Use synthetic division and the Remainder Theorem to find P(a)

P(x)=x^4+10x^3+8x^2+4x+10 ; a=2


2


–114


56


146

Answers

Answer 1
  P(x) =  x^4+10x^3+8x^2+4x+10

Synthetic dicision:

           ! 1        10       8        4    10
x=a=2 !             2     24      64  136
----------------------------------------------
             1         12    32      68  146=Remainder

P(a)=P(2)=146

Answer: Fourth option. 146

Related Questions

a student has test scores of 92%, 87%, and 78%. what must she need to score on thenlast test to maintain 80% or better?

Answers

We'll solve this equation in order to find the score of the 4th test, which we denote with x. [tex] \frac{92+87+78+x}{4}=80 [/tex]. Solving it we find that x=63. And it is the final answer for this problem.

Simplify the expression. (x1/8 y1/4)2

Answers

Answer:

Step-by-step explanation:

C) x1/4y1/2

A math club took a test. Twelve of the members had an average score of 80. Eighteen of the members had an average score of 86.

what was the class average score?

Answers

2508/30=83.6 
hope tis helps

The classes average score is 83%

You save three-fifths of your paycheck. Which decimal is equivalent to that fraction?

Answers

Answer: 0.6

Step-by-step explanation:

The fractions have the form shown below:

[tex]\frac{a}{b}[/tex]

Where: a is the numerator and b is the denominator.

To convert a fraction to a decimal number, you must divide the numerator by the denominator.

You know that the fraction is three-fifths, which is written as following:

[tex]\frac{3}{5}[/tex]

Therefore, when you divide the numerator 3 by the denominator 5, you obtain the following decimal number which is equivalent to that fraction:

 [tex]\frac{3}{5}=0.6[/tex]

Answer:

0.6

Step-by-step explanation:

Which ordered pair is a solution of y = x - 4?

( -3, -7 )

( 3, -7 )

( -3, 7 )

( 3, 7 )

Answers

(-3, -7) is your answer

an order pair follows the (x, y) pair, in which (in this case), x = -3, and y = -7

plug in to the respective places inside the equation.

y = x - 4

(-7) = (-3) - 4

-7 = -7 (true)

Therefore, (-3, -7) is your answer

hope this helps
The correct answer is (-3,-7). This is because you can plug it in and the two sides are equal to each other. When you plug -3 in for x, you subtract for from it and get -7 since the y term is -7 the answer is -7=-7, thus (-3, -7) is the answer. 

Joel is mailing a large envelope to his cousin. The envelope has pictures inside, so he doesn't want to bend it.
The mail slot has the dimensions shown. The dotted line shows the widest part of the slot.

Answers

Answer: 25

Step-by-step explanation:

Pythagorean theorem

c=√a²±b²

So it was 7=A

And it was 24=b

solving that it gives us 25

This isn’t that much of help sorry but this is the basic info on how to solve it you can learn more by searching videos about the Pythagorean thermom.

Hope this helps-A

The maximum width of the slot is 25cm (Option A).

To find the maximum width of the mail slot, we need to calculate the length of the diagonal (the dotted line) in the rectangle. The diagonal of a rectangle can be found using the Pythagorean theorem.

Given:

- The length of the rectangle (one side) = 24 cm

- The height of the rectangle (other side) = 7 cm

The formula for the diagonal [tex]\( d \)[/tex] is:

[tex]\[ d = \sqrt{(length)^2 + (height)^2} \][/tex]

Substituting the given values:

[tex]\[ d = \sqrt{24^2 + 7^2} \][/tex]

[tex]\[ d = \sqrt{576 + 49} \][/tex]

[tex]\[ d = \sqrt{625} \][/tex]

[tex]\[ d = 25 \, \text{cm} \][/tex]

So, the maximum width of the mail slot is 25cm.

Full Question:

Joel is mailing a large envelope to his cousin. The envelope has pictures inside, so he doesn't want to bend it.

The mail slot has the dimensions shown. The dotted line shows the widest part of the slot.

What is the maximum width of the mail slot?

A) 25

B) 31

C) 22

D) 20

hey can you please help me posted picture of question

Answers

The correct answer for this completion exercise shown above is the second option (Option B), which is: B. Parent

 Therefore, you have:"In each family of function, the parent function is the most basic function in the family"

 By definition, the most basic fucntion in each family of functions is called “parent fucntion”. A family of function is a set of function that when you graph them, you can notice that they have common charateristics.

which is the coefficient in the algebraic expression 12x + z^4 ?

Answers

I think the coefficient is the 12, before the variable 
Remember a coefficient is any number that comes before a variable as a multiplicative. So, in the equation 12x+z^4 our coefficient would be 12.

Hope this helps!

This graph shows the solution to the inequalities y>3/2x-2 and y<3/2x-10. Does the system of inequalities have solutions? If so, which region contains the solution?

A) there is no solution
B) there is a solution, and it’s shown by region A.
C) there is a solution, and it’s shown by region C
D) there is a solution, and it’s shown by region B.

Answers

we know that

the region A satisfies only the inequality-------> y>3/2x-2 

the region C satisfies only the inequality------->  y<3/2x-10

the region B
does not satisfy any of the two inequalities

there is no region that satisfies both inequalities

therefore
the answer is the option
A) there is no solution  

Answer:

there is no solution

Step-by-step explanation:


[tex]42 \times 42 \times 29 = [/tex]

Answers

The correct answer is 51156



Hope this helps :)

the cost of 10 yearbooks $250 what is the cost of one yearbook

Answers

$25 per yearbook

The cost is x and the amount is 10
So the equation is 10x=$250
Divide 250 by 10 and get 25
The per-yearbook cost is
   $250/10 = $25

_____
Whether you can actually purchase one yearbook for that price depends on a number of factors.

What’s 3.192 rounded to the nearest hundredth ?

Answers

3.19 is the answer to your problemo.
Yes, the soulution is 3.19

Rex painting the garage in the shed he uses 3 gallons of paint on the garage he uses 3/4 of that amount on the shed enter the amount of paint in gallons Rex uses on the shed

Answers

(3/4) of 3 gallons is ...
  0.75×(3 gallons) = 2.25 gallons

Rex uses 2.25 gallons of paint on the shed.

Rex uses 2.25 gallons of paint on the shed, which is [tex]\( \frac{3}{4} \)[/tex] of the 3 gallons of paint he uses on the garage.

To find out how much paint Rex uses on the shed, we need to calculate [tex]\( \frac{3}{4} \)[/tex] of the amount of paint he uses on the garage.

Rex uses 3 gallons of paint on the garage.

Therefore, the amount of paint he uses on the shed is:

Paint used on the shed = [tex]\frac{3}{4} \times 3[/tex]

Calculating this:

Paint used on the shed = [tex]\frac{3 \times 3}{4}[/tex]

= [tex]\frac{9}{4}[/tex]

= 2.25

So, Rex uses 2.25 gallons of paint on the shed.

Michelle collects US, Canadian and Mexican stamps. In her collection 80% of the stamps are U.S. and Mexican stamps. there are 3 times as many U.S. stamps as Mexican stamps. WHat percent of Michelle's collections is made up of U.S. stamps?

Answers

We know that 80% of the stamps are US and Mexican. 
The US stamps are 3 times the Mexican stamps. That means that of the 80%, Mexicans comprised of the 20% and US comprised of the 60% to satisfy the relationship of their ratios. 

Therefore, 60% of Michelle's collection is made up of US stamps.  
     

Final answer:

Michelle's stamp collection consists of 60% U.S. stamps, determined by solving equations based on the given information that U.S. and Mexican stamps make up 80% of her collection and there are three times as many U.S. stamps as Mexican stamps.

Explanation:

The student asked what percent of Michelle's stamp collection is made up of U.S. stamps if 80% are U.S. and Mexican stamps and there are 3 times as many U.S. stamps as Mexican stamps. To solve this, let's call the percentage of U.S. stamps 'U' and the percentage of Mexican stamps 'M'. According to the given information, U + M = 80%, and U = 3M.

We substitute the second expression into the first to get 3M + M = 80%, which simplifies to 4M = 80%. Dividing both sides by 4 gives M = 20%. As the number of U.S. stamps is three times the number of Mexican stamps, we calculate U as 3 × 20% = 60%. So, the percentage of U.S. stamps in Michelle's collection is 60%.

you have $120 to donate equally to several charities. Does this situaton represent direct or inverse variation? Explain.

Answers

This situation represents inverse variation.

The difference between direct and inverse variation is in direct variation, as one variable goes up the other does too, while in inverse, as one variable goes up the other falls.

In this case, as you donate to more charities, the amount you donate to each charity falls, because you donate an equal amount. This means it's inverse variation.

Hope this helps!

a plumber has a 36in. pipe that he has to cut into two pieces so that one piece is 8 in. longer than the other. find the length of each piece?

Answers

one piece is 14 in the other is 22 in
one is 22
and the other one is 14

What shape is the graph of the equation below? (x-5)^2/4^2 + y^2/7^2=1 A. A line B. A circle C. A parabola opening to the right D. A hyperbola opening to the right and left E. A hyperbola opening up and down F. An ellipse

Answers

the answer to your question

is the letter  C

Let's explore the equation to see why the graph of the formula that is given sounds like:

((x−5)²/(4)²) + (y²/(7)²) = 1

This equation represents the standard form of an ellipse:

((x−h)²/a²) + ((y-k)²/(b)²) = 1

Where:

*The ellipse's center is (h,k).

*The semi-major axis's length, or horizontal radius, is denoted by a.

*The semi-minor axis's length, or vertical radius, is b.

Comparing the given equation to the standard form, we see that:

*h=5 (center is at x=5)

*a=4 (semi-major axis length)

*b=7 (semi-minor axis length)

Since both a and b are positive and the denominators of both terms are squared, the graph represents an ellipse. Therefore, the correct answer is F. An ellipse.

The given equation is in the form of an ellipse:

((x−5)²/(4)²) + (y²/(7)²) = 1

It matches the standard form of an ellipse equation:

((x−h)²/a²) + ((y-k)²/(b)²) = 1

where (h,k) is the center of the ellipse, and a and b are the lengths of the semi-major and semi-minor axes, respectively.

In this equation, h=5, a=4, and b=7, indicating the ellipse is centered at (5,0) with a horizontal radius of 4 and a vertical radius of 7.

Therefore, the correct answer is F. An ellipse.

Complete Question:

What shape is the graph of the equation below?

A. A line

B. A circle

C. A parabola opening to the right

D. A hyperbola opening to the right and left

E. A hyperbola opening up and down

F. An ellipse

what is the limit of f (×) as x approaches - infinty

Answers

If the degree of numerator and denominator are equal, then limit will be leading coefficient of numerator divided by the leading coefficient of denominator.

So then the limit would be 3/1 = 3.

Alternatively,

[tex]\displaystyle \lim_{x\to\infty}\dfrac{3x^2+6}{x^2-4}=\displaystyle \lim_{x\to\infty}\dfrac{3x^2+6}{x^2-4}\cdot\dfrac{1/x^2}{1/x^2}=\lim_{x\to\infty}\dfrac{3+\frac6{x^2}}{1-\frac4{x^2}} = \dfrac{3+0}{1-0}=\boxed{3}[/tex]

Hope this helps.

Final answer:

The limit of a function as x approaches negative infinity is the value that the function f(x) approaches as x becomes very large in the negative direction. For example, the limit of 1/x is 0 as x approaches negative infinity, while the limit of 1/x² approaches positive infinity. Functions that oscillate, like sin(\u03C0/x), do not have a limit at infinity.

Explanation:

When discussing the limit of a function f(x) as x approaches negative infinity, we are essentially asking what value f(x) gets closer to as x becomes very large and negative. For instance, consider the function 1/x. As x approaches negative infinity, 1/x gets closer to 0, and we say that the limit of 1/x as x approaches negative infinity is 0. Similarly, for a function like 1/x² which "blows up" or increases rapidly as x approaches 0 from either side, we notice that as x approaches negative infinity, the function approaches positive infinity since the squared term always results in a positive number.

However, not all functions have limits at infinity. For functions that oscillate, such as sin(\u03C0/x), as x approaches 0, it oscillates indefinitely between -1 and +1 and does not approach a specific value.

The formal definition of a limit at infinity states: If there is a number L such that f(x) gets arbitrarily close to L when x is sufficiently large (positively or negatively), we write lim f(x) = L as x → -∞.

Form a sequence that has two arithmetic means between -1 and 59.
a.
-1, 29, 29, 59
c.
19, -1, 59, 39
b.
-1, 19, 39, 59
d.
-1, 14, 29, 44, 59

Answers

The formula for solving the problem is as follow:
an = a1 + (n - 1)d
Where:
n = number of figure in the sequence = 4
d = difference between successive number =?
a1 = -1
a4 = 59
Insert the given values into the formula,
59 = -1 + (4 - 1)d
59 = -1 + 3d
59 + 1 = 3d
60 = 3d
d = 60/3 = 20
Therefore, d = 20. This implies that, there is a difference of 20 between successive numbers.
The number sequence is as follow:
-1, 19, 39, 59.

two arithmetic means between -1 and 59.
b.-1, 19, 39, 59

hey can you please help me posted picture of question

Answers

The correct answer is option D.

The steps to find the inverse are listed below.

[tex]f(x)= \frac{2x}{7}+4 \\ \\ y= \frac{2x}{7}+4 \\ \\ y-4= \frac{2x}{7} \\ \\ 7(y-4)=2x \\ \\ x= \frac{7(y-4)}{2} \\ \\ f^{-1}(y)= \frac{7(y-4)}{2} \\ \\ f^{-1}(x)= \frac{7(x-4)}{2} \\ \\ [/tex]

Use complete sentences to describe the domain of the cosine function.

Answers

The domain of a function is the set of the possible input values of the function. For example: consider the function f(x) = cos x, the domain of the function is the set of possible values of x.

The cosine function takes x values from all real numbers.

Therefore, the domain of the cosine function is a real numbers.

im posting several questions i need help with in an image

Answers

Answers:
(1) n = 4
(2) x = 30
(3) a = -4
(4) n =10
(5) n = -46.2


Explanation:
(1) Given
9n-8 = 28
9n = 28 + 8
9n = 36
n=4

(2) Given
-1-x = -31
-x = -31 + 1
x = +31 - 1
x = 30

(3) Given
9-4a = -5a + 5
-4a + 5a = 5 - 9
a = -4

(4) Given
n/2 = 5
n=5*2
n = 10

(5) Given
29.5 = -16.7 -n
n = -16.7 - 29.5
n = -46.2

1.
9n = 28 + 89n = 36n=4
2.
-x = -31 + 1x = 31 - 1x = 30

3.
9-4a = -5a + 5-4a + 5a = 5 - 9
a = -4

4.
n/2 = 5n=5*2 n =10

5.
29.5 = -16.7 -nn = -16.7 - 29.5n = -46.2

A cylindrical thermos has a radius of2 in. and is 5 in. high. It holds 10 f oz. To the nearest ounce, how many ounces will a similar thermos with a radius of 3 in. hold? Show your work

Answers

let
A--------> larger thermos with radius 3 in
B-------> smaller thermos with radius 2 in

we know that
scale factor=radius larger thermos/radius smaller thermos
scale factor=3/2----> 1.5

volume larger thermos=[scale factor]³*volume smaller thermos
volume larger thermos=[1.5]³*10 f oz-----> 3.375*10-----> 33.75 f oz----> 34 f oz

the answer is
 34 f oz

y equals x + z + 5 Z equals -3 y - 3 2x minus y equals negative 4 How can i solve using 3 variable systems of equation

Answers

To solve a set of linear equations in 3 variables, you need 3 equations. As far as I can tell, you have 2 equations here, so the best you can do is write expressions for 2 of the variables in terms of the third.

If you have
  x +z +5z = -3y -3
  3x -y = -4
Then you can rewrite as
  x = -1.5 -0.6z
  y = -0.5 -1.8z

_____
You can get this by any of the usual methods of solving linear equations. Just treat the system as two equations in x and y with the z terms on the right side of the equal sign:
  x +3y = -3 -6z
  3x -y = -4

Marisol and Mimi walked the same distance from their school to a shopping mall. Marisol walked 2 miles per hour, while Mimi left an hour later and walked 3 miles per hour. If they reached the mall at the same time how far is the mall from their school?

Answers

Let the time in hours after Marisol starts walking be t  and so the time in hours after Mimi starts walking is (t-1)
The distance walked by Marisol=speed*time=2t
Distance walked by Mimi=3(t-1)

When they've reached school they've all walked the same distance so:
3(t-1)=2t
3t-3=2t
3t-2t=3
t=3
Thus the distance from the mall to their school is 2t=2*3=6 miles

What is the perimeter of the rectangle? Write your answer in scientific notation. The area is 2.76 x 10 pw12 the width is 4.6 x 10 pw5 pw is the power

Answers

The caret (^) is the symbol conventionally used to indicate an exponent.

You have
  area = 2.76·10^12
  width = 4.6·10^5

You want to find the perimeter of the rectangle with these dimensions.

The perimeter of a rectangle is twice the sum of length and width.
  perimeter = 2*(length + width)
The length can be figured from the area using the formula for area.
  area = length*width
  area/width = length . . . . . . . . . divide by width
Filling in the numbers, we have
  perimeter = 2*((2.76·10^12)/(4.6·10^5) +(4.6·10^5))
  perimeter = 2*(6.0·10^6 +0.46·10^6)
  perimeter = 2*6.46·10^6 = 1.292·10^7

The perimeter of the rectangle is ...
  1.292·10^7
Final answer:

To calculate the perimeter of a rectangle in scientific notation, divide the given area by the width to find the length, then use the perimeter formula (P = 2×length + 2×width), accounting for the power of 10 in your calculations to maintain proper notation.

Explanation:

The perimeter of a rectangle can be found using the formula P = 2×length + 2×width. Given the area of the rectangle (2.76 x 10^12 square units) and the width (4.6 x 10^5 units), we can find the length by dividing the area by the width. The length would therefore be the area divided by the width which is (2.76 x 10^12) / (4.6 x 10^5) = 6 x 10^6 units. Now that we have the length and width, we can calculate the perimeter by substituting into the formula: P = 2×(6 x 10^6) + 2×(4.6 x 10^5) = 1.2 x 10^7 + 9.2 x 10^5. Converting the width to the same power of 10, we get P = 1.2 x 10^7 + 0.092 x 10^7 = 1.292 x 10^7 units. This expresses the perimeter in scientific notation.

How can we check the binomial factors to verify that they are truly factors? Are the factors (x + 5)(x – 8) truly factors of x2 – 2x – 30. Show your work.

Answers

They are not. The easiest way to tell this is by multiplying the last number of each parenthesis together. This should always result in the last number in the equation. However, -8*5 does not equal -30, so these are not the true factors. 
You verify your answer by using the F.O.I.L. method. First Outside Inside Last. This shows that (x+5) & (x-8) is not the correct factors for 2x-2x-30 or x2-2x-30. Either way, the factors are not right for either of those equations. Hope my answer helps you

hey can you please help me posted picture of question

Answers

The real part of two complex numbers will be added together and the complex parts will be added together. So the sum will be:

( 6 - 2i) + ( 11 + 6i)

= 6 + 11 - 2i + 6i

= 17 + 4i

So the answer to this question is option D

What are the dimensions of the image at fraction 1 over 2 times its current size?

Length = 4 inches, width = 5 inches
Length = 6 inches, width = 8 inches
Length = 10 inches, width = 12 inches
Length = 16 inches, width = 20 inches

Answers

length= 4 inches, width= 5 inches

Answer:

Length = 4 inches, width = 5 inches

Step-by-step explanation:

hey can you please help me posted picture of question

Answers

The correct answer is: Option (D) 36


Explanation:
Multiply all the items to get all the possible outcomes (in this case sandwiches).
Kinds of breads = 3
Kinds of meat  = 4
Kinds of cheese = 3


Hence 4*3*3 = 36 (Option D)
Other Questions
How is augmented reality used A) to integrate 3-D graphics for providing a live, direct, or indirect view of a physical real-world environmentB) to gather and analyze digital data using special software toolsC) to provide up-to-the-minute information for decision-making processesD) to monitor employee movement during working hours Compare and Contrast topics and themes of writers from Americas and Europeans Predict where the Katydid would hide from danger? Draw a picture of what you predict, help please The Silk Road was discovered by __________. A. Marco Polo B. Genghis Khan C. General Zhang Qian D. Kublai Khan Calcium carbonate reacts with hydrobromic acid to form calcium bromide, carbon dioxide, and water according to the reaction below. what is the molarity of the hydrobromic acid if 250.0 ml of it reacts with 5.64 grams of calcium carbonate? Explain why the equation (x-4)^2-10=15 has two solutions. Then solve the equation to find the solutions. Please show all your work! (30 points) A standard number cube with the numbers 1 through 6 is rolled. Find the probability of rolling a number greater than 5 .1. 1 / 62. 1 / 33. 1 / 44. 2 / 3 If a = 0.3 with a line over 3 and b = 0.5 with a line over 5, what is the value of a + b?8/108/988/10080/99 75 points Write and solve an equation to find the measure of NEP. Make sure you show all work. A ladder leans against a building. The angle of elevation of the ladder is 70. The top of the ladder is 25 ft from the ground. To the nearest tenth of a foot, how far from the building is the base of the ladder?20.5 ft30.5 ft32.3 ft39.5 ft Three positions of praying mentioned in the Old Testament are:kneeling and sittingkneeling, standing, and falling face downstanding and sittingkneeling, sitting, and lying on one's side Andrew drove 55 mph on his trip. Which of the following equations best represents the distance he drove if x stands for the number of hours? Two people start walking at the same time in the same direction. One person walks at 8 mph and the other person walks at 2 mph. In how many hours will they be 4.5 miles apart? Rowland and molina's work showed that ultraviolet light in the stratosphere causes cfcs to release ________ atoms. Why is this cover letter inappropriate? Genetic disorders caused by multiple genes interacting with the environment are called Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? view available hint(s) where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? it would not bind the target dna. ttttagccatttacgattaatcg ttttagccatttacgattaatcg ttttagccatttacgattaatcg? Find the product.y 4 y 6 Identify a management practice most conducive to the traditional personality. Use the net to find the approximate surface area of the cylinder to the nearest square meter