triangle shown to the right is 120 sq units. find the base and height

Answers

Answer 1
the base and the height just have to multiply to 240. it can be 80 and 3 or 60 and 4
Answer 2
Area of a triangle = 1/2 * base * height. Plug in your given info and solve. 

120 = 1/2 * base * height

Multiply by 2 on both sides. This will cancel out the 1/2 on the right side of the equation and isolate our variables, the base and height. You get:

240 = base * height

There wasn't enough information given on the triangle (at least in your description) for the most accurate answer so your answer just becomes any pair of factors at equal to 240.

1, 240
2, 120,
3, 60
4, 80
6, 40
8, 30
10, 24
12, 20
16, 15

Those are all the possibilities not including fractional factors (ex: 1/4 and 960). 

Related Questions

William gave 4 football cards to each of the 6 friends.Suppose he had 54 cards left. Write and solve an equation to find how many cards each friend a initially had.

Answers

T=total

T = 6(4) + 54
William had 78 at the start

Reply if you need more help!
I dont know this one!

Which of the following best describes the symmetry of a trapezoid? Select all that apply.
a) point
b) line
c) plane
d) rotational

Answers

I believe the answer is A

Answer: A.) Point.

Step-by-step explanation:

If the sum of three numbers is 144, what is the average of the three numbers?   

Answers

The average will always be 48. No matter what the numbers are, they will equal 144 and there will always be 3 numbers so you divide 144 by 3 and that equals 48.

Final answer:

The average of three numbers that sum to 144 is 48, found by dividing 144 by 3.

Explanation:

The average of three numbers is the sum of those numbers divided by three. In this case, if the sum of three numbers is 144, then the average can be found by dividing 144 by 3. Calculating this, we get the average, which is 48 (144 ÷ 3 = 48). Hence, the average of the three numbers is 48.

Some students in a school were surveyed to determine how many hours they study per night and their grade-point averages. The results are shown in the table.

If the data are entered into a regression calculator, what is the approximate y-intercept of the resulting regression line?

–1.76
–0.63
0.63
1.76

Answers

It appears either the teacher provided the calculator result or you did so yourself. Either way, the regression equation is approximately y = 0.628x + 1.759

The equation is in slope intercept form y = mx+b
m = slope = 0.628
b = y intercept = 1.759 

The value 1.759 rounds to 1.76 which is the answer
1.76 is the answer
:)

1) In a trapezoid ABCD with legs

AB

and

CD

, the diagonals intersect each other at point O. Compare the areas of: ΔABD and ΔACD


and then


2) In a trapezoid ABCD with legs

AB

and

CD

, the diagonals intersect each other at point O. Compare the areas of:

ΔABO and ΔCDO


pleassssee help

Answers

Answer:

1)  Area of ΔABD = Area of ΔACD and

2)  Area of ΔABO = Area of ΔCDO

Step-by-step explanation:

1) In the given trapezoid ABCD,

AD || BC

Triangles ΔABD and ΔACD lie on the same base AD and lie between the parallel lines AD and BC.

Hence, they are equal in area.

Therefore, Area of ΔABD = Area of ΔACD.


2) From 1), we have

Ar (ΔABD) = Ar(ΔACD)

Subtract Ar (ΔAOD) from both sides,

Ar (ΔABD) - Ar (ΔAOD) = Ar(ΔACD) - Ar (ΔAOD)

Ar (ΔABO) = Ar (ΔCDO)


Written as a percent , what is the probability of getting an odd number on a spinner with 5 equal parts numbered 1 to 5

Answers

1, 3, and 5 are the odd numbers so the fraction would be 3/5. If you multiply the numerator and denominator by 20 you get 60/100, which would give you 60%

The probability of getting an odd number on a spinner with 5 equal parts numbered 1 to 5 is, 60%

What is mean by Probability?

The term probability refers to the likelihood of an event occurring. Probability means possibility. It is a branch of mathematics that deals with the occurrence of a random event. The value is expressed from zero to one.

We have to given that;

To find the probability of getting an odd number on a spinner with 5 equal parts numbered 1 to 5.

Since, From 1 to 5, there are three numbers 1, 3, 5 are odd numbers.

Hence, the probability of getting an odd number on a spinner with 5 equal parts numbered 1 to 5 is,

P = 3/5

Change into percent as;

P = 3/5 x 100%

P = 60%

Thus, the probability of getting an odd number on a spinner with 5 equal parts numbered 1 to 5 is, 60%

Learn more about the probability visit:

https://brainly.com/question/13604758

#SPJ3

just say answer, no need to explain! Thanks!

Answers

The given function is 

f(x) = |x|

Moving 4 units to right means, subtracting the number from x. So moving |x| 4 units to right will give:

f(x) = |x-4|

Moving 2 units up means addition of a number to the function. So moving 2 units up will give:

f(x) = |x-4| + 2

Thus, the correct answer to the question is option B

-1 ≥ -8; Multiply both sides by -2

Answers

2[tex] \leq [/tex]16

Solve for x.
a) x=7.5 b) x=16 c) x=17.5 d) x=27.5

Answers

x = 17.5

Note: This is done in the interior triangle as the angle will be equivalent to the other two angles.

Here's how you solve it:

You have to use the law of cosine for the interior triangle; the law of cosine is: c^2 = a^2 +b^2 - 2ab times cos (C)

Substitute each factor so that the equation now appears as so:

h^2 = 8^2 + 10^2 - 2(8)(10) times cos (80)

This will give you: h = 11.67

Now, you have to apply this to the law of sin which is a over sin(A) = b over sin (B) = c over sin (C). (Lowercase letters are the opposite side of uppercase angles.)

This will then give you:

11.67 over sin (80) = 8 over sin (S) = 10 over sin (T)

sin -1 ((8 times sin (80)) over 11.67)  is equal to S

sin -1 ((10 times sin (80)0 over 11.67)) is equal to T

Because you now know the angles of S and T, you need to use the law of sin again.

t over sin (T) = s over sin (S)

t = 10 + x
s = 8 + 18 = 22

Thus, you need to substitute the variables to get this equation: 

10 + x over sin (57.54) = 22 over sin (42.45) 

x = 22 times sin (57.54) over sin (42.45) and next to this is -10

Thus, getting the answer of x = 17.50

Answer: x = 17.5

Step-by-step explanation:

You're using interior angles

Use the law of cosine: c^2 = a^2 +b^2 - 2ab times cos (C)

h^2 = 8^2 + 10^2 - 2(8)(10) times cos (80) so h = 11.67

11.67 over sin (80) = 8 over sin (S) = 10 over sin (T)

sin -1 ((8 times sin (80)) over 11.67)  is equal to S

sin -1 ((10 times sin (80)0 over 11.67)) is equal to T

t over sin (T) = s over sin (S)

t = 10 + x

s = 8 + 18 = 22

10 + x over sin (57.54) = 22 over sin (42.45) 

x = 22 times sin (57.54) over sin (42.45) and next to this is -10

the answer of x = 17.50

Hope this helps, have a BLESSED and wonderful day! :-)

-Cutiepatutie <3

An ice cream cone has a diameter of 2 inches and a height of 5 inches. What is the volume of the ice cream cone? Round your answer to the nearest hundredth. (Use 3.14 for π.)
10.47 in.3
20.93 in.3
5.23 in.3
15.7 in.3

Answers

we know that
[volume of a cone]=(1/3)*pi*r²*h
for r=2/2---> 1 in
h=5 in

[volume of a cone]=(1/3)*pi*1²*5-----> 5.23 in³

the answer is
5.23 in.3
To find the volume of the cone, you will use the formula for the volume of a cone and replace the r(radius and the h(height) with the given values.

V = 1/3 x pi x r^2 x h
     1/3 x 3.14 x 1^2 x 5
V = 5.2281 

The volume is approximately 5.23 cubic inches.

A 25 foot ladder leans against a wall 7 feet from the base of the wall. How high does the ladder touch?

Answers

a² + b² = c²

a² + 7² = 25²

a² = 25² - 7²

a² = 576

a = 24

Answer: The height is 24 feet.

The height formed by this 25 foot ladder that leans against a wall is 24 feet.

Given the following data:

Length of ladder (hypotenuse) = 25 foot.Adjacent = 7 feet.

What is Pythagorean Theorem?

Pythagorean theorem can be defined as a fundamental mathematical expression in Euclidean geometry that can be used to determine any of the three (3) sides of a right-angled triangle.

Mathematically, Pythagorean's Theorem is given by this formula:

[tex]h^2 = a^2 + b^2[/tex]

Where:

h is the hypotenuse.a is the adjacent side.b is the opposite side.

Substituting the given parameters into the formula, we have;

[tex]h^2 = a^2 + b^2\\\\25^2 = 7^2 +b^2\\\\625=49+b^2\\\\b^2=625-49\\\\b=\sqrt{576}[/tex]

b = 24 feet.

Read more on Pythagorean Theorem here: https://brainly.com/question/16176867

The graph below represents which system of inequalities?


Option A

y > 2x − 3

y > −x − 3


Option B

y < 2x − 2

y < −x + 3


Option C

y ≤ 2x − 2

y > −x + 3


Option D

None of the above

Answers

I don’t know the graph

What’s the largest fraction in each group?
a. 5⁄6 and 29⁄36
b. 5⁄12 and 3⁄8
c. 2⁄5 and 19⁄45
d. 5⁄7, 13⁄14, and 19⁄21
e. 7⁄11 and 9⁄121
f. 1⁄2, 3⁄18, and 4⁄9

Answers

To find the biggest fraction you need to convert them to decimals.
a) 5/6
b) 5/12
c) 19/45
d) 13/14
e) 7/11
f) 1/2
Hope this helps!

Given the two expressions shown below:

square root of 64 plus square root of 5
square root of 64 plus square root of 4

Which statement best describes the two expressions?
Both are rational.
Both are irrational.
A is rational, but B is irrational.
A is irrational, but B is rational.

Answers

Hi there!
The answer is A is irrational, but B is rational.

An irrational number is a number that cannot be written as a fraction.

Expression A.
[tex] \sqrt{64} + \sqrt{5} = 64 + 2.23606...[/tex]
This cannot be written as a fraction and therefore the expression is irrational.

Expression B.
[tex] \sqrt{64} + \sqrt{4} = 8 + 2 = 10 = \frac{10}{1} [/tex]
This can be written as a fraction and therefore the expression is rational

Your answer:
A is irrational, but B is rational.

~ Hope this helps you!
MarkV

Answer:

A is rational, but B is irrational.

Step-by-step explanation:

Determine the factors of ax + ab + 2by + 2xy.

Answers

ax + ab + 2by + 2xy =(ax + ab) + (2by + 2xy)=

=a(x+b) + 2y(x+b) =(x+b)(a+2y)

ax + ab + 2by + 2xy = (x+b)(a+2y)

Answer: (x+b) (a+2y)

Step-by-step explanation:

ax+ab+2by+2xy

split the equatuion in half

1.  ax+ab                    2.     2by+2xy

        gcf=a                          gcf=2y

        ax/a=x                        2by/2y= b  

        ab/a=b                        2xy/2y= x

a(x+b)                                 2y(x+b)

          Answer :(x+b)(a+2y)

brainliest FOR WHO HELP ME a spherical mini donut hole has a diameter of 6 centimeters. A large spherical donut hole has a diameter of 9 centimeters. Approximately how much greater is the volume of a large donut hole than the volume of a mini donut hole?
86 cm³
113 cm³
226 cm³
268 cm³

Answers

4/3 *3.14*4.5^3-Donut Hole
4/3 *3.14*3^3-Mini Donut

Then Subtract the greater answer from the smaller one. 
the answer is 113 if my math is correct 

Find the slope of the line that passes through each pair of points.

1. (5,2),(3,1)

2.(-7,4),(-5,0)

Answers

1. (1-2)/(3-5) = (-1)/(-2) = 1/2

2. (0-4)/(-5-7) = (-4)/(-12) = 1/3

To find the slope you’d do the second y-value minus the first y-value over the second x-value minus the first x-value.

A circular plate has circumference 21.4 inches. What is the area of this​ plate? Use 3.14 for pi.

Answers

Final answer:

Given a circle with a circumference of 21.4 inches, first calculate the radius using the circumference formula, then use the radius to calculate the circle's area, which results in approximately 36.29 square inches.

Explanation:

This question involves determining the area of a circle given its circumference. The formula to calculate the circumference of a circle is C = 2πr, where C is the circumference, r is the radius, and π is a constant (approximated to 3.14). Given that the circumference is 21.4 inches, we can rearrange this formula to find the radius (r = C/2π), giving us a radius of approximately 3.4 inches.

Now, knowing the radius, we can use it to find the area using the formula for the area of a circle, which is A = πr². Plugging in the values, we find that the area is approximately 36.29 square inches.

Learn more about Circle's area here:

https://brainly.com/question/28642423

#SPJ12

Please answer the picture.

Answers

I hope that helps. Feel free to message me anytime if you need more help

A bag contains a total of 25 marbles. Five of the marbles are blue, 3 are red, 8 are green, and 9 are white. If a marble is drawn from the bag and then replaced 50 times, about how many times would a green marble be drawn?
A. 4
B. 8
C. 16
D. 24

Answers

There is an 8/25 chance of drawing a green marble, and since the marbles aee being drawn 50 times, then you have to muliply 8 by 2 to get 16/50. Since the marble is replaced after it’s drawn, the chances of drawing a green marble stay the same with each new pick, so 16/50 probability means that about 16 marbles will be drawn. (C)

Examine the system of equations. y = –3x – 2, y = 7 The value of x is . The solution to this system of equations is .

Answers

Hello!

You can substitute y into the other equation

7 = -3x - 2

Add 2 to both sides

9 = -3x

Divide both sides by -3

-3 = x

The answer is -3

Hope this helps!

The value of x is -3 and the solution to this system of equations is (-3 , 7).

When a number of variables are involved, the system of equation is generated. The system of equation has been the set of simultaneous equations as well.

Given :

[tex]y = -3x-2[/tex]   ----  (1)

[tex]y=7[/tex]  -----  (2)

Solution :

From, equation (1) and (2) we get the value of x to be:

[tex]7=-3x-2[/tex]

[tex]9=-3x[/tex]

[tex]x=-3[/tex]

Therefore, the value of x is -3.

For more information, refer the link given below

https://brainly.com/question/13911928

at the pet shelter,for every 7 dogs there are 5 cats.what is the ratio of dogs to cats?
a.5:7
b.7:5
c.7:12
d.12:7

Answers

B Because there a 7 dogs and five cats
The answer would be B. When it asks Dogs to Cats. The value for dogs would go first. If it was cats to dogs the cat value would be first

write an expression that represent the sum of r and 7

Answers

"The sum of r and 7" can be represented as r + 7

Final answer:

The expression that represents the sum of r and 7 is written simply as r + 7. This is a basic operation in algebra involving the addition of a variable and a constant.

Explanation:

To write an expression that represents the sum of r and 7, you simply add these two together. The mathematical expression for this is r + 7. This is a basic algebraic expression that demonstrates how to represent the addition of a variable, in this case r, with a constant number, which is 7.

An equation is shown below:

5(2x − 3) = 5

Part A: How many solutions does this equation have? (4 points)

Part B: What are the solutions to this equation? Show your work.

Answers

10x -15 = 5
10x = 20
x = 2

This equation has one solution.

The solution would be x = 2

A) This equation has only one solution. B) The solution would be x = 2.

How to find the solution to the given system of equation?

For that ,we will try solving it first using the method of substitution in which we express one variable in other variable's form and then you can substitute this value in other equation to get linear equation in one variable.

If there comes a = a situation for any a, then there are infinite solutions.

Given equation is 5(2x − 3) = 5

By solving further,

10x -15 = 5

10x = 20

x = 2

A) This equation has only one solution.

B) The solution would be x = 2

Learn more about the case of solutions here:

https://brainly.com/question/26254258

#SPJ2

the greatest common factor gcf of 2 monomiald is 3x^2y. One of the monomials is 3x^4y . Which couod be the other monomial.

Answers

While I cannot see your answer choices, the correct answer would be one that has a coefficient that is a multiple of 3 and has an x raised to an exponent of no more than 2.  It could have any other variables in it.

The reason this has to be is because of the GCF.  Since 3 is part of the GCF, and the other monomial has a coefficient of 3, this means the missing monomial must be divisible by 3 as well.

Since x² is part of the GCF, the missing monomial must contain x².  However, if it were to contain x³ or anything larger, the GCF would have x with a higher exponent.
Final answer:

The other monomial must have the factors of 3x^2y, with the possibility of having higher powers of y, but not lower, as this would change the GCF. An example of a compatible monomial with 3x^4y is 3x^2y^2.

Explanation:

The question is asking for the other monomial given that the greatest common factor (GCF) of two monomials is 3x^2y and one of the monomials is 3x^4y. Since the GCF is the product of the lowest powers of common factors in the monomials, the other monomial must have at least the factors 3, x^2, and y to a certain power. It can have these factors to higher powers as well, but not to lower powers, since it would then alter the GCF.

An example of another monomial that could be paired with 3x^4y is 3x^2y^2, because it has the factors of the given GCF with potentially higher powers, without affecting the GCF. Therefore, any monomial of the form 3x^2y^n (where n is greater than or equal to 1) could be the other monomial.

The Smith family has a two-and-a-half-foot-long sandwich to share. One-half foot of the sandwich will serve one person. How many one-half foot servings are in this sandwich?

Answers

To find the amount of servings, we divide the total sandwich by the amount given to one person:
2 1/2 / 1/2
This can simplify into:
5/2 / 1/2
Dividing a fraction is basically multiplying it's flipped side:
5/2 * 2
10/2 = 5
There are 5 servings in the sandwich

Anthony purchased 6 fruit bars and 3 chocolate-nut bars for a camping trip. He spent $4.12 on the bars. Anthony wrote the following equation:  . What did he define as the variable x?

Answers

X is the number of bars that in trip
He used x to represent the number of items in which he bought the fruit bars. The piece of information missing is that we need to know the price, guessing it look like this
(price of FB)x+(price of CB)x=4.12

PLESE HELP FAST!!!!!! WILL GIVE BRAINLIEST!!!! I NEED HELP ASAP!!
\
r. Jones took a survey of college students and found that 60 out of 65 students are liberal arts majors. If a college has 8,943 students, what is the expected number of students who are liberal arts majors?

Answers

the answer to your question is 8255 or 92%

Here, we need to calculate the expected number of students who are liberal arts major.

It is given that, 60 out of 65 students are liberal arts major.

So, we will calculate the percentage of liberal arts major from the total.

Percentage of liberal arts major = [tex] \frac{Number of liberal arts major}{Total students} [/tex] X 100

Percentage of liberal arts major = [tex] \frac{60}{65} [/tex] X 100

Percentage of liberal arts major = 92.31 %

Now, we will calculate for 8,943 liberal arts majors -

In total students of 8,943, liberal arts majors = 92.31 % X 8,943

In total students of 8,943, liberal arts majors =8,256 students (approximately)

There are 16 pink jelly beans in a bag. The ratio of red to pink jelly beans in the bag is 3/4. Which proportion could NOT be used to find r, the number of red jelly beans in the bag

Answers

the complete question in the attached figure

Let
r----------> the number of red jelly beans in the bag
p---------> the number of pink jelly beans in the bag

we know that
r/p=3/4
p=16
so
r/p=3/4--------> r/16=3/4-----> r=(3/4)*16-----> r=12

therefore

case A) 3/4=r/16-----> is correct, the proportion could be used to find r

case B) 16/r=4/3----> r=16/(4/3)----> r=16*3/4-----> r=12-----> is correct
the proportion could be used to find r

case C) 3/4=r/16-----> is correct, the proportion could be used to find r

case D) 3/4=r/16-----> is correct, the proportion could be used to find r

the answer is
All proportions could be used to find r

Jill has a balance of $5,000 on her credit card with an annual interest rate of 15%. To pay off the $5,000 in three years, Jill will have to make a minimum payment of $173.33 per month. To pay off the $5,000 in five years, Jill will have to make a minimum payment of $118.95 per month. How much more does Jill have to pay when the length of the loan changes from 3 years to 5 years? A) $1,239.88 B) $1,957.68 C) $2,137.00 D) $897.12

Answers

mark me brainlyest if i get this right 1 sec
   c is what it is

Answer:

The answer is D) $897.12

Step-by-step explanation:

3 years = 36 months

173.33 * 36 = 6239.88

5 years = 60 months

118.95 * 60 = 7137.00

7137.00 - 6239.88 = 897.12

Other Questions
Which food does NOT contain Vitamin D?A. MushroomsB. TofuC. CaviarD. Kale How much more would $1,000 earn in 5 years in an account compounded continuously than an account compounded quarterly if the interest rate on both accounts is $3.7% How to do this Im lost How do web based applications and websites differ? Describe the effects of Eastern Europes economic problems and ethnic and religious tensions What term refers to the coldest and densest zone, deep below the surface of a lake? Tyree is a skilled cyclist. when practicing on a stationary bike, his coach finds that when the women's cycling team enters the gym, his speed seems to increase significantly. tyree's increase in speed illustrates What factors are associated with recent intimate partner violence? findings from the who multi-country study on women's health and domestic violence? BY THE PRESIDENT OF THE UNITED STATES OF AMERICA. A PROCLAMATION. I, ABRAHAM LINCOLN, President of the United States of America, and Commander-in-Chief of the Army and Navy thereof, do hereby proclaim and declare that hereafter, as heretofore, the war will be prosecuted for the object of practically restoring the constitutional relation between the United States, and each of the States, and the people thereof, in which States that relation is, or may be, suspended or disturbed. That it is my purpose, upon the next meeting of Congress to again recommend the adoption of a practical measure tendering pecuniary aid to the free acceptance or rejection of all slave States, so called, the people whereof may not then be in rebellion against the United States and which States may then have voluntarily adopted, or thereafter may voluntarily adopt, immediate or gradual abolishment of slavery within their respective limits; and that the effort to colonize persons of African descent, with their consent, upon this continent, or elsewhere, with the previously obtained consent of the Governments existing there, will be continued. That on the first day of January in the year of our Lord, one thousand eight hundred and sixty-three, all persons held as slaves within any State, or designated part of a State, the people whereof shall then be in rebellion against the United States shall be then, thenceforward, and forever free; and the executive government of the United States, including the military and naval authority thereof, will recognize and maintain the freedom of such persons, and will do no act or acts to repress such persons, or any of them, in any efforts they may make for their actual freedom. That the executive will, on the first day of January aforesaid, by proclamation, designate the States, and part of States, if any, in which the people thereof respectively, shall then be in rebellion against the United States; and the fact that any State, or the people thereof shall, on that day be, in good faith represented in the Congress of the United States, by members chosen thereto, at elections wherein a majority of the qualified voters of such State shall have participated, shall, in the absence of strong countervailing testimony, be deemed conclusive evidence that such State and the people thereof, are not then in rebellion against the United States. That attention is hereby called to an Act of Congress entitled "An Act to make an additional Article of War" approved March 13, 1862, and which act is in the words and figure following: Be it enacted by the Senate and House of Representatives of the United States of America in Congress assembled, That hereafter the following shall be promulgated as an additional article of war for the government of the army of the United States, and shall be obeyed and observed as such: Article . All officers or persons in the military or naval service of the United States are prohibited from employing any of the forces under their respective commands for the purpose of returning fugitives from service or labor, who may have escaped from any persons to whom such service or labor is claimed to be due, and any officer who shall be found guilty by a court-martial of violating this article shall be dismissed from the service. SEC. 2. And be it further enacted, That this act shall take effect from and after its passage." What is the effect of the following passage on the U.S. government? ...and the executive government of the United States, including the military and naval authority thereof, will recognize and maintain the freedom of such persons, and will do no act or acts to repress such persons, or any of them, in any efforts they may make for their actual freedom.A) It intends to conscript former slaves into the military.B) It intends to prosecute former slave owners.C) It will not stop any slave from moving toward freedom.D) It will use its military and naval authority to stop the war. Which of the following words has the same root as the word biology? a zoology b geology c bibliography d biograph Which expression is equivalent to (2x^5+7x^3)-(5x^2-4x^3) What is the length of chord JK? Who was the first northern democrat elected to the presidency since 1968? determine the qotient of 7,684 and 78 Choose the sentence that best describes the history of Guatemala's capital city.The capital has always been Guatemala City.The capital has always been Antigua.The capital used to be Antigua, but is now Guatemala City.The capital used to be Guatemala City, but is now Antigua. As a healthier alternative to french fries, some fast food outlets offer pre-sliced, bagged apples as a side option. the ingredients list often reads, "apples and ascorbic acid." ascorbic acid is another name for vitaminc. what role does the ascorbic acid play in the product? ascorbic acid is a sequestrant that binds free metal ions and reduces the rancidity of fat in the apples. ascorbic acid is an antioxidant that prevents discoloration when the apples are cut and exposed to oxygen. ascorbic acid is a curing agent that prevents the growth of clostridium botulinum. ascorbic acid is a color additive that makes the color of the apples appear more vibrant. What are the causes of problems the milers and other Native American groups face in Guatemala how are people trying to solve these problems Which diagram shows the most useful positioning of a rectangle in the first quadrant of a coordinate plane? Answers are in the pictures. In an attempt to stem the rising tide of illegitimacy rates and single-parent families among the poor, which act mandated two-parent coverage for all state afdc programs? the family support act in 1988 the supplemental security income the affordable care act temporary assistance to needy families Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? view available hint(s) where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? it would not bind the target dna. ttttagccatttacgattaatcg ttttagccatttacgattaatcg ttttagccatttacgattaatcg?