6666 as a fraction, write 2.6666 as the numerator with 1 as the denominator.

2.6666/1

Now you multiply numerator and denominator by 10000 to make the numerator a whole number ( no decimals)

26666/10000

Both numbers are even and can be divided by 2:

The fraction becomes: 13333/5000

Laura is selling raffle tickets. for every 4 tickets, she charge $28​

Answers

Answer:

$7.oo for one ticket

Step-by-step explanation:

if Laura is selling 4 tickets for $28 then you would divide 28 by 4 and that's your answer.

what could these numbers be?​

Answers

Answer:

A could be 50

e could be 120

d/o could be 150

e could be 180

The width of a rectangular park is 23.4 yards. What is the perimeter of the park if the length is 2.5 times larger than the width.

Answers

Answer:

163.8 yd

Step-by-step explanation:

The perimeter of a rectangle is twice the length added to twice the width.

The width is 23.4 yd.

The length is 2.5 times the width, so to find the length, we multiply the width by 2.5.

length = 2.5 * width = 2.5 * 23.4 yd = 58.5 yd

The length is 58.5 yd.

perimeter = 2 * length + 2 * width

perimeter = 2 * 58.5 yd + 2 * 23.4 yd

perimeter = 117 yd + 46.8 yd

perimeter = 163.8 yd

[tex]Hey![/tex]

-------------------------------------------------

[tex]\large\boxed{Perimeter~of~the~retangular~park~is~163.8~yards!}[/tex]

-------------------------------------------------

[tex]Steps To Solve:[/tex]

[tex]Find~the~length.[/tex]

[tex]23.4~*~2.5~=~58.5[/tex]

[tex]Find~the~perimeter.[/tex]

[tex]p~=~(length~*~2)~+~(width~*~2)[/tex]

[tex]p~=~(58.5~*~2)~+~(23.4~*~2)[/tex]

[tex]p~=~117~+~46.8[/tex]

[tex]p~=~163.8[/tex]

-------------------------------------------------

[tex]Hope~This~Helped!~Good~Luck![/tex]

Is 2/3 and 8/12 in equivalent ratio

Answers

Answer: if your question here is if they are the same since it says equivalent then yes

Step-by-step explanation: 2/3 = 8/12

Other Questions
to create a formula in______, you would first click in one of the cells Dr. Han is studying which brain structure is associated with aggressive behavior among rats. Which part of the brain is she likely to see activated when using neuroimaging techniques? Please i need big helpChoose the adjective clause in the following sentence: The jeans that I want to buy are very expensive.to buyare very expensivethe jeans thatthat I want to buyI want True or false tasks are required activities that need to take place in order to complete a goal Two train whistles have identical frequencies of 175 Hz. When one train is at rest in the station and the other is moving nearby, a commuter standing on the station platform hears beats with a frequency of 4.05 beats/s when the whistles operate together. What are the two possible speeds and directions the moving train can have? slower speed m/s Correct: Your answer is correct. faster speed m/s Changed: Your submitted answer was incorrect. Your current answer has not been submitted. The processivity of a DNA polymerase depends on all of the following actions, EXCEPT for __________. A. association of the DNA polymerase with a sliding clamp (like eukaryotic PCNA) B. interaction between the thumb domain of DNA polymerase and the DNA C. interaction between the minor groove of DNA and the palm domain of the DNA polymerase D. loss of the hydrogen from the 3-OH of the primer due to interaction with a divalent metal ion associated with the palm domain of the DNA polymerase the romans introduced and estabished a common system of written laws why was that important The economy of early villages and cities was based mainly on What is the solution to 4x+5y=12x6y=22 Edouard Daladier became Prime Minister of which country in 1933? A __________ is a wide-mouthed body of water close to shore. Cusic Industries had the following operating results for 2019: sales = $34,621; cost of goods sold = $24,359; depreciation expense = $6,027; interest expense = $2,725; dividends paid = $2,023. At the beginning of the year, net fixed assets were $19,970, current assets were $7,075, and current liabilities were $4,010. At the end of the year, net fixed assets were $24,529, current assets were $8,702, and current liabilities were $4,700. The tax rate was 25 percent. a. What is net income for 2019? (Do not round intermediate calculations.) b. What is the operating cash flow for 2019? (Do not round intermediate calculations.) c. What is the cash flow from assets for 2019? (A negative answer should be indicated by a minus sign. Do not round intermediate calculations.) d-1. If no new debt was issued during the year, what is the cash flow to creditors? (Do not round intermediate calculations.) d-2. If no new debt was issued during the year, what is the cash flow to stockholders? (A negative answer should be indicated by a minus sign. Do not round intermediate calculations.) Evaluate M2/P2 for M = 10, N = -5, and P = -2? A.-5 B.5 C.-25 D.25 Read the sentences. Sentence 1: I hope the dinner comes out perfectly, but even if it doesnt, Im pretty sure theyll know how hard I tried. Sentence 2: Then well have coffee cake for dessert, which I made from scratch. Sentence 3: I am making my sisters favorite: roasted chicken, brown rice, and brussels sprouts. Sentence 4: I cannot wait to cook dinner for my family tonight. What is the most logical sequence for these sentences in a story? 1, 3, 2, 4 4, 1, 3, 2 4, 3, 2, 1 3, 2, 1, 4 An RNA virus that infects plant cells is copied into a DNA molecule after it enters the plant cell. What would be the sequence of bases in the first strand of DNA made complementary to the section of viral RNA shown here? 5' CCCUUGGAACUACAAAGCCGAGAUUAA 3' Reasoning if you multiply two decimals that are less than 1,can you predict whether the product will be less thanor greater than either of the factors? Explain What is the greatest common factor of 19 and 18? What happened as a result of the Sand Creek Massacre? Please select the word from the list that best fits the definition Likes to study with music in the background Which function has the given graph?