The parents of a school-aged child with cystic fibrosis tell the nurse that they have changed to natural pancreatic enzymes because of money issues. what is an appropriate response by the nurse?

Answers

Answer 1
The most appropriate response would be to tell the parents that Generic enzymes are not as effective as the brand-name one and therefore, the matter should be discussed with the healthcare provider. Cystic fibrosis is an inherited disorder that causes severe damage to the lungs, digestive system and other organs of the body. It affects the cell that produce mucus, sweat and digestive juices such that the secreted fluids are thin and slippery.The pancreas in people with this disorder produces a thick mucus that blocks the secretion of enzymes needed for digestion, called the pancreatic insufficiency.

Related Questions

Wo cells in the same organism differ only in the number of chloroplasts they contain. the first cell has multiple chloroplasts, and the second cell has very few. what would most likely characterize these cells? there would be no difference between the functioning of the cells because the chloroplasts are not essential cell structures. the second cell would become larger because it would have fewer chloroplasts regulating its size and shape. the second cell would shrink because it would not be able to store water and maintain cell shape. the second cell would not be able to produce as much food because it could not capture sunlight.

Answers

The second cell would not be able to produce as much food because it could not capture sunlight.

Answer:its d

Explanation:

just did it

If a human system fails to function properly,what is most likely to result

Answers

a disturbance in homeostasis

Heat lamps are designed to reheat food when it falls below 135 f true or false

Answers

The given statement is false, as the heat lamps are not created to reheat food when food falls under 135 degrees.  

A heat lamp refers to an incandescent light bulb, which is utilized for the primary objective of producing heat. The heat lamps are not considered for holding the probable venturous foods hot at a minimum of 135 degrees Fahrenheit. In order to heat up a probable venturous food for decent holding, the food should be cooked over swiftly to a least internal temperature of 165 degrees.  


It is often stated that the phosphate bonds in atp are "high energy," but in fact, they are not notably high in energy. rather, they are easy to break, and the δg of hydrolysis is a "useful" quantity of energy. what makes the phosphate bonds easy to break? negative charges on phosphate groups repel each other. positive charges on amino groups repel each other. high acidity attacks bonds between amino acids. high alkalinity attacks bonds between phosphate groups. they are close to the destabilizing nitrogenous base adenosine.

Answers

The answer is Negative charges on phosphate groups repel each other. The oxygen groups of a phosphoanhydride in ATP have electron cloud that repels each other. On hydrolysis, once a phosphate is lost, the electrostatic repulsion is reduced.

When ATP is hydrolyzed, it forms more hydrogen bonds with surrounding water molecules that when ATP is unhydrolyzed. Therefore, more energy is released since more bonds are formed than are broken. The net delta G is positive during hydrolysis of ATP.


Final answer:

The phosphate bonds in ATP are considered 'high energy' due to the repulsion of negative charges on the phosphate groups, making them easy to break and release energy. This process of breaking down ATP is a prime energy source for various cellular functions.

Explanation:

The 'high energy' often attributed to phosphate bonds in ATP (adenosine triphosphate) originates from the instability caused by the repulsion between the closely aligned negative charges on the phosphate groups. ATP has three phosphate groups that are negatively charged and these negative charges repulse each other, creating strain on the bonds that attach them to the ATP molecule. This repulsion makes the bond easy to break, thus releasing the stored energy within ATP. The breaking down of ATP to ADP (adenosine diphosphate) and an inorganic phosphate group, in a process called hydrolysis, is a key source of energy for many cellular processes.

The subject of this question is Biology.

The phosphate bonds in ATP are often referred to as "high energy," but in reality, they are not notable for their high energy content. Instead, these bonds are easy to break due to the presence of negative charges on phosphate groups that repel each other.

This repulsion weakens the bonds and makes them susceptible to hydrolysis, which releases a "useful" quantity of energy. The proximity of the phosphate bonds to the destabilizing nitrogenous base adenosine also contributes to their ease of breaking.

Learn more about ATP Energy Release here:

https://brainly.com/question/7568521

#SPJ11

An elderly client diagnosed with diarrhea is taking digoxin. which electrolyte imbalance should the nurse be alert to?

Answers

The nurse should inform the client about hypokalemia and its effect. The elderly client taking digitalis should be aware of how quickly hypokalemia and dehydration can occur with diarrhea. The nurse should show the client how to identify symptoms of hypokalemia. This is because low levels of potassium cn lead to digitalis toxicity

A plant makes its own proteins but an animal synthesizes the proteins it consumes as food.
a. True
b. False

Answers

This would be TRUE!! Plants have photosynthesis, which is their way of making their own energy, while animals must consume it's energy as food such as plants and other animals. 

I really need help with this someone please!! im offering the rest of my points

Below is a pedigree for a neurological disorder, of which one son has been affected. The disease is caused by a mutation on the X chromosome. Is the disorder recessive or dominant? Did the disorder come from mom or dad?



Recessive; dad

Recessive; mom

Dominant; dad

Dominant; mom

Answers

Dominant; Dad!!!!!!!

Answer:

Recessive;mom

Explanation:

I honestly don't have an explanation. I took this test twice, the correct answer is recessive;mom.

What is the term for the protective wall that helps bacteria survive unfavorable conditions? endospore sporangia aerobic wall botulism

Answers

The answer is endospore

A) Endospore

When living conditions become undesirable some bacteria become dehydrated cells called, " Endospores."

- Prodixy ☕

Anatomy question?

Which of the descriptions below does not explain the effects of air pollution on the respiratory system?

It could restrict air flow through the bronchi.
It could disrupt the rate of ventilation.
It could prevent hemoglobin from binding to oxygen.
It could increase carbon dioxide uptake in alveolar sacs.

I've narrowed this down to B and C, but I'm still not sure if those are even right. I've been working on this quiz since about 2 AM last night and it's getting on my nerves that this information isn't anywhere in my lessons.

Answers

It could increase carbon dioxide uptake in alveolar sacs Other than this option all the other options are the observed affects that air pollution is known to have on the respiratory system.

An otr® is explaining the purposes of therapeutic exercise and therapeutic activity to a physician. what are the primary reasons that otrs use these interventions for musculoskeletal conditions?

Answers

To improve function, increase strength, and prevent muscle imbalances
Therapeutic exercise and activity assist the client with improving strength and function while preventing further complications, including muscle imbalances.

In summary, therapeutic exercise and activity are fundamental components of occupational therapy for musculoskeletal conditions. They are tailored to address the specific needs of the patient, with the ultimate goal of restoring function, reducing pain, and enhancing overall quality of life.

The primary reasons that occupational therapists (OTRs) use therapeutic exercise and therapeutic activity for musculoskeletal conditions are to:

 1. Improve Range of Motion (ROM): Musculoskeletal conditions often lead to a reduction in the normal movement of joints. Therapeutic exercises are designed to gently increase the ROM, thereby improving flexibility and joint mobility.

 2. Increase Muscle Strength: Specific exercises can help strengthen the muscles around the affected joint or area, providing better support and reducing the risk of further injury.

 3. Enhance Neuromuscular Control: This involves improving the communication between the nervous system and muscles. Enhanced neuromuscular control can lead to better coordination and balance, which is crucial for performing daily activities without pain or injury.

4. Reduce Pain and Inflammation: Certain exercises and activities can help alleviate pain and reduce inflammation in the affected area by promoting circulation and the delivery of nutrients to the tissues.

 5. Improve Functional Mobility: By addressing the above areas, therapeutic exercises and activities aim to improve a patient's ability to perform functional tasks, such as walking, climbing stairs, or reaching for objects, with greater ease and less discomfort.

6. Prevent Deformity and Contracture: Regular exercise can prevent the development of deformities and contractures that may result from immobilization or muscle imbalance due to musculoskeletal conditions.

 7. Facilitate Healing and Tissue Repair: Controlled exercises can promote the healing process by stimulating tissue repair and remodeling, which is essential for the recovery of injured tissues.

 8. Educate the Patient: OTRs use therapeutic exercises as an opportunity to educate patients about their conditions, the importance of adherence to the exercise regimen, and ways to manage symptoms independently.

 In summary, therapeutic exercise and activity are fundamental components of occupational therapy for musculoskeletal conditions. They are tailored to address the specific needs of the patient, with the ultimate goal of restoring function, reducing pain, and enhancing overall quality of life.

A caregiver asks the nurse what the caregiver can give a 9-year-old child for a headache. what is the nurse's best response?

Answers

The nurse should respond to the caregiver that she or he should give a medicine for headache to the child depending on its intensity. If it is aching too much and he or she couldn't bare the pain and that it also has additional symptoms aside it, it is best to accompany the child to a doctor but if it is just light to moderate, it is best to let the child rest and give the child a medicine for headache.

Why does the sympathetic division of the ans have a more generalized effect in the body?
a. one preganglionic neuron synapses with many postganglionic neurons
b. one preganglionic neuron synapses with one or two postganglionic neurons
c. the secretion of epinephrine and norepinephrine can effect many organs
d. both choices a and c are correct?

Answers

The answer is D ( both choices A and C are correct) because one preganglionic neuron synapses with many postganglionic neurons and also the secretion of epinephrine and norepinephrine can effect many organs. The autonomic nervous system has two divisions namely the sympathetic division and the parasympathetic division. The two divisions have antagonistic effects on internal organs they send nerves to act on. The sympathetic nervous system stimulates body's flight or flight response and it is constantly active at a basic level to maintain homeostasis (internal body environment)

The right answer is D.

The sympathetic nervous system is one of the three components of the autonomic nervous system, managing the activity of visceral organs and the automatic functions of the body, such as breathing or beating of the heart. The sympathetic nervous system is involved in many unconscious physiological activities through two neuromodulators of the catecholamine family: adrenaline, but especially norepinephrine.

At the level of the sympathetic nervous system:

* A pre-ganglionary neuron innervates approximately twenty ganglionic neurons

* A ganglionic neuron innervates several effectors (multiple organs)

This difference in axon branching explains in part the differences in the extent of the effects of sympathetic and parasympathetic systems.

What effect does the terrain of a biome have on its climate and weather?


WILL GIVE BRAINLYEST!!1

Answers

The terrain of a biome has lots of different effects on its climate. For example, the sand of a desert absorbs heat and water, so it is constantly hot and it rarely rains. 


I hope this helps.

At a laboratory at case western reserve university in 1998, geneticist patricia hunt was making a routine check of her female lab mice. as she extracted and examined developing eggs from the ovaries, she began to wonder what had gone wrong. she noticed that many of the eggs showed problems with their chromosomes, and some had irregular amounts of genetic material, which can lead to miscarriages and birth defects in mammals. she learned that a lab assistant had mistakenly washed the plastic mouse cages and water bottles with a harsh soap, releasing bpa from the plastic. knowing that bpa is an endocrine disruptor, a chemical that can enter organisms and mimic hormones, hunt set out to discover whether it had adversely affected her mice.

Answers

Final answer:

Bisphenol A (BPA) is an endocrine disruptor that has been linked to multiple health issues, especially during developmental periods. Research indicates that even at low levels, BPA can disrupt hormonal balance and gene expression, with the FDA encouraging reduced use in food-related materials.

Explanation:

The research done by Patricia Hunt and subsequent studies have highlighted the potentially harmful effects of an endocrine disruptor known as bisphenol A (BPA). BPA exposure can lead to a series of health problems like developmental delays and an increased risk of cancers. These health risks are particularly concerning during the prenatal and postnatal periods. Additionally, the endocrine system's regulation can be significantly interfered with by BPA, which mimics hormones such as estrogen or has the opposite effect of androgens. The U.S. Food and Drug Administration (FDA) has facilitated the decreased use of BPA in food-related materials and many manufacturers have voluntarily removed BPA from products, particularly those for babies.

In experimental studies, both in vivo and in vitro, BPA has been observed to cause changes in gene expression leading to various health outcomes. Exposure to BPA has also been implicated in epigenetic inheritance, where environmental factors can influence gene expression in subsequent generations. In light of these insights, it's suggested that risk assessments for toxic substances, especially those that can act as endocrine disruptors, need a more nuanced approach that considers low-level exposure effects over prolonged periods.

Plant needles are PROBABLY initially the result of A) adaptations for survival that some plants developed due to high temperatures on Earth. B) somatic mutations that made some leaves thick and waxy, while other leaves did not change. C) neutral mutations to leaf tissue that would neither help nor harm the plants living in such a harsh environment. D) a beneficial mutation that increased survival of certain plants that reproduced and passed the mutated gene to offspring.

Answers

D)  a beneficial mutation that increased survival of certain plants that reproduced and passed the mutated gene to offspring.

Hope this helped! xD

the correct answer is D

What three things can happen to the radiation that Earth receives from the sun?

Answers

It can either be reflected or radiated back into space, it can get absorbed by the atmosphere, or it can reach the ground. 

Good luck :)
It can be absorbed by the atmosphere and ground
It can be reflected away from the magnetic field
It’s particles can hit other particles in our atmosphere triggering less-energetic radiation

What two muscles on your muscle list aid in mastication?

Answers

Unfortunately this question is incomplete as no options are provided. IN actual fact, four muscles are involved in mastication. Three of these are responsible for biting down, namely the masseter, the temporalis and the medial pterygoid, whereas one, the lateral pterygoid, is responsible for opening of the jaw. All four muscles help to move the jaw laterally.

North Carolina ranks second in production of Christmas trees in the United States. Scientists in North Carolina are developing a clone bank of disease and insect resistant trees. How would this be beneficial to Christmas tree growers?

Answers

That would be beneficial to them because they wouldn't lose as many trees to disease or insects, so they are able to sell more.
That's what I got from it at least.

Clones are genetically identical cells of organisms that can be produced in-vitro. Cloning can help tree growers to protect their production from insects and diseases.

What is cloning?

Diseases and insects can adversely affect the productivity of plant. So, as to prevent such condition, cloning can be useful.

This can be done by transferring any biological agent to plants by plant breeding methods or by recombinant DNA technology.

Thus, this will be beneficial for the Christmas tree to prevent diseases and attack of insects.

For more information about cloning, visit:

https://brainly.com/question/17245984

A biological community of interacting organisms and their physical environment is an

Answers

It is an ecosystem ....

A biological community of interacting organisms and their physical environment is an ecosystem

What is an ecosystem?

An ecosystem is a geographic area where plants, animals, and other organisms, as well as weather and landscapes, work together to form a bubble of life.

Every factor in an ecosystem depends on every other factor, either directly or indirectly. A change in the temperature of an ecosystem will often affect what plants will grow there, for instance. Animals that depend on plants for food and shelter will have to adapt to the changes, move to another ecosystem, or perish.

Learn more about ecosystem at: https://brainly.com/question/842527

#SPJ6

The most common site of back pain is the __________ area. question 15 options:
a. cervical
b. lumbar
c. thoracic
d. coccyx save

Answers

The most common site of back pain is the lumbar area

1. Aquaculture is the practice of farming sea organisms as a renewable food source.
A. True
B. False.,

Answers

This statement is true. Aquaculture involves the farming of different sea organisms that can provide food for humans and other water-dwelling species. It also is used to increase sustainability of resources by creating renewable energy and taking the strain off existing aquatic systems.

The set of instructions for each characteristic donated by the parent of the offspring is called

Answers

Instructions from characteristics which are passed from the parent to the offspring are called genes. Genes are made of complex molecules of DNA. Each parent also donates chromosomes to their offspring. Each offspring will get half of their genes from each parent and they will therefore have the aspect of the two parents.

How does pregnancy begin?

A. Differentiation
B. Fertilization
C. Deviation
D. Contraction

Answers

B Fertilization Answer Answer Answer Answer
Hello,

The answer is option B Fertilization.

Reason:

The answer is option B because fertilization is when the sperm contacts with the egg which starts the pregnancy. Its not option A because its differentiation is the process of comparing. Its not option C because its the action of departing which has nothing to do with pregnancy. Its also not option D because that is used for shoes, or tires which is the grip it has on a surface.

If you need anymore help feel free to ask me!

Hope this helps!

~Nonportrit 

Please help! Of the skulls below, which one shows the most evidence of upright walking?
Human Evolution
A. Skull A
B. Skull B
C. Skull C
D. Skull D

Answers

The skull that shows the most evidence of upright walking is actually D :)

Describe the short term and long term process of the carbon cycle

Answers

Short term

-interactions between atmosphere and biosphere, terrestrial and marine components

Long term

-formation and destruction of fossil fuels and sediments containing organic carbon

The short-term is of the carbon cycle is interactions between the terrestrial and marine components of the biosphere and the atmosphere. The long-term of the carbon cycle is the formation and destruction of fossil fuels and sediments containing organic carbon.

What is a carbon cycle?

The carbon cycle is nature's method of recycling carbon atoms, which repeatedly go from the atmosphere into Earth's living things and back into it.

The majority of carbon is kept in rocks and sediments; the remainder is kept in the ocean, atmosphere, and living things. The carbon cycle is the regulation of carbon from one form to another.

Thus, the short and long terms of the carbon cycle are the formation of natural components by the means of the natural processes with the presence of carbon.

To learn more about the carbon cycle, refer to the below link:

https://brainly.com/question/1627609

#SPJ2

10. Which of the following is true of an enzyme? (1 point)
-It catalyzes a series of reactions.
-It breaks down immediately following the reaction it catalyzes.
-It changes the amount of energy released at the end of a reaction.
-It binds a single set of substrates,

Answers

it binds a single set of substrates

Final answer:

An enzyme is a protein that functions as a catalyst, accelerating a biochemical reaction without being consumed by the reaction. It can work on many substrates, not just one, and can be reused repeatedly.

Explanation:

The molecule under discussion, an enzyme, is a type of protein that acts as a catalyst to speed up a specific biochemical reaction within a cell. The options provided include four functions, but the one that best characterizes an enzyme is that 'It catalyzes a series of reactions'.

Enzymes don't break down immediately following a reaction. Instead, they can be reused for the same reaction repeatedly, and they don't change the amount of energy released at the end of a reaction. They do, however, lower the activation energy required for a reaction to occur, thus speeding up the process. Also, while enzymes do bind to specific molecules (substrates), they are not limited to a single set of substrates and can interact with various molecules.

Learn more about Enzyme here:

https://brainly.com/question/32357248

#SPJ6

A 17-year-old high school senior presents to your clinic in acute respiratory distress. between shallow breaths he states he was at home finishing his homework when he suddenly began having right-sided chest pain and severe shortness of breath. he denies any recent traumas or illnesses. his past medical history is unremarkable. he doesn't smoke but drinks several beers on the weekend. he has tried marijuana several times but denies any other illegal drugs. he is an honors student and is on the basketball team. his parents are both in good health. he denies any recent weight gain, weight loss, fever, or night sweats. on examination you see a tall, thin young man in obvious distress. he is diaphoretic and is breathing at a rate of 35 breaths per minute. on auscultation you hear no breath sounds on the right side of his superior chest wall. on percussion he is hyperresonant over the right upper lobe. with palpation he has absent fremitus over the right upper lobe.

Answers

If you asking for the diagnosis, the answer would be spontaneus pneumothorax. 

Pneumothorax is a condition when the membrane (pleura) of the lungs is broken, make the thoracic space exposed to the atmosphere. Thoracic space becomes filled with air, makes the patient felt pain and hard to breathe. 
The air will cause the breath sound reduced, hyperresonant percussion and absent of fremitus. Tall men will be at higher risk since taller height also means taller lungs.

True or false abstinence is the only way to prevent pregnancy 100%.

Answers

false there is many ways to prevent pregnancy 100%

Answer:

True

A p e x i got this question correct

Why doesn't dr. logan feel the bed bug feeding on him? why doesn't dr. logan feel the bed bug feeding on him? the bed bug has very soft feet and mouthparts. the bed bug is tiny and weighs very little. the bed bug doesn't actually bite, but feeds by osmosis. the bed bug injects an anesthetic as it feeds. submitrequest answer?

Answers

the bed bug injects an anesthetic as it feeds

this would be the correct answer ^^

The answer is the bed bug injects an anesthetic as it feeds.

Bed bugs are tiny blood sucking insects that have an exoskeleton. These insects are found in places like the edges of the bed, cavities, etc. where they hide in the day time. During night, these insects come out and bite their hosts to feed on the blood. However like Dr. Logan, no one feels the pain due to the bite because the bed bugs also inject an anesthetic to avoid the host from detecting their presence. Anesthetic is a drug substance that stops the pain receptors from signalling the brain about the pain.

A population is a population is a group of individuals of the same species that live in the same area and interbreed. all individuals of a species, regardless of location or time period in which they live. a group of individuals of different species living in the same place at the same time. a group of individuals of a species plus all of the other species with which they interact.

Answers

c. a group ofindividuals of a species plus all of the other species with which they intera

A population refers to a group of organisms of the same species, living, interacting, and interbreeding within a certain geographic area.

A population is a term used to describe a group of organisms of the same species that are living in the same area and interacting with each other. This can include aspects such as their demography or genetics. In population ecology, scientists are interested in studying various features of how these populations live, such as density, dispersion, and birth and death rates, which help determine the health and stability of the population.

To further illustrate, all of the angelfish living in the same area of the ocean constitute the angelfish population. These populations not only live in the same geographic area but also interbreed, which means they share a gene pool. The gene pool consists of all the genes found among the individuals in that population, which is important for the survival and adaptability of the species.

Populations are identified partly by where they live. Their area of population may have natural boundaries like rivers and mountains, or artificial ones like roads or manmade structures. These boundaries define the geographic area considered the habitat within which populations interact and undergo processes like competition and cooperation.

Other Questions
What happened to American life as a result of new technology in the late twentieth century?A.Americans could purchase cars for the first time.B.Americans could shop at home on the Internet.C.Americans could see movies in theaters.D.Americans could fly on airplanes. The sum of two angles in a triangle totals 117 degrees, what is the measure of the third angle What types of anthropologists explore all aspects of living human culturefrom war and violence to love, sexuality, and child rearingand look at the meanings that people from all over the world place on these things? Read this excerpt from "Goodbye to All That" by Joan Didion.We stayed ten days, and then we took an afternoon flight back to Los Angeles, and on the way home from the airport that night I could see the moon on the Pacific and smell jasmine all around and we both knew that there was no longer any point in keeping the apartment we still kept in New York.Which statement best explains how the imagery in the excerpt affects the meaning of the text?It highlights the isolation and loneliness of life in Los Angeles, demonstrating that Didion faces the same problems there that she faced in New York.It captures the beauty and serenity of life in Los Angeles, suggesting why Didion feels more content living there than she did in New York.It provides an unrealistic and idealized impression of Los Angeles, showing that Didion has not changed at all.It depicts the dark and mysterious atmosphere of Los Angeles, indicating why Didion is drawn to this new, exciting city. What is the equation, in slope-intercept form, of the line that is perpendicular to the line y 4 = 2/3(x 6) and passes through the point (2, 2)? y = 2/3x 10/3 y = 2/3x +10/3 y = 3/2x 1 y = 3/2x + 1 Your gross pay on your paycheck is $400. your deductions are as follows: federal income tax - $50.00 state income tax - $20.00 social security tax - $7.00 medicare tax - $3.50 please calculate your net pay (in dollars). question 2 options: Which statement accurately describe the role of decomposers in the carbon cycle? When parking downhill on a road with a curb, you should turn your front wheels __________ .A. parallel to the curbB. towards the curbC. towards the street Which of the following terms describes the primary core of a comet? two cards are drawn without replacement from a standard deck of 52 playing cards. find the probability that both are odd numbers (aces are considered odd because they have a value of 1 or 11). 14) Which BEST describes the way the Fourteenth Amendment affected the states?A)States had to give all citizens, regardless of their race or religion, equal protection under the law.B)States could no longer make any laws that were not approved by the federal government.C)States had to pass laws that gave more rights to freed slaves than to other citizens.D)States could no longer institute poll taxes or tests for citizens before they voted.2) The term "Reconstruction" in United States history refers to the period after what event?A)the Civil WarB)the Revolutionary WarC)the Constitutional ConventionD)the Declaration of Independence The major problem with hydrogen as an alternative source of energy is that none exists on the surface of the earth. a. True b. False Analyze the following statement: Marcus notices that he runs faster in the mornings rather than the evenings. Is the statement an example of correlation or causation? A. Correlation, because time of day doesn't cause a person to run faster or slower B. Causation, because Marcus has noticed this over several trials C. No relationship, because time of day has nothing to do with how fast a person runs D.There is not enough information to make a conclusion Which head glands secrete sucrase, lipase, amylase, and invertase? What is the measure of an angle that turns through 3/4 of a complete circle What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatctcatccagcattctgaaagggtaatgaataattattccgctgagttcatgaggtatccgaaggaggagcaacacttaggctataagagtatcatgcacatagatcgggataaatcgcctatcatatgtgacaacaatttcatgattaaaagt code for? Which is a pro-election of federal judges argument?A. When judges are elected they can be biased by party politics. B. When judges are elected there they can focus more time on reviewing law.C. Judges are more accountable to the people and what they think is just when they are elected Which statement displays an effect of developing a successful atomic bomb? Question 11 options: A.encouraged private sector employees to not share their discoveries with the government B.was the final time that the government and private sector combined to form any great invention C.served as a model for future government or private research and development labs to create innovationsD.proved that military innovation is always ahead of private innovation the graph shows the percentage of dog breeds affected by elbow dysplasia, which causes dogs to limp. What???s the most likely explanation for the mixed breed???s disease incidence? The probability is 0.2 that a person shopping at a certain store will