What does a contour line show?

Answers

Answer 1
Definition, making a 2d surface appear more 3d
Answer 2
Answer:

The steepness or the gentleness of the slopes is depicted by contour lines.

Explanation:

A contour line is a function of two number of variables which forms a curve connecting the points of the equal value. It is a three dimensional diagram with the function with x and y variable parallel the plane (x, y) .

In cartography, a form line joins purposes of equivalent rise (tallness) over a given level, for example, mean ocean level. A contour map is a guide represented with form lines, for instance, a topographic guide, which along these lines indicates valleys and slopes, and the steepness or tenderness of inclines.

The form interim of a shape guide is the distinction in height between progressive shape lines.


Related Questions

There is a single Scientific Method that all scientists follow.
True False

Answers

Answer:

True

Explanation:

I did some research and all of it says that all scientists follow one scientific method

Yes scientist follow a set of procedures that is Make an observation.
Ask a question.
Form a hypothesis, or testable explanation.
Make a prediction based on the hypothesis.
Test the prediction.
Iterate: use the results to make new hypotheses or predictions.
AND WHEN THE HYPOTHESES FAILS THEY FORM A NEW HYPOTHESIS AND REPEAT THE SAME STEPS JUST TECHNICALLY A NEW QUESTION AND IF THE HYPOTHESIS IS TRUE ANOTHER SCIENTIST CAN FOLLOW THE SAME METHODS AND GET THE SAME RESULTS

A scientist observes plant roots growing through the mountain side. This is evidence for which type of natural process?

Answers

Answer:The answer is erosion

Explanation:

A scientist observes plant roots growing through the mountain side. This is evidence of Weathering

Explanation:

Weathering is the breaking down of rocks, soil, minerals. Weathering happens in the same place silently not happening as a sudden slide caused by erosion. Weathering is the natural process that takes place in the mountains.

Roots of lichens are pushed between the rocks. These slowly let their roots grow through the rocks. Then they slowly produce crack in the rocks and splits it. This happens slowly and gradually that it causes withering of the rocks.

Which statements describe what will most likely occur when warm air cools and the temperature drops to the dew point? Check all that apply.

A) Clouds form.
B) Air becomes more humid.
C) Solid ice forms on leaves.
D) Cumulus clouds disappear.
E) Water droplets form on grass.

Answers

Answer:

The correct choices are A,C AND E.

Explanation:

The formation of clouds occurs when the warm air cools and the temperature drops to dew point. The dew point can be describes as the temperature which occurs when the air becomes saturated into water vapour. The air becomes cooler and when humidity of 100% is acquired, water droplets form which lead to the formation of clouds. The formation of clouds has always been  known to occur when temperature drops to the dew point.

As the warm air cools, it also results in forming tiny water droplets on the grass especially in the morning times. This most likely happens when the day has been warm followed by a cold night. The water droplets formed on the grass are known as dew.

Final answer:

When air cools to the dew point, the moisture it holds condenses forming clouds and dew on grass surfaces. The air's humidity does not increase, rather, the relative humidity does. The process does not result in freezing nor make clouds disappear.

Explanation:

When warm air cools and the temperature drops to the dew point, certain phenomena occurs. The dew point is the temperature at which the air cannot hold all the moisture in it and some of it condenses as water vapor, leading to the formation of small droplets. The statements A 'Clouds form' and E 'Water droplets form on grass' best describe what will most likely happen, since clouds are formed due to condensation of water vapor in the air, and dew forms on grass for the same reason. Statement B 'Air becomes more humid' could be misleading; while it's true that the relative humidity increases (since it is defined as the ratio of the actual amount of water vapor in the air to the maximum amount of water vapor the air could hold at that temperature), the actual amount of water vapor does not increase. Statements C 'Solid ice forms on leaves' and D 'Cumulus clouds disappear' are not accurate as cooling to the dew point results in condensation, not freezing, and this process tends to create, not dissipate clouds.

Learn more about Dew Point here:

https://brainly.com/question/33345309

#SPJ6

In 1990, scientists at the National Institutes of Health used gene therapy to try to treat a 4-year-old girl suffering from severe combined immunodeficiency disease (SCID). This genetic disease made her extremely susceptible to infections. The scientists used a virus to inject normal genes into the girl's immune system cells. The experiment was moderately successful, and the girl's health improved but only for short periods of time. If this form of gene therapy could be fine-tuned, how would it impact society? A. People would need to be genetically tested before having children together. B. Many genetic diseases would be curable. C. The number of infections from genetically-engineered viruses would increase. D. Most Americans would no longer suffer from heart disease.

Answers

Answer:

B. Many genetic diseases would be curable.

Explanation:

Gene therapy is intended to acquaint hereditary material into cells in order to compensate for faulty or mutated genes or to make a helpful protein. On the off chance that a faulty gene makes a beneficial protein be flawed or missing, gene therapy might have the option to present a typical duplicate of the gene to reestablish the function of the protein.  

A gene that is embedded straightforwardly into a cell as a rule doesn't work. Rather, a bearer or carrier called as a vector is hereditary built to insert the desired gene.

Answer: Many genetic diseases would be curable.

Explanation: The successful use of gene therapy would allow doctors to cure, rather than simply treat, genetic diseases.

Proof that I am right look at the Image And rate 5

which of these groups is the smallest level of classification

A. Phylum

B. Family

C. Order

D. Genus

Answers

Answer: Number D. Genus

Explanation:

Answer:

D. Genus

Explanation:

This is the smallest classification level because of all those named it is the one that covers the least organisms. This taxonomic level is between the level of species and family, that is, it covers only several related species. In order from largest to smallest the levels of organization are domain, kingdom, phylum, class, order, family, gender and species

Which of the following is NOT a major concept involved in the study of Earth Science?
a Earth's History
C Earth in the Solar System
b. The Structure of the Earth System
d. All are major concepts
Please select the best answer from the choices provided

Answers

Answer:

D

Explanation:

All are major concepts.

-Jarvis

The two most populous countries in the world are

Answers

Answer: China and India

Explanation: China's population is 1,389,618,778 and India's is 1,311,559,204.

If a gene has only one allele, how many different traits can the allele produce?

Answers

Answer:

If you have 2 dominant alleles, the gene will be dominant, if you have 2 recessive alleles, the gene will be recessive. But if you have 1 recessive and 1 dominant, the Dominant allele will mask the recessive one.

Explanation:

Final answer:

If a gene has only one allele, it can produce one specific trait in an individual organism. However, within a population, multiple alleles for the same gene can exist, allowing for a range of traits to be expressed among the individuals in that population. The ABO blood type system in humans is an example of multiple alleles influencing various traits.

Explanation:

If a gene has only one allele, it can typically produce only one trait in an individual organism. This is because an allele is a specific version of a gene, and without an alternative allele to combine with, there is no variation at that gene locus in the individual's genotype. However, at a population level, multiple alleles may exist for the same gene, giving rise to various combinations of two alleles and hence multiple traits within the population.

An example of this phenomenon is the ABO blood type system in humans, where there are three alleles (IA, IB, and i) that can combine in different ways. These combinations result in the A, B, AB, or O blood types, showcasing how multiple alleles contribute to genetic diversity.

Still, it's important to note that while an individual organism with a single allele for a gene can typically only express one trait, the presence of multiple alleles at the population level allows for the range of observable traits (phenotypes) to expand beyond that single manifestation.

A girl carried a box of books up two flights of stairs to her attic. Her father carried a box the same weight up a ladder directly to the attic. The girl says she did more work on the box than her father because she walked further up the stairs, is she correct?

Answers

Answer:

The girl is correct because her father only went the distance of the ladder, whereas she went to the extension of two flights of stairs.

Explanation:

Final answer:

The work done by the girl and her father is the same. The discrepancy arises from the difference in perceived effort, not actual work done. In physics, work done against gravity for the same weight over the same vertical distance is equal, regardless of the path taken.

Explanation:

The question asked pertains to the concept of work in physics. According to the definition of work in physics, work is equal to the force applied to an object times the distance the object is moved in the direction of the force. The force in this scenario is the same, as the same weight box is being lifted. The distance is also the same (the vertical distance from the ground to the attic). Therefore, regardless of the path taken (flight of stairs or directly using a ladder), the work done is the same.

It might seem that more effort is required to carry the box up the stairs due to the longer path, however, this is likely due to the additional force required to fight against gravity while taking the longer route, but this doesn't constitute to additional work done in terms of physics. Work Done Against Gravity is the significant concept here. The energy changed from one form to another to overcome gravity remains the same in both cases

Learn more about Work and Energy here:

https://brainly.com/question/17290830

#SPJ2

Review the following DNA sequences .
Original DNA Sequence: ATTGCTAAGTCA
Mutated DNA Sequence: ATTGATAAGTCA
Which type of mutation occurred ?
A) insertion
B) there is no mutation
C) substitution
D) deletion

Answers

Answer:

C) Substitution

Explanation:

C has been substituded by A from the DNA sequence so it is Substitution mutation.

Substitution mutation is shown in the ATTGATAAGTCA,  DNA sequence.

The correct option is C.

What is mutation?

Mutation is the changing in DNA or chromosome which cause genetic change in an organism.

Mutation sometimes leads to death.

In the given sequence

Original DNA Sequence: ATTGCTAAGTCA

Mutated DNA Sequence: ATTGATAAGTCA

The C is substituted or replaced by A

Thus, it is a substitution mutation. The correct option is C, substitution.

Learn more about mutation, here:

https://brainly.com/question/17106056

Which is associated with divergent boundaries?
a)ocean mountain chains
b)volcanic island ares
c)folded mountains
d)horsts and grabens

Answers

Volcanic island areas is associated with divergent boundaries

Answer: B. Volcanic island areas

Explanation:

Divergent boundaries in the middle of the ocean leads to the spreading of the seafloor. As the plates of the ocean separate and move apart, they produce breaks in the sea depths. Magma ascends from the mantle and overflows out from the breaks like a long, flimsy volcano.

This magma cools and ultimately forms igneous rock. Most dynamic plate boundaries happen between plates of the ocean and exist as mid-oceanic edges. Divergent boundaries likewise structure volcanic islands.

Answer:

B. Volcanic island areas

where does cell produce atp​

Answers

Enzym
It is very correct


Which of the following is an inference instead of an observation? Please answer correctly and show how it's correct maybe

A. The squirrel is gathering acorns in his cheeks

B. The boat is sailing on the lake in circles

C. The sun is hot today as it shines down on us at the park

D. Deer walked down the path earlier because of the prints in the mud

Answers

Answer:

D

Explanation:

A, B, and C, are all observing the situations, while D states the deer walked down the path earlier because of the tracks, this is hardly obersavable, and you would have to infere the deer took the path early.

Final answer:

'Deer walked down the path earlier because of the prints in the mud' is an inference, not an observation, as it is a conclusion made based on the observed deer prints. The correct option is D.

Explanation:

The answer to the question which statement is an inference rather than an observation is option D: 'Deer walked down the path earlier because of the prints in the mud.'

An observation refers to something that one directly sees, hears, or experiences, while an inference is a conclusion or assumption drawn from those observations. Options A, B and C are observations as they directly describe actions that are immediate and visible.

Option D, on the other hand, makes a prediction or inference about past events (deer walking) based on current observations (prints in the mud).

Learn more about Inference here:

https://brainly.com/question/33136743

#SPJ2

Silver has two naturally occurring isotopes. Ag-107 has an abundance of 51.82% and a mass of 106.9 amu. Ag-109 has a relative abundance of 48.18% and a mass of 108.9 amu. Calculate the atomic mass of Silver.​

Answers

Answer:

The atomic mass of silver is 107.86 amu

Explanation:

The atomic mass is calculated by formula

Atomic mass = (Mass of first isotope x Abundance of first isotope) + (Mass of Second isotope x Abundance of second isotope)

In case of silver, the formula will be as

Atomic mass = (Mass of Ag-107 x Abundance Ag-107) + (Mass of Ag-109 x Abundance Ag-109)

Mass of Ag- 107 = 106.9

Mass of Ag- 109 = 108.9

Abundance of Ag-107 = 51.82/100 = 0.5182

Abundance of Ag-109 = 48.18/100 = 0.4818

Putting these values in the formula

Atomic mass of silver = (106.9 x 0.5812) + (108.9 x 0.4818) = 107.86 amu

Final answer:

To calculate the average atomic mass of silver, the masses of its isotopes are multiplied by their relative abundances and summed up, resulting in an atomic mass of 107.841428 amu.

Explanation:

The average atomic mass of an element can be calculated by taking the weighted average of the masses of its naturally occurring isotopes, based on their relative abundances. For silver, we have two isotopes: Ag-107 with a mass of 106.9 amu and an abundance of 51.82%, and Ag-109 with a mass of 108.9 amu and an abundance of 48.18%. To find the atomic mass of silver, we perform the following calculation:


Atomic mass = (Percentage abundance of Ag-107 × Mass of Ag-107) + (Percentage abundance of Ag-109 × Mass of Ag-109)

Atomic mass = (0.5182 × 106.9 amu) + (0.4818 × 108.9 amu)

Atomic mass = 55.359866 amu + 52.481562 amu


Atomic mass = 107.841428 amu

Therefore, the average atomic mass of silver is 107.841428 amu.

because of biochemical cycling
A human activity has no effect on elements, chemical chemical compounds, and and no other form of living matter
B, living living organisms are not limited by any one nutrient
C nutrients are circulated throughout the biosphere
D, many nutrients do not reach toxic contractions in the biosphere
whoever is correct I will name brainliest​

Answers

Nutrients are circulated throughout the biosphere because of biochemical cycling.

Answer: Option C

Explanation:

Apart from vitality, water and a few other chemical components spin through biological systems and impact the rates at which life forms develop and duplicate. Around 10 noteworthy supplements and six minor nutrients are basic to all creatures and plants, while others assume significant jobs for chosen species.

The most significant biochemical cycles influencing environment well being of the water, carbon, nitrogen, and phosphorus cycles. Thus it is due to biochemical cycling, nutrients are circulated through out the biosphere.

What characteristics do all living things share

Answers

I had biology last year and these are the 8 things that make something a living thing


Here is the list of characteristics shared by living things:
Cellular organization.
Reproduction.
Metabolism.
Homeostasis.
Heredity.
Response to stimuli.
Growth and development.
Adaptation through evolution.

What percentage of precipitation falls back onto land? a. 78% b. 92% c. 17% d. 22%

Answers

22%  percentage of precipitation falls back onto land.

Answer: D. 22%

Explanation:

Water cycle is the phenomenon in which both evaporation and condensation or precipitation of water takes place. Water evaporates from the lakes, ponds, oceans and other water bodies to the atmosphere because of the heat.

The evaporated water or water vapour then form clouds which gets precipitated or condensed and falls back to the land in the form of rain, snow, hail storm, sleet etc.

However, all the forms that fall into the land have one thing in common i.e., all of them come from clouds as the clouds get heavy by the evaporated water.

Final answer:

About 22% of all precipitation falls back onto land, as part of the water cycle where the majority of precipitation (approximately 78%) falls onto the oceans.

Explanation:

To understand the question, let's discuss briefly about the water cycle.

The water cycle describes how water from the land and oceans enters the atmosphere by evaporation or sublimation, where it condenses into clouds and falls as rain or snow in a process called precipitation. This precipitated water may enter freshwater bodies or infiltrate the soil. Eventually, this surface or groundwater reenters the ocean, completing the cycle.

Although the specifics can vary based on the climate, local topography, and other factors, approximately 22% of all precipitation ends up falling back onto land (option d). This happens because the rest of the precipitated water (around 78%) falls onto the oceans themselves.

Learn more about Precipitation here:

https://brainly.com/question/18109776

#SPJ6

which of Thomas hunt Morgan‘s hypothesis was valid
white eyes are lethal in female Drosophila
white eyes are lethal in male Drosophila
white eyes are homozygous recessive in femal Drosophila
white eyes are the dominate trait in female Drosophila

Answers

Answer:

Option C, white eyes are homozygous recessive in femal Drosophila

Explanation:

Morgan's in his initial study crossed a white-eyed male fly with red-eyed females to see of the next generation has white eye. To his surprise, all the offspring in the next generation have red eye but somewhere he believed that might be these red eyed species have recessive white allele.  So he crossed the F1 generation species among themselves and found that in F2 generation 3 red eyed and 1 white eyed species is produced. The results were matching with the results obtained by Mendel’s pea plant experiment. But in case of Morgan, only males has white eye so to his surprise he first time observed a co-relation between a non sexual trait and gender of an individual . Later he crossed a white eyed male to a heterozygous red eyed female and found that the next generation has white eyed female

From this he concluded the following –  

a) The allele for white eye is not lethal neither in male nor in female and all sort of combinations are possible.

Answer:

C

Explanation:

Increase in the worlds population will require a. Increase in sustainable practices. True or false

Answers

Increases in the world's population will require an increase in sustainable practices: True

Answer:

True

Explanation:

Edge 2021

based on the model of cellular transport, the hydrolysis of ATP and ADP provide a mechanism for

Answers

Answer:

B

Explanation:

They move against the gradient : this is coming directly from USAtestprep

Based on the model of cellular transport, the hydrolysis of ATP and ADP provides a mechanism for moving against the gradient.

What is active transport?

Active transport is a type of cellular transport that involves the use of ATP to move substances across membranes.

Active transport can move substances and ions against a concentration gradient.

Conversely, passive transport moves substances in favor of a concentration gradient.

In conclusion, based on the model of cellular transport, the hydrolysis of ATP and ADP provides a mechanism for moving against the gradient.

Learn more in:

https://brainly.com/question/25802833

One function of the hematic system is to _____.

cause voluntary and involuntary motion
protect the body
transport substances in the body
distribute blood through the body

Answers

distribute blood through the body

The hematic system, or circulatory system, is crucial in transporting substances and distributing blood to all parts of the body. It enables nutrient and oxygen delivery, waste removal, defense mechanism operation, and helps in maintaining the body temperature and acid-base balance. The system also influences both voluntary and involuntary motions.

The function of the hematic system, also known as the circulatory system, primarily involves transporting substances in the body and distributing blood throughout the body. It reaches almost every cell, tissue, organ, and system in the body. The circulatory system is responsible for the transportation of materials, such as nutrients and oxygen, to different parts of the body, allowing our cells to function properly. Furthermore, it plays a critical role in our body's defense mechanism, distributing white blood cells and immune system antibodies to maintain our health. It also contributes to controlling body temperature and maintaining the acid-base balance.

Moreover, the circulatory system works closely with other body systems. For instance, it moves in conjunction with our body muscles, enabling us to perform both voluntary and involuntary motions. It also provides the physical site for the exchange of gases, nutrients, and other substances with body cells, ensuring effective metabolism and cellular processes.

Learn more about Hematic System here:

https://brainly.com/question/32155332

#SPJ6

When Stephanie’s light bulb did not turn on after she wired a circuit board, she asked her brother to use the same procedure to see if he got the same results.
Which important step of scientific design is being modeled?

a. reevaluating

b. repetition

c. replication

d. revising

Answers

Answer:

Revising (D)

Explanation:

Answer:

d

Explanation:

i just got it right on the test

Identify the organelle where photosynthesis takes place. Image of a plant cellshown with letters A to H showing various organelles. A points to the mitochondria. B points to the Golgi apparatus. C points to the nucleus. D points to endoplasmic reticulum. E points to the chloroplast. F points to the cell wall. G points to the cell membrane. H points to the vacuole. B C D E

Answers

Answer:

E

Explanation:

A chloroplast is the organelles in which photosynthesis takes in plants. The chloroplast has thylakoid lamellae that occasionally arrange itself into stacks called grana where there are photosystem units that have chlorophyll pigment. The chlorophyll pigments tap energy from the photons of sunlight and use it for photophosphorylation.

Chloroplast  is the organelle where photosynthesis takes place.

The correct option is E .

The chloroplast is the organelle where photosynthesis takes place in plant cells. It contains chlorophyll, a green pigment that captures sunlight and converts it into chemical energy through the process of photosynthesis. During photosynthesis, the chloroplasts use light energy, carbon dioxide, and water to produce glucose (a type of sugar) and oxygen. This process is crucial for plants as it provides them with the energy they need to grow and carry out various cellular functions.

Chloroplasts are specialized organelles found in plant cells and some other eukaryotic organisms, such as algae. They are the key sites for photosynthesis, a vital process that converts light energy from the sun into chemical energy in the form of glucose.

Hence , E is the correct option

To learn more about Chloroplast , here

brainly.com/question/11136550

#SPJ6

Which of the following best describes a nuclear fusion reaction?
a reaction that forms chemical bonds
a reaction that breaks chemical bonds
a reaction that joins the nuclei of two atorns into one
a reaction that splits the nucleus of an atom into two
LATINU
ISK OP UP

Answers

Answer:

A reaction that joins the nuclei of two atoms into one  

Explanation:

Think of the words "nuclear fusion".

Nuclear = "relating to a nucleus"

Fusion = "joining"

So, nuclear fusion is the joining of two nuclei into one.

A and B are wrong, because chemical reactions involve electrons.

D is wrong, because the splitting of a nucleus is fission.

Final answer:

Nuclear fusion is the combination of light atomic nuclei to form a heavier nucleus, releasing energy, and it is the fundamental process that fuels stars.

Explanation:

Nuclear fusion is best described by option : a reaction that joins the nuclei of two atoms into one. This process involves two or more light atomic nuclei colliding at high speed and combining to form a heavier nucleus. Nuclear fusion releases energy when these light nuclei fuse to form medium-mass nuclei; this is the same process that powers stars like our Sun. The simplest example of this is the fusion of hydrogen isotopes to form helium in the proton-proton cycle, which happens at the extreme temperatures and pressures found in the core of stars.

i’m supposed to draw something for advantage but have no idea what to draw it’s due 9/12 anyone has an ideaa

Answers

Answer:

Explanation:

Draw stick figures then have one standing higher than the rest to show they have an advantage while the others don’t

Answer:

For number eight draw a person that's wealthy and a person blow them that's poor. It's a real life example of someone that is at a disadvantage

define hydraphilic. which portion of the bilayer is hydrophilic?​

Answers

Answer:

hydrophilic is when something has the tendency to mix with water or be wetted by it.

lipids and phospholipids are hydrophilic

5. How do
eagles depend on sunlight for their
energy?

Answers

Because An eagle's average daily food consumption is from 250-550 grams per day, or between 5-10% of an eagle's body weight. Bald Eagles, like other animals, get all their energy from the sun. ... Sunlight is the source of energy for plants. Using the sun's energy, green plants produce food through photosynthesis.
The plants make energy from the sun. Smaller animals eat the plant, and absorb the energy. When the Eagle eats the smaller animal, it’s consuming the energy the small animal got from the plant

Cell Parts and Functions
Select the correct cell parts listed below to fill the blanks of the sentences or spaces that follow
cell membrane
cell wall
mitochondria
nuclear envelope
cytoplasm
nucleolus
vacuole
centriole
Golgi apparatus
lysosomes
ribosomes
chloroplast
smooth ER
nucleus
1. The
is the place where genes (DNA instructions for traits) are stored._____
2. The rough endoplasmic reticulum is studded with ribosomes and functions in the production of protein,
whereas the
functions in the synthesis of lipids and detoxification of harmful
substances._____
3. Structures normally found in animal cells that are involved in animal cell reproduction (aka, cell division)._____
4. Involved in making ribosomes in the cell, this structure is located in the nucleus._____
5. The structure is the outer covering of a cell and is involved in regulating the movement of materials (food,
gases, elements) in and out of the cell._____
6. Cellular respiration occurs in this organelle. Cellular respiration produces ATP for cell activities.
Therefore, the
is sometimes called the powerhouse of the cell."_____
7. The double membrane surrounding the nucleus that controls what enters and leaves it through nuclear
pores) is called the nuclear membrane or_____
8. Vesicles that contain digestive enzymes are_____
9. Outside the cell membrane of a plant cell is the
that also serves as
support and protection for the cell._____
10. Enzymes are proteins, and proteins are produced in this organelle_____
11. Sacs storing water, wastes and food are storage chambers in the cell called_____
12. Structure found in plants, but not animal cells, that carries out photosynthesis is the_____
13. The
is everything outside the nuclear membrane but inside the cell membrane
including the cytosol and structures within the cytosol._____
14. The structure of the cell that prepares and packages proteins for use within the cell for shipment outside
the cell._____

Answers

Answer:1 = nucleus,2= smooth endoplasmic reticulum,3=centrioles,4=nucleolus,5= cell membrane,6=mitochondria,7= nuclear envelope,8= lysosomes,9= cell wall,10= ribosomes,11= vacuole,12= chloroplast,13= cytoplasm and 14= Golgi apparatus

Explanation:


True testing means that a serious effort is made to falsify ("disprove") each possible
explanation.

True or false?

Answers

the answer is ( true )
Answer:

The statement given about the true testing mechanism is false.

Explanation:

Testing is the way toward assessing a framework or its component(s) with the plan to discover whether it fulfills the predefined necessities or not. It is a process of executing a framework so as to distinguish any holes, blunders, or missing prerequisites in as opposed to the real necessities.  

The concept of true testing is not to falsify all possible explanation. It means to come up with a solution which is true in all aspects.

The sun's energy is classified by the ____

A. temperature of the wavelength
B. range of its wavelengths
C. amount of visible light emitted
D. amount of radiation given off

Answers

I Think The Answer Is D

Final answer:

The sun's energy is classified by the 'range of its wavelengths', which make up the electromagnetic spectrum, including visible light.

Explanation:

The sun's energy is emitted in the form of electromagnetic radiation, which includes a range of different wavelengths. These wavelengths each have their own characteristic energy, and together they make up the electromagnetic spectrum. The correct answer to the question is B. range of its wavelengths, as the sun emits electromagnetic radiation at different wavelengths, from very short gamma rays to very long radio waves. Visible light, a part of this spectrum, ranges from violet at 380 nm to red at 750 nm.

Other Questions
In this problem, we explore the effect on the mean, median, and mode of adding the same number to each data value. Consider the data set 2, 2, 3, 6, 10. (a) Compute the mode, median, and mean. (b) Add 5 to each of the data values. Compute the mode, median, and mean. (c) Compare the results of parts (a) and (b). In general, how do you think the mode, median, and mean are affected when the same constant is added to each data value in a set? Paraphrase this text from the Ellis Island site. "Ellis Island doctors were particularly watching for signs of contagious diseases. Incurable diseases included trachoma and tuberculosis and guaranteed a return trip to where the immigrant came from." What prompted the formation of the Tertium Quids in 1808? a. Jefferson's desire to buy West Florida. b. Jefferson's opposition to the Embargo Act. c. Napoleon's attack on American shipping. d. The Federalists clamoring for war with England. to create a formula in______, you would first click in one of the cells Dr. Han is studying which brain structure is associated with aggressive behavior among rats. Which part of the brain is she likely to see activated when using neuroimaging techniques? Please i need big helpChoose the adjective clause in the following sentence: The jeans that I want to buy are very expensive.to buyare very expensivethe jeans thatthat I want to buyI want True or false tasks are required activities that need to take place in order to complete a goal Two train whistles have identical frequencies of 175 Hz. When one train is at rest in the station and the other is moving nearby, a commuter standing on the station platform hears beats with a frequency of 4.05 beats/s when the whistles operate together. What are the two possible speeds and directions the moving train can have? slower speed m/s Correct: Your answer is correct. faster speed m/s Changed: Your submitted answer was incorrect. Your current answer has not been submitted. The processivity of a DNA polymerase depends on all of the following actions, EXCEPT for __________. A. association of the DNA polymerase with a sliding clamp (like eukaryotic PCNA) B. interaction between the thumb domain of DNA polymerase and the DNA C. interaction between the minor groove of DNA and the palm domain of the DNA polymerase D. loss of the hydrogen from the 3-OH of the primer due to interaction with a divalent metal ion associated with the palm domain of the DNA polymerase the romans introduced and estabished a common system of written laws why was that important The economy of early villages and cities was based mainly on What is the solution to 4x+5y=12x6y=22 Edouard Daladier became Prime Minister of which country in 1933? A __________ is a wide-mouthed body of water close to shore. Cusic Industries had the following operating results for 2019: sales = $34,621; cost of goods sold = $24,359; depreciation expense = $6,027; interest expense = $2,725; dividends paid = $2,023. At the beginning of the year, net fixed assets were $19,970, current assets were $7,075, and current liabilities were $4,010. At the end of the year, net fixed assets were $24,529, current assets were $8,702, and current liabilities were $4,700. The tax rate was 25 percent. a. What is net income for 2019? (Do not round intermediate calculations.) b. What is the operating cash flow for 2019? (Do not round intermediate calculations.) c. What is the cash flow from assets for 2019? (A negative answer should be indicated by a minus sign. Do not round intermediate calculations.) d-1. If no new debt was issued during the year, what is the cash flow to creditors? (Do not round intermediate calculations.) d-2. If no new debt was issued during the year, what is the cash flow to stockholders? (A negative answer should be indicated by a minus sign. Do not round intermediate calculations.) Evaluate M2/P2 for M = 10, N = -5, and P = -2? A.-5 B.5 C.-25 D.25 Read the sentences. Sentence 1: I hope the dinner comes out perfectly, but even if it doesnt, Im pretty sure theyll know how hard I tried. Sentence 2: Then well have coffee cake for dessert, which I made from scratch. Sentence 3: I am making my sisters favorite: roasted chicken, brown rice, and brussels sprouts. Sentence 4: I cannot wait to cook dinner for my family tonight. What is the most logical sequence for these sentences in a story? 1, 3, 2, 4 4, 1, 3, 2 4, 3, 2, 1 3, 2, 1, 4 An RNA virus that infects plant cells is copied into a DNA molecule after it enters the plant cell. What would be the sequence of bases in the first strand of DNA made complementary to the section of viral RNA shown here? 5' CCCUUGGAACUACAAAGCCGAGAUUAA 3' Reasoning if you multiply two decimals that are less than 1,can you predict whether the product will be less thanor greater than either of the factors? Explain What is the greatest common factor of 19 and 18?