think how the authors structure their article. why is this structure effective?

Answers

Answer 1
The structure depends on what the article is about, and how the Author feels about the subject.
Answer 2

Answer:

The Authors structure their article in this way

determine what is to be written in a topicprovide an overview of the key concepts in the articleidentify major relationships in there writingidentify strength and weaknessesidentify conflicting evidence identify any gaps from previous articles and fill it up

structure is so effective because it controls the major elements/parts of the story, it affects the meaning of the story by organizing the theme of the article been written

Explanation:

It is necessary for authors to structure their article in a good and presentable manner because it helps the reader to get whatever information  the author is trying to pass across


Related Questions

What does the word means “not speaking clearly? Subordinate incoherent unfathomable impede

Answers

Incoherent is your answer

Incoherent means that the expressed words are unclear and confusing


hope this helps

Answer:

incoherent

Explanation:

give the package to blank opens the door.

Answers

The person who ordered the package or who wants it

an interrupting word or group of interrupting words that renames or identifies the noun or pronoun that it follows is called a A.appositiv B.subjunctive C.dependent phrase D.expletive

Answers

An interrupting word or group of interrupting words that renames or identifies the noun or pronoun that it follows is called an appositive

An interrupting word or group of words that renames or identifies a noun or pronoun is called an appositive, which provides additional information about the noun it follows.

An interrupting word or group of interrupting words that renames or identifies the noun or pronoun that it follows is called an appositive. An appositive is a noun or pronoun that usually appears immediately after another noun to rename the noun and provide additional information about it. It is typically enclosed in a pair of commas, and sometimes appositives can have their own modifiers. For example, 'My boss, Mr. Smith, was talking to my parents.' In this sentence, 'Mr. Smith' is an appositive that renames 'My boss' and provides additional information.

Reread the following excerpt from "The Necklace":

Instead of being delighted, as her husband had hoped, she threw the invitation spitefully upon the table, murmuring: "What do you suppose I want with that?"

Which word most closely replaces the word "spitefully" in this excerpt? 

       A. Eagerly   B. Sadly   C. Reluctantly   D. Resentfully

Answers

D- resentfully
by reading context clues, you can tell that the woman was angry (spiteful) at her husband. resentful is a synonym of spiteful

PLEASE answer all of them! There is 3 more!

Answers

The purpose of the boldfaced text in the passage is to present a counterclaim to the author's argument, showing an opposing perspective and inviting readers to critically consider the main points.

In the passage from "A Cat Is Not a Can of Soup," the purpose of the boldfaced text is to acknowledge a counterclaim to the author's claim. A counterclaim presents an opposing view or argument, which can make the author's position seem more balanced and fair.

In this case, the bolded text somewhat contradicts the text around it by demonstrating the responsibility shelters take even for ill animals.

This shows another side to the argument, making the reader more inclined to consider the author's main points critically.

Learn more about Counterclaim here:

https://brainly.com/question/30892609

#SPJ1

Based on the online article,”Definitional Speeches,” when giving a definition speech it is very important to do which of the following choices?

Answers

SchoolEnglish5+3 ptsBased on the online article,”Definitional Speeches,” when giving a definition speech it is very important to do which of the following choices?

List 3 advantages to Hamlet committing suicide

Answers

In the play Hamlet, the protagonist considers the option of su.icide in his most famous soliloquy. As Hamlet struggles with his problems, he wonders what it is that prevents him from killing himself, as this would put an end to all his problems, making the option vey attractive ("’tis a consummation/Devoutly to be wished!"). These are some of the advantages of su.icide:

By killing himself, Hamlet would be free from the responsibility of having to avenge his father's death by killing Claudius.His death would also benefit Claudius and Gertrude, as it would eliminate any challenges to the throne.His death would also liberate Ophelia from her commitment to Hamlet, allowing her to marry someone else who loves her more deeply.

However, Hamlet finds himself incapable of committing su.icide due to the fact that this is a sin, as well as the fact that he does not know what awaits him in the afterlife.

Which author motivation best matches this conflict?

Answers

Showing the power of reconciliation

"A dog is accidentally left behind on a family camping trip hours from home".

C. Showing the power of animal-human relationships- Apex

Based on the information provided here, crude oil is:

an element

a compound

a mixture


its mixture

Answers

The answer is Mixture. Plz mark me brainliest!!!
Final answer:

Crude oil is a mixture of multiple hydrocarbons that can be separated through fractional distillation. Its composition can vary depending on its source.

Explanation:

Crude oil is not an element or a compound but rather a mixture. A mixture is made up of two or more substances that are physically combined and can be separated by physical methods. In the case of crude oil, it is a mixture of many different hydrocarbons including paraffins, aromatics, naphthenes, and asphaltics. These components can be separated through a process called fractional distillation, which is commonly used in oil refining industries. The composition of crude oil can vary depending on its source, and it's the reason why we sometimes say 'its mixture' to imply its unique composition.

Learn more about Crude Oil here:

https://brainly.com/question/33903801

#SPJ12

Which sentences in this excerpt from "The Yellow Wallpaper" by Charlotte Perkins Gilman suggest that the narrator’s husband has a condescending attitude toward her? What is it, little girl?" he said. "Don't go walking about like that—you'll get cold." I thought it was a good time to talk, so I told him that I really was not gaining here, and that I wished he would take me away. "Why, darling!" said he, "our lease will be up in three weeks, and I can't see how to leave before. "The repairs are not done at home, and I cannot possibly leave town just now. Of course if you were in any danger, I could and would, but you really are better, dear, whether you can see it or not. I am a doctor, dear, and I know." "I don't weigh a bit more," said I, "nor as much; and my appetite may be better in the evening when you are here, but it is worse in the morning when you are away!" "Bless her little heart!" said he with a big hug, "she shall be as sick as she pleases! But now let's improve the shining hours daytime by going to sleep, and talk about it in the morning!"

Answers

The best answer for this question would be:

"The repairs are not done at home, and I cannot possibly leave town just now. Of course if you were in any danger, I could and would, but you really are better, dear, whether you can see it or not. I am a doctor, dear, and I know.

 

This depicts a condescending attitude based on how the line was delivered and the emotion behind it.

Amber has been asked to identify the meter of “Sonnet 18.” She is highlighting the syllables that should be stressed.

And often is his gold complexion dimm'd

Which syllables should Amber highlight? Check all that apply.

1.And
2.of-
3.-ten
4.is
5.his
6.gold
7.com-

Answers

Sonnet 18 is Shakespeare's sonnet, which means that it was written in iambic pentameter. When it comes to an iamb, we know that the sequence is as follows: the first syllable is unstressed, and the one after it is stressed. Having that in mind, the correct answers are:
2. of-
4. is
6. gold
And even though these aren't your options, there are two more stressed syllables, and those are -plex, and -dim-. 

Complete the sentence with the word or phrase that has the most positive connotation.

When we saw her barefoot and wearing flowers as a crown, we knew the girl was

Answers

What are the options? It could be many things that she is.

HELP PLEASE!!!!

Work Cited entries of sources with multiple authors


A) must list at least the first three authors's last names followed by et. al.


B) should only list the author designated as the main author.


C) must list every author by last name.


D) can list the first author's full name followed by et. al.

Answers

Answer:

can list the first author's full name followed by et. al.

Explanation:

When there are multiple authors, the only name needed is the name of the first author in the entry, followed by et. al. (Latin for "and others").

When citing a source with multiple authors, it is important to provide credit to all the individuals who contributed to the work. The correct option is C) must list every author by the last name.

When creating a Works Cited entry for a source with multiple authors, the general rule is to list every author by their last name. Each author's last name should be followed by their first name or initials. This allows proper attribution to all individuals involved in the creation of the source.

In the Works Cited entry, you should list every author by their last name. The general format for citing sources with multiple authors is as follows: Last name, First name of the first author, First name Last name of the second author, First name and Last name of the third author, and so on.

For sources with more than three authors, you can use the abbreviation "et al." (meaning "and others") after listing the first three authors' last names. However, it is still necessary to include all the authors' names in the initial citation.

Thereofre, the correct option is C) must list every author by last name.

For more details regarding Works Cited entry, visit:

https://brainly.com/question/33144022

#SPJ2

In Pygmalion, Act 1, How does the note-taker make a living?
1. He studies phonetics.
2. He sells his poetry.
3. He works for the university.
4. He is hired to train people to speak properly.

Answers

2 he sells his poetry

Actually, the correct answer is: He is hired to train people to speak properly

Write a thesis statement with an academic tone for the following central idea and evidence-based claims. Central idea: Teenage gang activity is becoming a problem in middle schools. Evidence-based claims: Middle-school children are easily influenced, gangs give children a sense of belonging, and gangs have colors associated with them which is attractive to middle-school kids

Answers

A good thesis statement for the central idea and claims would be:

Teenage gang activity is becoming a problem in middle schools because middle-school children are easily influenced, need a sense of belonging, and are attracted to gang colors. 

This statement combines the central idea and three evidence-based claims into one sentence.

Answer:

Teenage gang activity in middle School makes children easily influenced buy gangs, students have been attracted to gang colors and feel a need of a sense to belong. 

Explanation:

YW! =^.^=

According to the "Future Potential Source #2: Wind" article, how much have wind power costs decreased over the past six years?


A. 28%–41%

B. 8%

C. 50%

D. 66%

Need answer asap

Answers

67 is the equilibrium of the phosphate group in the 3rd amendment so its hypothetically going to be F

Goines uses satire in his narrative because

Answers

He wants the reader to think critically about the war

Answer:

Goines uses satire in his narrative because he wants the reader to think critically about the war.

Explanation:

Satire is a literary or artistic technique that ridicules a particular theme, usually as a form of political intervention or otherwise, with the aim of provoking or avoiding a change, but the purpose of satire is to make the reader reflect and think critically in a particular situation .

For this reason, in "Let Sleeping Dogs Lie" by David Lance Goines, he satirizes the journey he had to avoid recruitment during the Vietnam War. The purpose of this work is to make the reader think critically about war.

what is a comparison of two unlike things using "like" or "as"?

Answers

simile is a comparison of two unlike things using "like" or "as".

For example:

"John was like an eagle, as he quickly spotted the rabbit, and was able to capture it."

Note that the word like was used, and that it compared John with the eagle


hope this helps
Hey there!

I believe when you compare some thing with like or as, that is a simile.

I hope this helped! :-)

What does the phrase “away went alice like the wind” most likely mean, as used in paragraph 11 in the story down the rabbit hole

Answers

It is a simile that most likely means that Alice ran away very fast, seemingly like the wind.

Answer:Which of the following statements best describes how the narrator’s point of view influences the text?

book:

DOWN THE RABBIT HOLE

An Excerpt from Alice's Adventures in Wonderland

Explanation:

In this passage, how does the speaker's point of view support the tone?

Diana finally appeared, wearing a gown that looked like she had been dipped in liquid gold. Her smile instantly charmed each person she passed, and they all seemed happy to just bask in her glow. If she lifted her lashes to look you in the eye, it was a compliment you wouldn't forget.
A. Because the speaker describes Diana in detail, the passage has a judgmental tone.
B. Because the speaker admires Diana, the passage has a positive tone.
C. Because the speaker seems jealous of Diana, the passage has a judgmental tone.
D. Because the speaker uses positive imagery, the passage has a positive tone.

Answers

The anwser is B becauae they way he/she describes the passage of the way ahe looks
I'd say the answer is D because of the way he describes her in such a way that we picture her as a beautiful woman. The author did this using positive imagery to evoke positive thoughts.

why do you think DR. MLK was assassinated?

Answers

He was assassinated because he was fighting for his rights and speaking out on behalf of African Americans. White americans didn’t like that because it wasn’t how they have always lived life.

Final answer:

Dr. Martin Luther King Jr. was assassinated due to his influential leadership in the civil rights movement and his nonviolent approach to advocating for racial equality, which was met with resistance from those opposed to the movement's goals.

Explanation:

The assassination of Dr. Martin Luther King, Jr. in April 1968 sent shockwaves across the United States, profoundly impacting the civil rights movement. King's nonviolent approach to racial equality and his support for striking sanitation workers in Memphis positioned him as a unifying figure in the struggle for civil rights. However, his death highlighted the deep-seated resistance to the civil rights movement and the vision of an inclusive democracy. The violence and riots that followed King's assassination reflected the outrage and despair felt by many African Americans and underscored the racial tensions of the time. King's advocacy for nonviolence and racial justice, and his role in the civil rights movement, made him both an influential leader and a target for those opposed to his ideals.

what kind of people always think for the well being of others

Answers

compassionate, empathic, sympathetic, and kind people. 
altruists ...perhaps this should be taken with a grain of salt..God can inspire a man to altruism but tis a long and arduous chore

Help me please !!! Very quick!!

Answers

The answer to this is migrate, sleep is to hibernate, is the D
The answer would be migrate

Hibernation is an extended form of sleep, migration is an extended form of travel



During which stage of the listening process would you determine how well you understood a speech?


taking notes


active involvement


evaluation


preparation

Answers

I'm pretty sure it's evaluation

The correct answer is C. Evaluation

Explanation:

The process of listening usually involves multiple stages that allow the listener to understand properly the message delivered by the speaker and respond to it. This states include receiving in which the listener focus on hearing the message and isolated it from other noises; understanding in which the listener tries to understand the meaning of the message; remembering which is about connecting new ideas listened to previous ideas by using memory actively; evaluating which usually takes place after listening the message is about judging the process of listening by determining if you understood properly the message and asking questions to the speaker and the final stage responding which is about providing feedback to the speaker. Considering this, the stage of listening process in which you determine how well you understood a speech is the evaluation as in this stage you evaluate your own process of understanding and ask questions to clarify your understanding if necessary.

Refer to Explorations in Literature for a complete version of this story.

How do the boys’ actions develop a theme in "The Harvest"?

There’s no purpose behind Don Trine’s walks or actions according to the boys who watch him. This develops the theme that hard labor robs individuals of their sanity and their humanity.

Most of the boys believe that Don Trine is crazy and that his actions are pointless. This develops the theme that, for most people, wealth is the only thing that matters.

Don Trine’s walks are seen by the boys as suspicious; the boys suspect him of stealing or some kind of criminal activity. This develops the theme that young people often distrust the elderly, especially when they should be learning from them.

The boys are greedy and plan to rob Don Trine. This develops the theme that wealth is the only thing that does and should matter to young people.

Answers

The answer is B  .In the story everyone believe Don Trine is hiding money 

The way the boys’ actions develop a theme in "The Harvest" is B. Most of the boys believe that Don Trine is crazy and that his actions are pointless. This develops the theme that, for most people, wealth is the only thing that matters.

What is a Theme?

This refers to the central idea of a text that is used to convey a message from the author to the readers.

Hence, we can see that from the complete text, there is the narration of the actions of some boys and their thoughts about Don Trine which creates and develops the theme that for most people, wealth is the only thing that matters.

Read more about The Harvest here:

https://brainly.com/question/23602558

#SPJ2

Yes; As sparrows eagles, or the hare the lion. If I say sooth, I must report they were As cannons overcharged with double cracks, so they Doubly redoubled strokes upon the foe: Except they meant to bathe in reeking wounds, Or memorise another Golgotha, I cannot tell. But I am faint, my gashes cry for help. In this scene the Sergeant compares Macbeth and Banquo to "As sparrows eagles, or the hare the lion." Knowing that the eagle and the lion are predators and the sparrow and the hare are prey, what does Shakespeare reveal about the characters using this comparison?

Answers

Shakespeare reveals that the characters Macbeth and Banquo are likewise like predator and prey, just as the eagle and the lion are predators and the sparrow and the hare are prey.

What is the meaning of the term “predator”?

A predator is an animal that consumes other creatures, or individuals or organizations that behave in a predatory manner. Predators include lions, pickpockets, and some very large organizations.

The term "predator" originally described insects that consumed other insects, but it has come to refer to any animal that consumes another animal. Although humans prefer to believe that are at the top of the food order, spooky movies frequently disagree.

Such as in the 1987 film Predator, which features ominous aliens who want to kill and consume us. However, predators don't have to murder and consume; they might just simply take belongings.

Learn more about predators from here:

https://brainly.com/question/28871161

#SPJ2

Final answer:

The Sergeant's comparison in 'Macbeth' depicts Macbeth and Banquo as powerful, fierce warriors, likening them to predators overpowering their prey, which underscores themes of power and ambition in the play.

Explanation:

In Macbeth, the Sergeant uses a comparison to describe the heroic efforts of Macbeth and Banquo in battle, likening them to predatory animals such as eagles and lions, while their foes are as helpless as sparrows and hares. This simile reveals the characters' bravery, ferocity, and dominance in combat, suggesting they are powerful and fearsome warriors who are vastly superior to their enemies. This depiction contributes to the themes of power, ambition, and the nature of manhood that recur throughout the play.

In the sentence why does Romeo compare his liver to the sea

Answers

I don't remember Romeo comparing his liver, but his love for Juliet to the sea. He compared the two saying his love was never ending, conquered by the ship captain Juliet.

Sorry if you did actually mean liver, haha...

what type of relationship do tom and Laura have in the glass menagerie

Answers

A Brother and Sister Relationship in The Glass Menagerie by Tennessee Williams

In the play, "The Glass Menagerie", the characters and relationships between them are very unique. Two unique characters that have a very strong relationship are the brother Tom, and his sister, Laura. Tom is a confused, young man who supports his sister. Laura, his sister, has very low-self esteem and does nothing but sulk around the house all day. Their mother Amanda, is absolutely a lunatic. She is obsessive and controlling to her children, because she wants them to live the life she wanted to live. While Tom works hard to support his family, and has a strong care for Laura, he feels trapped and confused.

Tom and Laura Wingfield in 'The Glass Menagerie' have a complex brother-sister relationship characterized by care and constraint. Tom feels burdened by responsibility, while Laura relies on him, intensifying the familial tension and affecting their interactions.

The relationship between Tom and Laura in The Glass Menagerie by Tennessee Williams is that of a brother and sister who care for each other but are also constrained by their circumstances and personalities. Tom is the breadwinner of the family and feels the weight of responsibility, often seeking escape from the confines of their home life.

Laura, on the other hand, is shy, withdrawn, and suffers from a physical disability, relying on Tom emotionally and financially. Their relationship is complex, as it is filled with affection but also characterized by frustration and a yearning for escape, particularly from Tom's perspective. The play draws attention to their dynamic as Tom grapples with his obligations to his family and his own desires for freedom.

How could you start an essay about what you think it means to be an adult in an interesting way? Create a couple sentences that you could use to gain the reader’s interest.

Answers

It seems that this question is asking for you to create a hook for an essay about what you think it means to be an adult.

A hook is the first few sentences of an essay that is used to "hook" and grab the reader's attention. Hooks can be personal anecdotes, rhetorical questions, or anything else that is compelling to the readers.

The hook should be relevant to the topic. It should also insinuate what you are going to argue for.

So, let's compose some sentences that could start off an essay in an interesting way (aka the hook). Here is an example hook I have made:

Example Hook: Every kid has that dream of how it is to be like an adult. But, how do they see it? Do they believe it is fun and exciting? Do they believe it is scary and stressful? How do other younger people see life as an adult?

If this is a response you should write by yourself, I would recommend composing your own hook, but this should give you a basic idea. Hope this helps! :)

Of course, if you have additional questions, feel free to comment!

Both Jonathan and John Seward had been eager to put past horrors behind them, but now they both begin writing in their diaries again. Why do you think they both feel the need to resume this habit?

Answers

The best answer for this question would be that:

 

These writers were prevented in writing because of the traumatic past horrors that had prevented them from doing their passion. Traumatic pasts can affect a persons reason to do their routine or even deprive them of their daily life. And now that both have timed to heal, they were able to get back to their writing as inspiration.

Other Questions
What term refers to the coldest and densest zone, deep below the surface of a lake? Tyree is a skilled cyclist. when practicing on a stationary bike, his coach finds that when the women's cycling team enters the gym, his speed seems to increase significantly. tyree's increase in speed illustrates What factors are associated with recent intimate partner violence? findings from the who multi-country study on women's health and domestic violence? BY THE PRESIDENT OF THE UNITED STATES OF AMERICA. A PROCLAMATION. I, ABRAHAM LINCOLN, President of the United States of America, and Commander-in-Chief of the Army and Navy thereof, do hereby proclaim and declare that hereafter, as heretofore, the war will be prosecuted for the object of practically restoring the constitutional relation between the United States, and each of the States, and the people thereof, in which States that relation is, or may be, suspended or disturbed. That it is my purpose, upon the next meeting of Congress to again recommend the adoption of a practical measure tendering pecuniary aid to the free acceptance or rejection of all slave States, so called, the people whereof may not then be in rebellion against the United States and which States may then have voluntarily adopted, or thereafter may voluntarily adopt, immediate or gradual abolishment of slavery within their respective limits; and that the effort to colonize persons of African descent, with their consent, upon this continent, or elsewhere, with the previously obtained consent of the Governments existing there, will be continued. That on the first day of January in the year of our Lord, one thousand eight hundred and sixty-three, all persons held as slaves within any State, or designated part of a State, the people whereof shall then be in rebellion against the United States shall be then, thenceforward, and forever free; and the executive government of the United States, including the military and naval authority thereof, will recognize and maintain the freedom of such persons, and will do no act or acts to repress such persons, or any of them, in any efforts they may make for their actual freedom. That the executive will, on the first day of January aforesaid, by proclamation, designate the States, and part of States, if any, in which the people thereof respectively, shall then be in rebellion against the United States; and the fact that any State, or the people thereof shall, on that day be, in good faith represented in the Congress of the United States, by members chosen thereto, at elections wherein a majority of the qualified voters of such State shall have participated, shall, in the absence of strong countervailing testimony, be deemed conclusive evidence that such State and the people thereof, are not then in rebellion against the United States. That attention is hereby called to an Act of Congress entitled "An Act to make an additional Article of War" approved March 13, 1862, and which act is in the words and figure following: Be it enacted by the Senate and House of Representatives of the United States of America in Congress assembled, That hereafter the following shall be promulgated as an additional article of war for the government of the army of the United States, and shall be obeyed and observed as such: Article . All officers or persons in the military or naval service of the United States are prohibited from employing any of the forces under their respective commands for the purpose of returning fugitives from service or labor, who may have escaped from any persons to whom such service or labor is claimed to be due, and any officer who shall be found guilty by a court-martial of violating this article shall be dismissed from the service. SEC. 2. And be it further enacted, That this act shall take effect from and after its passage." What is the effect of the following passage on the U.S. government? ...and the executive government of the United States, including the military and naval authority thereof, will recognize and maintain the freedom of such persons, and will do no act or acts to repress such persons, or any of them, in any efforts they may make for their actual freedom.A) It intends to conscript former slaves into the military.B) It intends to prosecute former slave owners.C) It will not stop any slave from moving toward freedom.D) It will use its military and naval authority to stop the war. Which of the following words has the same root as the word biology? a zoology b geology c bibliography d biograph Which expression is equivalent to (2x^5+7x^3)-(5x^2-4x^3) What is the length of chord JK? Who was the first northern democrat elected to the presidency since 1968? determine the qotient of 7,684 and 78 Choose the sentence that best describes the history of Guatemala's capital city.The capital has always been Guatemala City.The capital has always been Antigua.The capital used to be Antigua, but is now Guatemala City.The capital used to be Guatemala City, but is now Antigua. As a healthier alternative to french fries, some fast food outlets offer pre-sliced, bagged apples as a side option. the ingredients list often reads, "apples and ascorbic acid." ascorbic acid is another name for vitaminc. what role does the ascorbic acid play in the product? ascorbic acid is a sequestrant that binds free metal ions and reduces the rancidity of fat in the apples. ascorbic acid is an antioxidant that prevents discoloration when the apples are cut and exposed to oxygen. ascorbic acid is a curing agent that prevents the growth of clostridium botulinum. ascorbic acid is a color additive that makes the color of the apples appear more vibrant. What are the causes of problems the milers and other Native American groups face in Guatemala how are people trying to solve these problems Which diagram shows the most useful positioning of a rectangle in the first quadrant of a coordinate plane? Answers are in the pictures. In an attempt to stem the rising tide of illegitimacy rates and single-parent families among the poor, which act mandated two-parent coverage for all state afdc programs? the family support act in 1988 the supplemental security income the affordable care act temporary assistance to needy families Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? view available hint(s) where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? it would not bind the target dna. ttttagccatttacgattaatcg ttttagccatttacgattaatcg ttttagccatttacgattaatcg? For the electric field shown, which of the following statements describes an increase in voltage?A) A negative charge crosses an equipotential line toward the source charge.B) You cannot tell from the information given.C) A positive charge crosses an equipotential line toward the source charge.D) A positive charge moves along an equipotential line.UPDATE: ANSWER IS C Which organisms are both secondary and tertiary consumers in the food web Laura is completing a craft project that involves covering only the lateral surface of a cylindrical container with fabric. The cylinder has a height of 16.8 in. and a radius of 14.6 in. To the nearest square unit, how much fabric does she need for this project? Use a calculator. Marie has left written instructions directing doctors and family members to avoid or stop using life-sustaining procedures in the event of a terminal condition. such an instrument is called the A solution in which the hydroxide-ion concentration is 1x10^-2 is