Use the text below to answer the following question: Case study: The Very Big Apple With over eight million people, New York City is the most heavily populated city in the U.S. Between 1800 and 1900, the population of New York increased from about 80,000 to over three million people. In the years after the Civil War, the population of New York City tripled. With a large influx of European immigrants New York became known as the "melting pot." New York has always had the highest population density of any U.S. city. According to the 2000 census, New York City has about 26,403 people per square mile—almost twice the number of people per mile as Chicago. Based on the statistics in the text and your knowledge, what was most likely the biggest challenge for city officials because of the wave of immigrants?
Keeping up with housing needs
Finding jobs for everyone
Protecting those already in the city
Increasing mass transportation

Answers

Answer 1

The most significant challenge for New York City officials due to the wave of immigrants was keeping up with housing needs, as the sudden population increase placed a heavy demand on the city's housing infrastructure.

Based on the provided information about New York City's rapid population growth in the wake of the Industrial Revolution, the biggest challenge for city officials at the time was likely keeping up with housing needs. The influx of immigrants and the natural increase in population would have exerted tremendous pressure on the city's housing infrastructure.

The statistics showing a dramatic rise from about 80,000 people to over three million between 1800 and 1900, and the description of New York as a "melting pot," indicates that proper accommodation for the diverse and quickly growing population would have been a primary concern.

In the late 19th and early 20th centuries, as the Industrial Era progressed, factories moved closer to urban centers. This led to even more people relocating to cities, further increasing the demand for housing. Moreover, given that New York City had the highest population density of any U.S. city and an extremely high number of people per square mile, finding room for all those new residents would have been exceptionally challenging.

While finding jobs, protecting those already in the city, and increasing mass transportation would also have posed significant challenges given the rise in population, the immediate impact of the incoming residents would have primarily been felt in the housing sector. Providing adequate living conditions for the new arrivals and addressing overcrowding would have been essential tasks for urban planners and policymakers.


Related Questions

what were some major ideas and events (i.e., Enlightenment philosophies, colonial conflicts, imperial regulations, acts of rebellion) that led to the American Revolution?

Answers

The following is a list of causes of the American Revolution
1) Conflict between Great Britain and American colonists- The passage of several different taxes like the Tea Act and Stamp Act caused constant problems between the colonists and the government. This was due to the fact that the taxes were passed without the consent of the colonists.
2) Boston Masaacre- 5 unarmed colonists were killed British soldiers after a confrontation in the Boston streets.
3) Enlightenment ideas- the concepts of the social contract and unalienable Rights helped spark the American Revolution.
Final answer:

The American Revolution was influenced by the Enlightenment ideas of reason and individual rights, persistent colonial conflicts with British imperial regulations, and the impact of texts like Thomas Paine's Common Sense. Together, these factors incited ideologically, economically, and politically motived resistance that paved the way for rebellion and ultimately, revolution.

Explanation:

Causes of the American Revolution

The American Revolution was a culmination of ideological, political, and economic tensions between the American colonies and the British Empire. The Enlightenment, a period characterized by an emphasis on reason and individual rights, heavily influenced revolutionary leaders. Enlightenment philosophers such as John Locke argued for the concept of natural rights and government as a social contract with the people, which shaped colonial perspectives. Thomas Paine's pamphlet Common Sense conveyed the impracticality of a hereditary monarchy and the importance of self-governance, resonating with many colonists.

Colonial Conflicts and Imperial Regulations

Throughout the 18th century, British efforts to consolidate imperial control, through acts like the Stamp Act and the Townshend Acts, were met with colonial resistance. The colonists, many of whom saw themselves as equals to British citizens, demanded the right to govern themselves and manage their own taxes. Their resistance laid the groundwork for a broader movement towards autonomy.

Events Leading to the American Revolution

Additionally, events such as the Boston Massacre and the Tea Act catalyzed public opinion against British rule. Colonial elites, merchants, and frontiersmen had distinct motives, yet converged in opposition to British trade restrictions and encroachments on autonomous governance. The result was a patchwork of grievances that collectively led to the start of the American Revolution.

Under the Articles of Confederation, why was the national government unable to raise revenue? Check all that apply. -1 The national government was not given the power to regulate trade. -2 The national government needed approval from the states to collect taxes. -3 The states voted to allow the national bank to go bankrupt. -4 The state and national currencies competed with each other. -5 The national government could not create national money.

Answers

-1 The national government was not given the power to regulate trade.
-2 The national government needed approval from the states to collect taxes.
-4 The state and national currencies competed with each other. 
Correct answer choices are:The federal government was not given the power to regulate tradeThe federal government needed approval of the states to collect taxesThe state and national currencies competed with each otherExplanation:

A panic of central government restrained the formulation of such a control, and broadly experienced political theory believed that a self-government could not sufficiently assist a huge country such as the United States. The representatives of a vast republic would be incompetent to settle in touch with the people they impersonated, and the republic would surely decline into a oppression. To several Americans, their union looked to be solely an alliance of confederated states, and their Congress a strategic association, serving thirteen independent republics.

As the midpoint of the Revolutionary War, Washington had proposed amending the Articles of Confederation. Especially, he recognized the rules of the national government had to be established so it could raise revenues and improve trade. The Articles did not support Congress to tax. It was up to the states when they needed to supply funds to the central administration. As a consequence, Congress had to obtain funds to finance the war. The federal mortgage skyrocketed, ending in a crippling rise and inflation. Paper currency was useless.

why were mormons persecuted?... And what was the cause for the fight for the Alamo ?

Answers

The cause for the fight at the Alamo was all because Texas wanted independence from Mexico. Most everyone died except for Susana Dickson and her baby so she can tell the others what has happened.

both houses of Congress represent the executive branch

Answers

Answer:

Explanation:

 The federal senate and a chamber of deputies. They are  part of the national congress, represents the Brazilian legislative power, at the federal level.   The chamber of deputies is made up of representatives of the people, while the senate is made up of representatives of the state and the federal district.

What did the United States do to encourage Texas to give up some of its land?

A) threatened to fine or punish it

B) offered to pay off its debt

C) allowed it to become a slave state

D) promised it other land

Answers

The United States offered to pay off its debt  to encourage Texas to give up some of its land. Option B is correct.

The Texas annexation was the 1845 annexation of the Republic of Texas into the United States, which was admitted to the Union as the 28th state on December 29, 1845.

Mexican Texas is the historiographical name used to refer to the era of Texan history between 1821 and 1836, when it belonged to Mexico.

Answer:

B is the answer i am on the test

Explanation:

The fastest growing group of americans in 2005 categorized themselves as

Answers

The answer is multiracial

Answer:

Multi-racial  Americans are the fastest growing group in 2005.

Explanation:

Multi-racial Americans are among the fastest-growing society of demographics in America. There are few young, tolerant, and growing at the fastest speed than other populations. As America is divided because of race, different social groups are against interracial marriages. However, some multiracial adults are proud of their mixed-race lives; they also feel that their human race has given them open to other diverse cultures. Because of this, a high number of population is proud to have a multi-racial background.

Infinity War’s Thanos proves CGI supervillains are a terrible idea , ideas?

Answers

Infinity War’s Thanos proves CGI supervillains are a terrible idea , ideas?

The correct answer is:
 Infinity War’s Thanos proves CGI supervillains are a terrible idea.

We used idea since before the word terrible, there is "a" word which signifies that it is singular and CGI supervillains is a singular word thus making the "idea" also a singular.

Answer:

naw

Explanation:

explain 4 Nuremberg laws.

Answers

The Nuremberg Laws, as they became known, did not define a "Jew" as someone with particular religious beliefs. Instead, anyone who had three or four Jewish grandparents was defined as a Jew, regardless of whether that individual identified himself or herself as a Jew or belonged to the Jewish religious community. Many Germans who had not practiced Judaism for years found themselves caught in the grip of Nazi terror. Even people with Jewish grandparents who had converted to Christianity were defined as Jews.

Which group was not a target for fascism in the United States during world war II?

Answers

Fascism in general is characterised by a purist ideology (i.e., the ideology that a 'pure' national race is to be maintained within a country and that other races are to be eliminated). American fascism was no exception: it mainly promoted the rights of white Americans - which is thus a group they did not attack. For this reason American fascists are sometimes called "white supremacists". 

why did the middle colonies grow quickly?
A. they were in a good commercial location between New England and the southern colonies.
B. they only accepted a certain type of person and their colonies.
C. the land wasn't easy to farm so they needed more people to work.
D. their population was mostly indentured servants looking to get to the new world.

Answers

D. the were escaping to a New World
Your answer is A. At first I thought it was D, but that’s not right because if they were servants, they wouldn’t be getting into the new world.
Sorry if I’m wrong! Hope you get a good grade!

Explain the difference between subsistence and commercial agriculture. (Site 1)

Answers

Subsistence agriculture is the production of food primarily for consumption by the farmer and mostly found in less developed countries. Commercial agriculture is when farmers grow food for a profit.
In subsistence agriculture, farming is grown for consumption by the farmer.
In commercial agriculture, the primary objective is to make a profit.

which is an example of de facto segregation?
A) A law establishes schools for white children only
B) Families of the same race live in the same neighborhood
C) Laws require children to go to integrated schools
D) Citizen groups denounce racial integration

Answers

the answer should be B.

Republicans believed that black codes and other restrictions on freedmen's rights were a result of

Answers

It established more schools and made efforts to educate freed slaves in the South

Republicans and particularly Radical Republicans in Congress believed that Black codes were enacted by Southern states to maintain White supremacy and to curtail the rights of freedmen, essentially attempting to perpetuate the social and economic conditions of slavery post-Civil War.

Black Codes and Freedmen's Rights

The Black codes were a series of discriminatory laws enacted by Southern states after the Civil War. These laws were aimed at maintaining White supremacy and were seen by Republicans, particularly the Radical Republicans in Congress, as a direct response to the attempts at social and economic advancements of African Americans during Reconstruction.

The Black codes restricted the civic participation of freed enslaved people by depriving them of the right to vote, serve on juries, own or carry weapons, and in some cases, even the right to rent or lease land. Despite the Thirteenth Amendment's outlawing of slavery, these laws essentially attempted to continue the social and economic hierarchies of slavery.

Radical Republicans believed that the Black codes and other restrictions were a means for former Confederates and sympathizers, now returned to power in Southern states, to limit the newly won civil rights of freedmen. The codes varied from state to state, but commonly included severe vagrancy laws and denied fundamental rights such as property ownership and the right to testify against White individuals in court.

what method did the United States use to prevent huge shipping losses in the Atlantic

Answers

They used a convoy system

Why was 1976 a good year to focus on starting over?

Answers

I'm guessing to start over again with no more conflict between each other because of the Vietnam war. so to probably end dove vs hawks. but I'm not quite sure though.

What did Coolidge miss by not running for office in 1928? WWI , The Great Depression, WWII The Eighteenth Amendment

Answers

It was the Great Depression as it had started in 1929. But, I'm not 100% sure on this...

It was the Great Depression

who found the new world in 1492 on his journey across the sea

Answers

Christopher Columbus 
Christopher Columbus, he sailed across the Atlantic and landed in the Bahamas.  he thought he was in India, that is why we call native Americans Indians 

explain one way in which international relations in the period 1900-1945 changed as a result of japanese policies

Answers

Before modernization of Japan, it was easily subdued by foreign powers. It was highly skeptical of colonial powers of Britain and France and was also not happy about the presence of United States in the Pacific.

After the Meiji Restoration period, Japan had not only developed an advanced, export led economy, it was able to muster a regional military force which had warships, guns, and fighter planes.

Japan had a new found confidence in it's abilities and sought to challenge regional players for dominance.

Britain, China, Russia all posed some form of a threat to Japan, which the rulers believed should be eliminated for Japan to prosper.

Eventually, Japan became involved in Wars with major powers which they eventually lost in 1945.

In 1868 there was an event in Japan called the Meiji restoration that gave power to the emperor Meiji. The objectives of this restored rule were explained in the Charter Oath. They were progressive laws that wanted to open Japan to trade and modernization. By the end of the 19th century, Japan had transformed itself into a modern state. However, we have to take into account that Japan was always an expansionist country. During Meiji restoration, the education system in Japan trained children into Bushido (¨the spirit of the warriors¨) . The industrialization of Japan led to a rise in the military power. Japan soon got engaged in a war against Russian (1904-1905). The complete victory of Japanese forces was a surprise for world observers. Russia agreed to withdraw from the south on Manchuria and the control of Japan over Korea was recognized. Japan participated in the World War I in an alliance with Entente powers securing lanes in the Pacific Ocean against the German. As you can see Japan continued its expansionism policy. It was until the attack of Pear Habor in 1941 that the USA learned the bitter reality of Japanese policies.

Why was the soviet invasion of Afghanistan troubling to the United States

Answers

Afghanistan being in a very strategic position has provided the Soviet the advantage of controlling trades as it is in the juncture between Asia and middle east. This gave better leverage to the Soviet compared to the united states having control of pakistan after WorldWar 2. The soviet influenced has not been good in terms of improving afghan either as it made several internal tribal sect enemies with each other due to oppression and poor economy impacting poorest of the poor families.
THis is because Afghanistan is a good place for trade and market, invasion or terrorism in afghanistan will lessen and complicate trade in Asia and America. 

in the United States your legal right to express your political options to government officials is under the Amendment

Answers

Your right to express your political opinions is protected under the First Amendment

the growth of feudalism in europe during the middle ages was primarily caused by the

Answers

The fall of the Roman Empire

Describe how president bush's foreign policy initiatives departed from the traditional policies practiced by every president since world war ii

Answers

A key difference was in using US military power preemptively to combat enemies of democracy around the world.


The "Bush Doctrine" in foreign policy had these core ideas:  that the United States could pursue this goals on its own (without need for United Nations partnerships), that preemptive strikes were allowable against countries that harbored terrorists, and that regime change for the sake of promoting democracy was a good strategy.  
Applied in regard to "the war on terror," Bush's foreign policy advocated that the best defense against terrorism in the world was to use American power to spread democratic values in countries that were potential breeding grounds for terrorist activity.  This sort of policy agenda was part of the "neoconservative" view of a number of  President George W. Bush's advisers -- especially some who had also served in the administration of his father, President George H.W. Bush.  In the wake of the 9/11 attacks, there was a desire to push American values and not be shy about doing so with the use of American military might.  

How did the need to rebuild after the war affect the choices made by the US and the soviet union? (US History, The Cold War)

Answers

The United States sponsored what became known as "The Marshall Plan" (so called after Secretary of State George Marshall).  The official name of the program was the European Recovery Program.  Initially, this support was offered to all nations in Europe needing recovery after the war.  But the Soviet Union denounced the plan as a device to push countries to align with the United States and its "capitalist imperialism." Thus nations that were under Soviet influence withdrew from involvement in the plan. The Western European democracies that were aided by the Marshall Plan received $13 billion in economic aid.  (That would more that $100 billion in today's dollars.)

The Soviet Union sponsored its own plan for the communist bloc nations.  The USSR's foreign minister, Vyacheslav Molotov, proposed his own plan to aid states in alliance with the USSR.  The Soviet Union aimed to strengthen its own ties to communist-leaning countries in Europe.  The plan established the Council for Mutual Economic Assistance (COMECON), which was an economic organization of communist states that lasted from 1949 to 1991.

After declaring war on japan in 1941, how did the u.s. government deal with americans of japanese heritage

Answers

The government restricted the civil liberties of Japanese Americans.  In February, 1942, President Roosevelt issued Executive Order 9066, which allowed the Secretary of War to designate certain areas as military zones.  FDR's executive order set the stage for the relocation of Japanese-ancestry persons to internment camps.  By June of 1942, over 100,000 Japanese Americans were sent to such internment camps.
They were sent to camps

In the antebellum south, which segment of the population exercised the greatest political and economic power

Answers

Wealthy slave-owners

Hope this helped :)

Why was doryphoros or spear bearer famous throughout the ancient world?

Answers

The Doryphoros (Greek Δορυφόρος Classical Greek Greek pronunciation: [dorypʰóros], "Spear-Bearer"; Latinised as Doryphorus) of Polykleitos is one of the best known Greek sculptures of classical antiquity, depicting a solidly-built, well-muscled standing warrior, originally bearing a spear balanced on his left shoulder.

The work nonetheless forms an important early example of both Classical Greek contrapposto and classical realism; as such, the iconic Doryphoros proved highly influential elsewhere in ancient art.

Read this excerpt from franklin delano roosevelt's "fireside chat 19: on the war with japan": in 1940, italy attacked france and later greece — without warning. and this year, in 1941, the axis powers attacked yugoslavia and greece and they dominated the balkans — without warning. in 1941, also, hitler invaded russia — without warning. and now japan has attacked malaya and thailand — and the united states — without warning. which sentence most accurately evaluates the rhetoric of franklin delano roosevelt's speech?

Answers

The president repeats the phrase "without warning" to emphasize that these events were unexpected.

"without warning"-- this repeated statement gives the speech impact.


FDR's fireside chat repeats the phrase "without warning" to remind the citizens that the Axis powers have been ruthless. He suggests the Axis powers have created a pattern of surprise attacks demonstrating their evil methods. This creates a clear line between the sides and puts the US on a side of morality.

after the US withdrew, North Vietnam invaded South Vietnam. What year did the two become one country

Answers

North and South Vietnam became one country in the 1970's.

How was the high-tech sector affected during the recession of 2007?

Answers

the high-tech sector affected during the recession of 2007 because they were the most important sector in that year. This  was called as Great Recession which began in 2007 up to 2009. This happened when there was a burst of  8 trillion dollar housing bubble which led to sharp cutbacks in consumer spending due to loss of money.

The high-tech sector faced challenges during the recession of 2007 due to reduced consumer spending and declining investments.

The high-tech sector was significantly affected during the recession of 2007. Companies in this sector faced challenges such as reduced consumer spending, declining investments, and layoffs. Additionally, the global economic collapse during this period had adverse effects on high-tech industries worldwide.

what was one major problem caused by Europeans drawing new African borders during the Scramble for Africa?

Answers

Answer:

It divided communities families and clans by putting them into different spheres of influence.

Explanation:

In Kenya, for example two communities the Somali and the Masai were put in different jurisdiction administered by different powers.

Other Questions
Which two measures did the United States take to counter terrorism after the September 11 attacks?A)withdrew support for IsraelB)passed the Patriot ActC)banned immigrationD)increased airport securityE) denied entrance to foreigners The U-Drive Rent-A-Truck company plans to spend $15 million on 310 new vehicles. Each commercial van will cost $35 comma 000 , each small truck $70 comma 000 , and each large truck$60 comma 000 . Past experience shows that they need twice as many vans as small trucks. How many of each type of vehicle can they buy? How is augmented reality used A) to integrate 3-D graphics for providing a live, direct, or indirect view of a physical real-world environmentB) to gather and analyze digital data using special software toolsC) to provide up-to-the-minute information for decision-making processesD) to monitor employee movement during working hours Compare and Contrast topics and themes of writers from Americas and Europeans Predict where the Katydid would hide from danger? Draw a picture of what you predict, help please The Silk Road was discovered by __________. A. Marco Polo B. Genghis Khan C. General Zhang Qian D. Kublai Khan Calcium carbonate reacts with hydrobromic acid to form calcium bromide, carbon dioxide, and water according to the reaction below. what is the molarity of the hydrobromic acid if 250.0 ml of it reacts with 5.64 grams of calcium carbonate? Explain why the equation (x-4)^2-10=15 has two solutions. Then solve the equation to find the solutions. Please show all your work! (30 points) A standard number cube with the numbers 1 through 6 is rolled. Find the probability of rolling a number greater than 5 .1. 1 / 62. 1 / 33. 1 / 44. 2 / 3 If a = 0.3 with a line over 3 and b = 0.5 with a line over 5, what is the value of a + b?8/108/988/10080/99 75 points Write and solve an equation to find the measure of NEP. Make sure you show all work. A ladder leans against a building. The angle of elevation of the ladder is 70. The top of the ladder is 25 ft from the ground. To the nearest tenth of a foot, how far from the building is the base of the ladder?20.5 ft30.5 ft32.3 ft39.5 ft Three positions of praying mentioned in the Old Testament are:kneeling and sittingkneeling, standing, and falling face downstanding and sittingkneeling, sitting, and lying on one's side Andrew drove 55 mph on his trip. Which of the following equations best represents the distance he drove if x stands for the number of hours? Two people start walking at the same time in the same direction. One person walks at 8 mph and the other person walks at 2 mph. In how many hours will they be 4.5 miles apart? Rowland and molina's work showed that ultraviolet light in the stratosphere causes cfcs to release ________ atoms. Why is this cover letter inappropriate? Genetic disorders caused by multiple genes interacting with the environment are called Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? view available hint(s) where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? it would not bind the target dna. ttttagccatttacgattaatcg ttttagccatttacgattaatcg ttttagccatttacgattaatcg? Find the product.y 4 y 6