The formula for the area of a triangle is A = 1/2bh, where b is the length of the base and h is the height. The equation solved for h is h =2a/b The formula for the area of a triangle is A = bh, where b is the length of the base and h is the height. The equation solved for h is h = . Find the height of a triangle that has an area of 30 square units and a base measuring

12 units. 3 units 5 units 8 units 9 units

Answers

Answer 1
the height is 5 units, if you want an explanation just say so ^^
Answer 2

the answer is 5 units i know this because i just took a test with this question


Related Questions

Does anybody have the answer, please?

Answers

Hello,

x is half of arc 148°

x=148/2
x=74

The tangent ratio compares the length of what to the length of what

Answers

By definition in a triangle with a right angle, the tangent compares two of its sides:
 Tanx = (C.O) / (C.A)
 Where,
 x: angle
 C.O: Opposite leg.
 C.A: Adjacent leg.
 Therefore the tangent compares the length of the opposite leg with the length of the adjacent leg.
 Answer:
 the tangent compares the length of the opposite leg with the length of the adjacent leg
 Tanx = (C.O) / (C.A)

If you rewrite the problem 14(22) as 14(20+2) so that you can use mental math, which of the following properties will you use?
*nevermind I got it* 

Answers

For this case, the property you can use is the following:
 Commutative property.
 We have then that:
 14 (20 + 2) = 280 + 28 = 308
 Equivalently:
 14 (2 + 20) = 28 + 280 = 308
 Either way the result is exactly the same.
 Answer: 
 Commutative property.

Three survey markers are located on a map at points H, I, and J. A triangle is formed by connecting these markers by string so that HI = 150 feet, HJ = 245 feet,and IJ = 365 feet.

Which statement is true about the measures of the angles of TriangleHIJ?

f m∠I is the largest
g m∠H is the largest
h m∠H is the smallest
j m∠I is the smallest

Answers

Hello,

In a triangle,
to the longest side is opposed the bigest angle
==>answer g :  m∠H is the largest

The measure of the side IJ is the longest one so the largest angle is ∠H. Then the correct option is B.

What is the triangle?

The polygonal shape of a triangle has a number of sides and three independent variables. Angles in the triangle add up to 180°.

Three survey markers are located on a map at points H, I, and J. A triangle is formed by connecting these markers by string so that HI = 150 feet, HJ = 245 feet, and IJ = 365 feet.

If the side is the largest one then its opposite angle will be the largest one.

The measure of the side IJ is the longest one so the largest angle is ∠H. Then the correct option is B.

More about the triangle link is given below.

https://brainly.com/question/25813512

#SPJ5

In the figure, TR−→− and TV−→− are secants to circle A. mRV=99∘ mSU=45∘ What is the measure of ∠RTV ? Enter your answer in the box.

Answers

The answer is 27 I just took the test and it was correct.

The difference between 3.6 and a number is 2.95, as shown below. What number should go in the box to complete the subtraction problem?

Numerical Answers Expected!

Answers

The missing number is 6.   3.6-.65 = 2.95
3.6 - 2.95 = .65

Hope it helps ;)))

1. Astronomers measure large distances in light-years. One light year is the distance that light can travel in one year, or approximately 5.88 x 10^12 miles. Suppose a star is 9.8 x 10^1 light years from Earth. In scientific notation, approximately how many miles is it?

A. 5.88 x 10^13 miles
B. 5.76 x 10^14 miles
C. 5.88 x 10^12 miles
D. 9.8 x 10^12 miles


2. A 1,600.00 principal earns 7% annual interest, compounded semiannually (twice per year). After 33 years, what is the balance in the account?

A. $4,979.11
B. $14,920.54
C. $112,992.00
D. $15,494.70

Answers

1. Distance: d=9.8x10^1 light years
d=9.8x10^1x5.88x10^12 miles
d=57.6x10^13 miles
d=5.76x10^14 miles

Answer: Option B. 5.76x10^14 miles

2. Principal: P=1,600
Annual interest: i=7%=7/100→i=0.07
Number of years: t=33
Balance: B=?
Compounded semiannually (twice per year) → n=2

B=P(1+i/n)^(nt)

Replacing the values:
B=$1,600(1+0.07/2)^(2x33)
B=$1,600(1+0.035)^66
B=$1,600(1.035)^66
B=$1,600(9.684185201)
B=$15,494.69632
B=$15,494.70

Answer: Option D. $15,494.70

Final Answer:

The answers are:
1. B. 5.76 x 10¹⁴ miles
2. D. $15,494.70

Explanation:

Let's solve each of these questions step by step.
Question 1:
First, we'll calculate the distance to the star in miles, given its distance in light years.
One light year is approximately 5.88 x 10¹² miles.
The star is 9.8 x 10¹ light years from Earth.

To find the distance in miles, we multiply the distance in light years by the length of one light year in miles:
Distance in miles = (5.88 x 10¹² miles/light year) * (9.8 x 10¹ light years)

To multiply these numbers in scientific notation, we multiply the coefficients (5.88 and 9.8) and then add the exponents of 10 (12 and 1).
Coefficient multiplication: 5.88 * 9.8
Using a calculator or doing the multiplication by hand, we find that 5.88 * 9.8 is approximately 57.624.
Exponent addition: 12 + 1 = 13

So the distance in miles is approximately 57.624 x 10¹³ miles.

However, in scientific notation, the coefficient should be between 1 and 10. Therefore, we need to adjust the coefficient from 57.624 to 5.7624 and increase the exponent by 1 to keep the same value.
Distance in miles = 5.7624 x 10¹⁴ miles

To make it approximately and match the answer choices, we can round the coefficient to 5.76.
Distance in miles ≈ 5.76 x 10¹⁴ miles

The closest answer to our computed value is:
B. 5.76 x 10¹⁴ miles

Question 2:
Next, let's use the compound interest formula to find the balance in the account after 33 years.
The compound interest formula is:
[tex]A = P (1 + r/n)^{(nt)[/tex]
where:
A is the amount of money accumulated after n years, including interest.
P is the principal amount (the initial amount of money).
r is the annual interest rate (decimal).
n is the number of times that interest is compounded per year.
t is the time the money is invested for, in years.

We're given:
P = $1,600.00
r = 7% annual interest = 0.07 (as a decimal)
n = 2 (since interest is compounded semiannually)
t = 33 years

Plugging these values into the formula gives us:
[tex]A = 1600.00 * (1 + 0.07/2)^{(2*33)[/tex]
Let's break it down:

Interest rate per compounding period: 0.07/2 = 0.035
Number of compounding periods: 2*33 = 66

Now substitute these values:
A = 1600 * (1 + 0.035)⁶⁶

We calculate (1 + 0.035)^66 using a calculator:
(1 + 0.035)⁶⁶ ≈ (1.035)⁶⁶ ≈ 9.682

So the final balance is:
A ≈ 1600 * 9.682 ≈ 15491.2

The closest answer to our computed value is:
D. $15,494.70

Hence, the answers are:
1. B. 5.76 x 10¹⁴ miles
2. D. $15,494.70

What number is 35% of 22?

Answers

Hello,

Here is your answer:

The proper answer to this question is "7.7"

Here is how:

35*22
_____
100

=7.7

Your answer is 7.7!

If you need anymore help feel free to ask me!

Hope this helps!

The strength of the force of gravity depends ona.the masses of the objects and their speeds.
b.the masses of the objects and the distance between them.
c.the weight of the objects and their speeds.
d.the masses of the objects and their weights.

Answers

B) The mass of objects and the distance between them.

Choose an equation for the relationship between the measures of the segments, angles, and arcs.

Answers

I think it is the last one.

The correct equation for the relationship between the measures of the segments, angles, and arcs is [tex]PR^2[/tex] = PS * PT. The last option is the right choice.

Power of a Tangent: We know that the power of a point from an external point P to a circle is equal to the product of the lengths of the two tangents drawn from P to the circle (PQ * PR = PS * PT).

Identify the Tangents and Secant: In the given diagram, PR is the secant intersecting the circle at points T and S, and PQ and PS are the tangents drawn from P to points Q and S, respectively.

Apply the Power of a Tangent Theorem: Since PS and PT are tangents from P, we can apply the power of a tangent theorem to get:

PS * PT = PQ * PR.

Substitute PQ with PR: Since PQ and PR are both tangents drawn from the same point P, they have the same length (PQ = PR). Substituting PQ with PR in the equation, we get:

PS * PT = PR * PR.

Simplify the Equation: Simplifying the equation PR * PR = PS * PT, we get the final equation:

[tex]PR^2[/tex] = PS * PT.

Therefore, the equation [tex]PR^2[/tex] = PS * PT correctly represents the relationship between the measures of the segments, angles, and arcs in the given diagram.

The last option is the right choice.

Kenny has $1,400 in the bank. He earns $150 every week at his afterschool job. What is the rate of change for the scenario described?

2
150
300
1,400
@tylermcmullen23,

Answers

The rate of change would be equal to the amount of money that Kenny is earning every week, since there are no expenses that are removing money from his account. In this case, it would be the $150 that he is putting into the account weekly.

Answer:

150

Step-by-step explanation:

The surface area of a rectangular prism is 792 units2. The length of the prism is 2 times the width, and the width is 4 times the height. What is the volume of the prism?

Answers

Answer:

The real answer is 846 ^-^ I got it right

The volume of the rectangular prism is 105.57

What is the volume of a rectangular prism?

A rectangular prism is a three-dimensional shape that has two at the top and bottom and four are lateral faces.

The volume of a rectangular prism=Length X Width X Height

Where l, h and w represent the length, height and width respectively.

Given that;

Length of the prism is 2 times the width L = 2w

the width is 4 times the height  w = 4h

Now let’s plug these values;

the surface area equation, it becomes;

A = 2(2w(w) + w(w/4) + w/4(2w))

A = 2(2w^2 + w^2/4 + w^2/2)

A = 1/2(7w^2)

792 x2 = 7w^2

w = 15.04

The volume of a rectangular prism=Length X Width X Height

V = 2w x w x w/4

V x 2 = w³

V = 15.04³/2

V = 105.57

Thus, the volume is 105.57.

Learn more about a rectangular prism;

https://brainly.com/question/21308574

#SPJ2

BRAINLIESTTTT!!!
If Mary pitches a baseball with the initial height of 6 feet and a velocity of 73 feet per second, how long will it take for the ball to hit the ground? :)

Answers

x = [ -73 +/- sqrt (73^2 - 4 * -16 *6) ] / (2 * -16)

73^2 - 4 * -16 * 6 = 5713

sqrt 5713= 75.58

(-73 - 75.58) / -32 = 4.64

Good luck :)
when the ball hits the ground H(t) =, 0 so just plug in 0 for H(t) , 6 for s and 73 for v, then solve for t.

 Hope this helps!

What is the radian measure of the central angle of an arc that has an arc length of 3 units and a radius of 4 units?

Find the arc length intercepted by a central angle of pi/2 radians in a circle whose radius is 24 inches.

Find the measure of a central angle that intercepts an arc of 27 inches in a circle whose radius is 10 inches.

Answers

The radius of circle(r), the arc length(s) and the angle subtended by the arc at the center of the circle(Ф) are related by the following equation:

s = rФ

For the first question, we have the arc length (3 units) and the radius of circle (4 units) and we need to find the radian measure of central angle of the arc. Substituting the values in the above formula we get:

3=4Ф

Ф=3/4 = 0.75 radians


For the second question, we have the central angle (π/2 radians) and the radius of circle(24 inches). We need to find the length of the arc. Substituting the values in above equation, we get:

s = 24 x (π/2) = 12π inches

The third question is similar to the first one. The arc length is given (27 inches) and radius of circle is given to be (10 inches). We are to find the radian measure of central angle. Substituting the values in above equation, we get:

27=10Ф

Ф=2.7 radians

Answer:

Step-by-step explanation:

What is the measure of the central angle?

Answer : 140°

What ratio represents the measure of the central angle compared to the measure of the entire circle?

Answer7/18

If s = , what is the length of minor arc AB?

Answer : 14π

PLEASE PLEEAASE HELP!! You have a 5-question multiple-choice test. Each question has four choices. You don’t know any of the answers. What is the experimental probability that you will guess exactly three out of five questions correctly? Type your answer below using complete sentences,

Answers

The number of ways to permute three correct answers among five questions is 5Choose3 which is 5!/(3!*2!) which equals 10. We must then have the correct answer three times which happens .25 of the time, and two wrong answers 75 of the time. So the probability is 10*0.25^3*.75^2 which is 0.087890625 or roughly an 8.8% chance.

All the events for the volunteer committee need to be finished;____, parents' day needs to be completed.

Choose the transitional word or phrase that best fits the blank.

A. In essence
B. Similarly
C. Finally
D. In particular

Answers

All the events for the volunteer committee need to be finished; B. Similarly, parents' day needs to be completed. 

We use the term "similarly" because the volunteer committee and parents' day events are not related, but both need to be completed. The word "similarly" is used to compare the two events by stating that they both need to be completed.

What would the total bill be of painting the costs $44.80 with the tax rate of 6%?

Answers

$47.488

Hope this helped!

Paint costing $44.80 plus a 6% tax would be:
44.80*1.06 = 47.488 Rounded to $47.49

1. Based on the information given, can you determine that the quadrilateral must be a

parallelogram? Explain.

Given: (BE) ̅  (ED) ̅ and (AE) ̅  (EC) ̅


2. The parallelogram has the angle measures shown. Can you conclude that it is a rhombus, a rectangle, or a square? Explain.

Answers

Solving Q1: Given BE = ED and AE = EC.

Considering triangles ΔAED and ΔCEB;

1. AE = EC (given)

2. ∠AED = ∠CEB (vertical angles)

3. ED = EB (given)

ΔAED ≡ ΔCEB (Side-Angle-Side congruency of triangles)

∠DAE = ∠BCE and AD = BC (using CPCTC)

AD║BC (Converse of Alternate Interior angles theorem)


Similarly consider triangles ΔABE and ΔCDE;

1. AE = CE (given)

2. ∠BEA = ∠DEC (vertical angles)

3. BE = DE (given)

ΔABE ≡ ΔCDE (Side-Angle-Side congruency of triangles)

∠ABE = ∠CDE and AB = CD (using CPCTC)

AB║CD (Converse of Alternate Interior angles theorem)


Since we have AB║CD, AB = CD and AD║BC, AD = BC.

Therefore, quadrilateral ABCD is a parallelogram.

****************************************************************************************************

Solving Q2: The parallelogram has the angle measures shown in the diagram.

It is clearly visible that both the triangles are Isosceles triangles, so opposite sides in each triangle are equal.

Consider two triangles given in the problem, we have two sets of congruent angles and one included side is common in both triangles.

Using Angle-Side-Angle congruence of triangles, both the triangles would be congruent too.

Using CPCTC, we can say opposite sides of quadrilateral would be congruent.

Therefore, all sides in given quadrilateral are equal.

Hence, Given quadrilateral is a Rhombus.

If possible, choose k so that the following function is continuous on any interval:

f(x)= (5x^4-20x^3)/(x-4) , x≠4
f(x)= K , x=4

k=?,

Answers

We need to cancel out the discontinuity in x = 4

In order to do that, factorize the numerator:
5x⁴ - 20x³ = 5x³(x-4)

This way, your function will be:
f(x) = 5x³(x-4) / (x-4)

and the two parentheses cancel out, leaving
f(x) = 5x³ 

which at x = 4 gives:
f(4) = 5·4³ = 5 · 64 = 320

Therefore K = 320.

Using continuity concepts, it is found that K = 320 makes the function continuous.

------------------

A function f(x) is said to be continuous at x = a if:

[tex]\lim_{x \rightarrow a^{-}} = \lim_{x \rightarrow a^{+}} = f(a)[/tex]

------------------

The piece-wise function given is:

[tex]f(x) = \frac{5x^4 - 20x^3}{x-4}, x \neq 4[/tex]

[tex]f(x) = K, x = 4[/tex]

------------------

The definition for x different of 4 can be simplified, as follows:

[tex]f(x) = \frac{5x^4 - 20x^3}{x-4} = \frac{5x^3(x - 4)}{x - 4} = 5x^3[/tex]

Thus, the simplified definition is:

[tex]f(x) = 5x^3, x \neq 4[/tex]

[tex]f(x) = K, x = 4[/tex]

------------------

For the lateral limits, x is close to but not exactly 4, so the first definition is used.

[tex]\lim_{x \rightarrow 4^-} = \lim_{x \rightarrow 4} 5x^3 = 5(4)^3 = 5 \times 64 = 320[/tex]

[tex]\lim_{x \rightarrow 4^+} = \lim_{x \rightarrow 4} 5x^3 = 5(4)^3 = 5 \times 64 = 320[/tex]

------------------

For continuity, it is needed that:

[tex]f(4) = 320[/tex]

Thus:

[tex]K = 320[/tex] makes the function continuous.

A similar problem is given at https://brainly.com/question/14755764

cole grew 2 3/4 inches last year kelly grew the same amount which fraction below represent the number of inches that kelly grew last year

Answers

the answer is 2 3/4 because Kelley grew just as much as Cole. You might have to simplify some of the answers in your multiple choice question do it makes 2 3/4.
You didn't mention the fraction however, 

2 3/4 can be 11/4 as an improper fraction.

3/4 can change into anything such as, 12/16 or 3000/4000 while 2 still remains the same.
Let me know if you need any additional help. =)

MAJOR HELP NEEDED!

Lea knows the following information about the 50 days where she tracked whether she wore a tie and whether she received a compliment on her outfit:

-There were 11 days where she neither wore a tie nor received a compliment.
-There were 30 days in total where she received a compliment.
-There were 16 days in total where she did not wear a tie.

Can you help Lea organize the results into a two-way frequency table?

Answers

Answer  with explanation:

We know that a two-way frequency table is constructed when we have to deal with two variables ( which is also known as a bivariate data)

Here we have two variables as wore a tie or not and the second variable is: Received compliment or not.

Hence, on the basis of the information provided to us in the question we see that the two-way frequency table is obtained as follows:

                                               Wore tie          Do not wore tie     Total

Receive compliment                 25                         5                       30

Do not receive compliment       9                         11                       20

        Total                                 34                         16                       50

The considered data given about the frequencies of events can be used to fill the two-way frequency table. The values will be 25 and 5 in first row, and 9 and 11 in second row.

How to form two-way frequency table?

Suppose two dimensions are there, viz X and Y. Some values of X are there as [tex]X_1, X_2, ... , X_n[/tex] and some values of Y are there as [tex]Y_1, Y_2, ... , Y_n[/tex]

List them in title of the rows and left to the columns. There will be [tex]n \times k[/tex] table of values will be formed(excluding titles and totals), such that:

Value(ith row, jth column) = Frequency for intersection of  [tex]X_i[/tex]  and [tex]Y_j[/tex]  (assuming X values are going in rows, and Y values are listed in columns).

Then totals for rows, columns, and whole table are written on bottom and right margin of the final table.

For n = 2, and k = 2, the table would look like:

[tex]\begin{array}{cccc}&Y_1&Y_2&\rm Total\\X_1&n(X_1 \cap Y_1)&n(X_1\cap Y_2)&n(X_1)\\X_2&n(X_2 \cap Y_1)&n(X_2 \cap Y_2)&n(X_2)\\\rm Total & n(Y_1) & n(Y_2) & S \end{array}[/tex]

where S denotes total of totals, also called total frequency.

n is showing the frequency of the bracketed quantity, and intersection sign in between is showing occurrence of both the categories together.

We're given that:

There were 11 days where she neither wore a tie nor received a compliment.There were 30 days in total where she received a compliment.There were 16 days in total where she did not wear a tie.

If we take:

A = event of Lea wearing a tie on a day

A' = event of Lea not wearing a tie on a day

B = event of Lea getting a compliment on a day

B' = event of Lea not getting a compliment on a day

then, we're given that:

[tex]n(A' \cap B') = 11\\n(B) = 30\\n(A') = 16[/tex]

Also, total number of days = S = 50

On each of those 50 days, she either wore a tie or not.

If she didn't put on a tie on 16 out of 50 days, then she wore tie for 50-16=34 days.

Thus, we get n(A) = 34

Similarly, we get n(B') = 50 - n(B) = 50 - 30 = 20

[tex]\begin{array}{cccc}&A&A'&\rm Total\\B&n(B\cap A)&n(B\cap A')&n(B)=30\\B'&n(B' \cap A)&n(B' \cap A')=11&n(B')=20\\\rm Total & n(A)=34 & n(A')=16 & S=50 \end{array}[/tex]

Using the total of the third row, we get:

[tex]n(B' \cap A) + 11 = 20\\n(B' \cap A) = 9[/tex]

Similarly, now using second column's total, we get:

[tex]n(B \cap A) + n(B' \cap A) = 34\\n(B \cap A) + 9 = 34\\n(B \cap A) = 25[/tex]

Now using second row's total, we get:

[tex]25 + n(B \cap A') = 30\\n(B\cap A') = 5[/tex]

Thus, we get:

[tex]\begin{array}{cccc}&A&A'&\rm Total\\B&n(B\cap A)=25&n(B\cap A')=5&n(B)=30\\B'&n(B' \cap A)=9&n(B' \cap A')=11&n(B')=20\\\rm Total & n(A)=34 & n(A')=16 & S=50 \end{array}[/tex]

Thus, finally, we can say that:

                                                  Wore a tie,               Didn't wore a tie

Got a compliment                         25                                    5

Didn't got a compliment               9                                      11

Thus, the values will be 25 and 5 in first row, and 9 and 11 in second row.

Learn more about two-way table here:

https://brainly.com/question/26788374

#SPJ3

Jason knows that the equation to calculate the period of a simple pendulum is , where T is the period, L is the length of the rod, and g is the acceleration due to gravity. He also knows that the frequency (f) of the pendulum is the reciprocal of its period. How can he express L in terms of g and f?

Answers

1/f = 2π√(L/g)
1/(2πf) = √(L/g) . . . . . divide by 2π
1/(2πf)^2 = L/g . . . . . .square both sides
g/(2πf)^2 = L . . . . . . .multiply by g

L = g/(4π^2f^2) . . . . . . . matches the 1st selection

Answer-

[tex]\boxed{\boxed{L=\dfrac{g}{4\pi^2 f^2}}}[/tex]

Solution-

The equation for time period of a simple pendulum is given by,

[tex]T=2\pi \sqrt{\dfrac{L}{g}}[/tex]

Where,

T = Time period,

L = Length of the rod,

g = Acceleration due to gravity.

Frequency (f) of the pendulum is the reciprocal of its period, i.e

[tex]f=\dfrac{1}{T}\ \Rightarrow T=\dfrac{1}{f}[/tex]

Putting the values,

[tex]\Rightarrow \dfrac{1}{f}=2\pi \sqrt{\dfrac{L}{g}}[/tex]

[tex]\Rightarrow (\dfrac{1}{f})^2=(2\pi \sqrt{\dfrac{L}{g}})^2[/tex]

[tex]\Rightarrow \dfrac{1}{f^2}=4\pi^2 \dfrac{L}{g}[/tex]

[tex]\Rightarrow L=\dfrac{g}{4\pi^2 f^2}[/tex]

Let set C = {even numbers between 1 and 99} and set D = {numbers between 1 and 150 that are evenly divisible by 10}.

What is C ∩ D?
@ganeshie8,

Answers

In case of Set C the possible set is {2,4,6,....98} and in case of Set D, the possible set is given by { 10, 20, 30,...150}. Now C ∩ D means the set that is common to both C and D. Let's name the set as E. Hence Set E will have {10,20,30,40,50,60,70,80,90} Hence there are 9 observations which are common to both Set C and Set D.

The stem-and-leaf plot shows the number of home runs hit by the top major league baseball players in the 2000 season. stem leaf 3 0 0 0 0 1 1 1 1 1 1 1 2 2 2 3 3 4 4 4 5 5 5 6 6 6 7 7 8 8 9 4 0 1 1 1 1 2 2 3 3 3 4 4 7 7 9 5 0 3⏐0 ? 30 what is the probability that one of these players picked at random hit more than 35 home runs

Answers

first count the number of players then count the number of players with more than 35 home runs.
the probability is number of players with more than 35 home runs divided by number of players

a horse trots in a circle at the end of a 4m rope. About how far does the horse trotted after completing ten circles?

Answers

251.33m. First find the distance around one circle then times by ten for all the circles.
Circumference of each circle=2x(pi)xr
=2(Pi)x10
=25.13
For ten circles=25.13x10
=251.33
--------------------------------------------------
Find 1 round
--------------------------------------------------

1 round of the circle = πD
1 round of the circle = π(2x4)
1 round of the circle =8π

--------------------------------------------------
Find 10 rounds
--------------------------------------------------

10 round of the circle = 8π x 10 
10 round of the circle = 80π
10 round of the circle = 251.33 m

--------------------------------------------------
Answer: 251.33 m
--------------------------------------------------

The sum of three consecutive even integers is 222. find the three integers.

Answers

x + (x+1) + (x+2) = 222
3x = 219
x = 73

Integers are 73 74 and 75


Which expressions are equivalent to the one below? Check all that apply. 9x

Answers

Answer:

C.),F.),andD.) Are correct

Step-by-step explanation:

Answer:

Option: C, D and F are the correct options.

C.   [tex](\dfrac{36}{4})^x[/tex]

D.   [tex]9\cdot 9^{x-1}[/tex]

F.  [tex]\dfrac{36^x}{4^x}[/tex]

Step-by-step explanation:

We are asked to find the expression which is equivalent to:

                                        [tex]9^x[/tex]

C)

 [tex](\dfrac{36}{4})^x[/tex]

We know that:

[tex](\dfrac{36}{4})^x=9^x[/tex]

Since, 36/4=9

Hence, option: C is correct.

D)

[tex]9\cdot 9^{x-1}=9^{1+x-1}[/tex]

Since,

[tex]a^m\cdot a^n=a^{m+n}[/tex]

Hence,

[tex]9\cdot 9^{x-1}=9^x[/tex]

Hence, option: D is correct.

F)

[tex]\dfrac{36^x}{4^x}[/tex]

We know that:

[tex]\dfrac{36^x}{4^x}=(\dfrac{36}{4})^x[/tex]

Since, we know that:

[tex]\dfrac{a^n}{b^n}=(\dfrac{a}{b})^n[/tex]

Hence, we have:

[tex]\dfrac{36^x}{4^x}=9^x[/tex]

Since, 36/4=9

Hence, option: F is the correct answer.

Write an equation for the line whose data is in the table below
X:1 2 5
Y: 4 6 12

Answers

y=2x+2
this is the equation for the graph

please help 1. another term for adding money to an account is
A) additional
B) submission
C) contribute
D) payment


2. which situation allows you to have the most saved
A) having a set amount set aside for savings each time you are paid
B) having a set minimum or percentage for saving whichever is greater
C) having a percentage set aside for savings
D) having a percentage set aside for savings when your pay is higher and hours are more

Answers

Payment. While payment is the sum of money paid in exchange for something either goods and services; the money can be credited (or added) into an account directly without making direct payment. We can also credit our account which is also payments. The most efficient way of building a savings is having a set minimum or percentage for saving whichever is greater. Sometimes we may need to save more than our "set minimum" especially when we earn more. The higher we earn the more our set minimum pales in comparison to what we ought to save. On the other hand if we have a set percentage it would also need to be raised higher when we earn more, but saving whichever is greater ensures that we make the best and most efficient savings decision at any period in time.
Answer:

1. Another term for adding money to an account is - contribute

One should contribute to his account. This phrase means, one should add money to his account. Contribution is addition of money in account.

2. Which situation allows you to have the most saved ?

A) having a set amount set aside for savings each time you are paid- this can be the most possible answer. Technically a person should save 20% to 25% of his income and this amount increases with income. So, each time when you are paid, set aside the savings amount.


Rachel is selling T-shirts. It costs her $5 each week to advertise her T-shirts. She buys each T-shirt for $3.50 and sells each one for $8.00. Write an equation to model the amount of profit, P, she makes from selling x T-shirts in one week.

P = 3.50x − 5
P = 8x − 3.5
P = 5x + 3.5
P = 4.5x − 5

Answers

net profit from selling one t-shirt=(8-3.5=$4.5)
so
P=4.5x-5
Other Questions
Read this excerpt from "Goodbye to All That" by Joan Didion.We stayed ten days, and then we took an afternoon flight back to Los Angeles, and on the way home from the airport that night I could see the moon on the Pacific and smell jasmine all around and we both knew that there was no longer any point in keeping the apartment we still kept in New York.Which statement best explains how the imagery in the excerpt affects the meaning of the text?It highlights the isolation and loneliness of life in Los Angeles, demonstrating that Didion faces the same problems there that she faced in New York.It captures the beauty and serenity of life in Los Angeles, suggesting why Didion feels more content living there than she did in New York.It provides an unrealistic and idealized impression of Los Angeles, showing that Didion has not changed at all.It depicts the dark and mysterious atmosphere of Los Angeles, indicating why Didion is drawn to this new, exciting city. What is the equation, in slope-intercept form, of the line that is perpendicular to the line y 4 = 2/3(x 6) and passes through the point (2, 2)? y = 2/3x 10/3 y = 2/3x +10/3 y = 3/2x 1 y = 3/2x + 1 Your gross pay on your paycheck is $400. your deductions are as follows: federal income tax - $50.00 state income tax - $20.00 social security tax - $7.00 medicare tax - $3.50 please calculate your net pay (in dollars). question 2 options: Which statement accurately describe the role of decomposers in the carbon cycle? When parking downhill on a road with a curb, you should turn your front wheels __________ .A. parallel to the curbB. towards the curbC. towards the street Which of the following terms describes the primary core of a comet? two cards are drawn without replacement from a standard deck of 52 playing cards. find the probability that both are odd numbers (aces are considered odd because they have a value of 1 or 11). 14) Which BEST describes the way the Fourteenth Amendment affected the states?A)States had to give all citizens, regardless of their race or religion, equal protection under the law.B)States could no longer make any laws that were not approved by the federal government.C)States had to pass laws that gave more rights to freed slaves than to other citizens.D)States could no longer institute poll taxes or tests for citizens before they voted.2) The term "Reconstruction" in United States history refers to the period after what event?A)the Civil WarB)the Revolutionary WarC)the Constitutional ConventionD)the Declaration of Independence The major problem with hydrogen as an alternative source of energy is that none exists on the surface of the earth. a. True b. False Analyze the following statement: Marcus notices that he runs faster in the mornings rather than the evenings. Is the statement an example of correlation or causation? A. Correlation, because time of day doesn't cause a person to run faster or slower B. Causation, because Marcus has noticed this over several trials C. No relationship, because time of day has nothing to do with how fast a person runs D.There is not enough information to make a conclusion Which head glands secrete sucrase, lipase, amylase, and invertase? What is the measure of an angle that turns through 3/4 of a complete circle What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatctcatccagcattctgaaagggtaatgaataattattccgctgagttcatgaggtatccgaaggaggagcaacacttaggctataagagtatcatgcacatagatcgggataaatcgcctatcatatgtgacaacaatttcatgattaaaagt code for? Which is a pro-election of federal judges argument?A. When judges are elected they can be biased by party politics. B. When judges are elected there they can focus more time on reviewing law.C. Judges are more accountable to the people and what they think is just when they are elected Which statement displays an effect of developing a successful atomic bomb? Question 11 options: A.encouraged private sector employees to not share their discoveries with the government B.was the final time that the government and private sector combined to form any great invention C.served as a model for future government or private research and development labs to create innovationsD.proved that military innovation is always ahead of private innovation the graph shows the percentage of dog breeds affected by elbow dysplasia, which causes dogs to limp. What???s the most likely explanation for the mixed breed???s disease incidence? The probability is 0.2 that a person shopping at a certain store will What is the differecne of the following polynomials? (6x^2 - 3x^3) - (2x^3 + 4x^2 -5) Congratulations As you know, the position for which you are applying requires superlative problem-solving skills in a variety of arenas, and the ability to think critically on the fly is essential. To evaluate your ability in this area, the practical portion of the interview process consists of a series of locked-room puzzles. You will need to use all of your ingenuity to find the key to unlocking each room. There are six rooms total; four of the rooms will have individual time limits, while the remaining two rooms will be untimed. You will be observed by the interview team from a remote location, and your progress through the rooms will be recorded. For which type of communication would this paragraph be used?A)casual noteB)informal emailC)formal business If 1495 J of heat is needed to raise the temperature of a 337 g sample of a metal from 55.0C to 66.0C, what is the specific heat capacity of the metal?