What is the image of (0, 1) after a reflection over the line y = x?

Answers

Answer 1

Answer:

(1,0) would be the correct answer.

Step-by-step explanation:

any point that is reflected across y=x will change unless it is on the line. if reflected across y=x, the coordinates will become y,x


Related Questions

Solve the equation c2 = 4.​

Answers

Answer:

C = 2

Step-by-step explanation:

[tex]2*2=4[/tex]

The required solution for the given equation c² = 4 is  c = 2.​​

What is an equation?

In mathematics, an equation is a formula that expresses the equality of two expressions by connecting them with the equal sign = .

Now the given equation is,

c² = 4

Since factor 4 = 2 x 2

Therefore, 4 = 2 x 2 = 2²

So the given equation becomes,

c² = 2²

Taking square root both the side we get,

√c² = √2²

Therefore,

c = 2

which is the required solution of the given equation.

Thus, The required solution for the given equation c² = 4 is  c = 2.​​

To learn more about equations:

brainly.com/question/2273153

#SPJ2

I need help solving this equation does anybody know what x is? 5+x+(-2)=-8

Answers

Answer: x=5

Step-by-step explanation:

5+x+(−2)=−8

Simplify

5 + x - 2 = -8

x + 3 = -8

Subtract 3 to both sides

x + 3 - 3 = -8 +3

Simplify

x = -5

Answer:

x=-11

Step-by-step explanation:

5+x+(-2)=-8

x+(-2)=-13

x=-11

What is the slope of the line represented by the equation y = -x-3?

Answers

Answer:

(C) 1/3

Step-by-step explanation:

The slope intercept form: y = mx + b.

Note:

m = slope

b = y-intercept

x & y = (x , y) for the points.

You are trying to get the y-intercept of the following function given:

f(x) or y = (-2/9)x + (1/3)

1/3 is your answer, or (C), for 1/3 replaces the b inside the equation.

If you really need the slope, the slope of the following equation is (-2/9), which replaces the m inside the equation.

~

What is the slope of the line passing through the points (−1, 7) and (4, −1)?



−56
−2
−85
2

Answers

Hey!

------------------------------------------------

Formula: [tex]m = \frac{y2 - y1}{x2 - x1}[/tex]

------------------------------------------------

Steps To Solve:

~Substitute

[tex]m = \frac{-1 - 7}{4 - (-1)}[/tex]

~Simplify

[tex]m = \frac{-8}{5}[/tex]

------------------------------------------------

Answer:

[tex]\large\boxed{C)~\frac{-8}{5} }[/tex]

------------------------------------------------

Hope This Helped! Good Luck!

-2 Is the answer to the question

The PSU charges $2 for a package weighing up to 3 lbs, plus an additional fee of $0.15 per lb over 3lbs . what is the most a package can weigh that you plan to mail if you have 3 dollars ? (the nearest whole lb)

Answers

The correct answer is 9lbs!

You will start by subtracting the initial $2 which leaves you with $1 left. after that you count how many times $0.15 goes into your $1 left. That answer should be 6 time which is $0.90. Now you add the 6 to the original 3 to get 9lbs!

300 students were surveyed. 240 completed the survey. What is the percentage of students surveyed

Answers

240 divided by 300 would be 0.8 multiply by 100 giving you 80. 80 percent.

Final answer:

To calculate the percentage of students who completed the survey, divide the number who completed it (240) by the total number surveyed (300) and then multiply by 100, yielding 80%.

Explanation:

To find the percentage of students who completed the survey, we use the formula for calculating a percentage: (Number of Students Who Completed the Survey ÷ Total Number of Students Surveyed) × 100. In this case, it's (240 ÷ 300) × 100, which equals 80%. Therefore, 80% of the students surveyed completed the survey. This is a common type of problem in statistics that involves dealing with portions and percentages of a whole.

. In this case, 240 students completed the survey out of 300 students surveyed. So, the percentage of students surveyed is:

Percentage = (240 / 300) * 100 = 80%

Which real number property is illustrated here? *
1 point
3* – 5 = – 5 * 3
o
Associative Property of Multiplication
O
Identity Property of Multiplication
Commutative Property of Multiplication
O
Commutative Property of Addition

Answers

Answer:

Commutative property of multiplication



HELP will mark brainilest
The original price of a sound system is $1250. For one day only, the store is offering a frequent shopper discount of 35% on all merchandise. Which expressions can be used to find the discounted price of the sound system? Check all that apply.

0.35($1250)
$1250 + 0.35($1250)
0.65($1250)
$1250 – 0.35($1250)

Answers

Answer:

The answer to your question is $1250 - 0.35($1250)

Step-by-step explanation:

If PR = 4x – 2 and RS = 3x – 5, which expression represents PS?


Answers

Final answer:

To find the expression representing segment PS, we add the expressions for segments PR (4x - 2) and RS (3x - 5) to get PS as 7x - 7.

Explanation:

The question asks us to determine the expression that represents the segment PS given the expressions for segments PR and RS. PR is given as 4x - 2 and RS is given as 3x - 5. To find the length of PS, we add PR and RS because PS is the sum of PR and RS when they form a continuous line segment. Therefore, PS is (4x - 2) + (3x - 5). Simplifying this expression, we get PS as 7x - 7.

Find the vertex of the function given below.
y = 3x2 + 6x +1

Answers

Answer: The coordinates of the vertex are : (-1,-2)

Step-by-step explanation: To find the x coordinate, we use the formula:

Xv = -b/2a = -6/(2.3) = -6/6 = -1

Replacing x by -1, we write:

y = 3. (-1)^2 + 6. (-1) +1 = 3 - 6 + 1 = -2

The vertex of the function will be (-1, -2)

What is Function?

A relation between a set of inputs having one output each is called a function.

Given that;

The function is,

⇒ y = 3x² + 6x + 1

Now,

Since, The function is,

⇒ y = 3x² + 6x + 1

By comparing with the standard form of a quadratic equation ax²+bx+ c , we get;

⇒  a = 3, b = 6 c = 1

Since, The x- coordinate of the vertex is,

⇒ x = - b/2a

Substitute all the values, we get;

⇒ x = - 6/2×3

⇒ x = - 6/6

⇒ x = - 1

And, Put x =- 1 in the function, we get;

⇒ y = 3x² + 6x + 1

⇒ y = 3(-1)² + 6(-1) + 1

⇒ y = 3 - 6 + 1

⇒ y = - 2

Thus, The value of vertex = (- 1, - 2)

Learn more about the function visit:

https://brainly.com/question/17043948

#SPJ2

Two stores sell the same computer for the same original price. Store A advertises that the computer is on sale for 25% off the original price. Store B advertises that it is reducing the computer’s price by $180. When Brittany compares the sale prices of the computer in both stores, she concludes that the sale prices are equal. What is the computer’s original price? Write and solve an equation.

Answers

Let the price of the computer = X

Store A is selling it for 25% off, so they are selling it for 75% of the original price, so you have 0.75X

Store B is selling it for 180 less the original price, so you have X - 180

Now set both equations to equal and solve for x:

0.75x = X-180

Subtract 1X from each side:

-0.25x = -180

Divide both sides by -0.25:

x = -180 / -0.25

X = 720

The original price is $720

check:

720 x 0.25 = 180

The original price of the computer is $720, calculated by setting the 25% sale price equal to the flat $180 discount and solving the resulting equation.

Brittany wishes to determine the original price of a computer based on the sale prices from two different stores. Store A offers a 25% discount while Store B offers a flat $180 discount. To find the original price when the sale prices are equal, we set up an equation.

Let the original price be represented by x. The sale price at Store A is therefore x - 0.25x or 0.75x. At Store B, the sale price is x - $180.

To find the original price when the sale prices are equal, we set the equations equal to one another:
0.75x = x - $180

We solve the equation by subtracting x from both sides:
0.75x - x = -$180
-0.25x = -$180

Then we divide both sides by -0.25 to solve for x:
x = -$180 / -0.25
x = $720

Therefore, the original price of the computer is $720.

Please answer this asap for 15 pt

Answers

Answer:

Step-by-step explanation:

what is question that you whant my to answer

What is the image point of (9,8) after a translation right 4 units and up 2 units?​

Answers

Answer:

(13,10)

Step-by-step explanation:

On the graph, all the points going right starting from 0, would be positive, and all points going up starting from 0 would be positive.

You should also know that going right would mean the x (which is 9 here) would get bigger; and the y (which is 4) going up would get bigger too.

So if you move (9,8) right 4 times 9 + 4 = 13, so now you have (13,8).

Then, you move (13,8) up 2 units, so 8+2 more units = 10, so then your final answer would be (13,10).

Hope this helped, sorry if its confusing I wasn't born to teach lol

The image point of (9, 8) is (13, 10), after the translation.

What is the required image point ?

In graphs, we know that the horizontal line is the x-axis, more we go right in that line, more positive values of x we get & in similar manner, more we go left, we get more negative values of x.

So, if we translate (9, 8), 4 units in the right, then we get larger value of x, i.e. 9+4=13 and the point becomes (13,8)

Also, the vertical line on a graph defined the y-axis, more we go up in that line, more we get positive values of y and more we go down that line, more we get negative values of y.

So, if we up the value of y 2 units, then the co-ordinate of y is 8+2 = 10

And the point becomes (13,10)

So, the required image point is (13,10)

Learn more about image point here :

https://brainly.com/question/2418777

#SPJ2

complement of angle Y. Y=(8x-20°)​

Answers

Answer:

Step-by-step explanation:

Complement = 90 - Angle

Complement = 90 - y

Complement = 90 - (8x - 20)

Complement = 90 - 8x + 20

Complement = -8x + 110

Final answer:

The complement of an angle Y denoted as (8x-20°), is found by subtracting the angle from 90°. After distribution and addition, the final formula for the complement of angle Y is 110° - 8x.

Explanation:

The complement of an angle is defined as the difference between 90 degrees and the angle. In this case, we need to find the complement of angle Y, represented as (8x-20°).

To find the complement, we subtract the angle from 90°. So, the complement of angle Y is given by the formula 90° - (8x - 20°).

When you distribute the negative sign into the parentheses, the formula becomes 90° - 8x + 20°. Adding 90° and 20° gives us 110°, making the final formula for the complement of angle Y as 110° - 8x.

Learn more about the Complement of an angle here:

https://brainly.com/question/29775107

#SPJ2

If A= (-1,-3) and B = (11,-8), what is the length of Ad?

Answers

Answer:

AB = 13

Step-by-step explanation:

The formula of a distance between two points

[tex]A(x_1,\ y_1),\ B(x_2,\ y_2)\\\\d=\sqrt{(x_2-x_1)^2+(y_2-y_1)^2}[/tex]

We have the points A(-1, -3) and B(11, -8).

Substitute:

[tex]AB=\sqrt{(-8-(-3))^2+(11-(-1))^2}=\sqrt{(-8+3)^2+(11+1)^2}\\\\=\sqrt{(-5)^2+12^2}=\sqrt{25+144}=\sqrt{169}=13\\\\\sqrt{169}=13\ \text{because}\ 13^2=169[/tex]

what is the answer to 1/8÷1/4​

Answers

1/8÷1/4​

Flip over the second fraction

1/4=4/1

1/8 *4/1

Cross out 8 and 4 ,divide by 4

8/4=2

4/4=1

1/2 *1/1=1/2

Answer: 1/2

Answer:

1/2

Step-by-step explanation:

1/8 divided by 1/4 becomes

1/8 multiplied by 4/1

(When we divide fractions the second fraction flips and we multiply instead of division)

So the answer is 1/2

Which of the following expressions are equivalent to (6.2+6.2)+9.4(6.2+6.2)+9.4left parenthesis, 6, point, 2, plus, 6, point, 2, right parenthesis, plus, 9, point, 4? Choose 2 answers: Choose 2 answers: (Choice A) A 6.2 + (6.2 + 9.4)6.2+(6.2+9.4)6, point, 2, plus, left parenthesis, 6, point, 2, plus, 9, point, 4, right parenthesis (Choice B) B -(-6.2+6.2)+9.4−(−6.2+6.2)+9.4minus, left parenthesis, minus, 6, point, 2, plus, 6, point, 2, right parenthesis, plus, 9, point, 4 (Choice C) C -(6.2+6.2)+9.4−(6.2+6.2)+9.4minus, left parenthesis, 6, point, 2, plus, 6, point, 2, right parenthesis, plus, 9, point, 4 (Choice D) D 9.49.49, point, 4 (Choice E) E 6.2-(-6.2-9.4)6.2−(−6.2−9.4)

Answers

Answer:

6.2 + (6.2 + 9.4) ⇒ A

6.2 - (-6.2 - 9.4) ⇒ E

Step-by-step explanation:

your welcome i hope you pass <3

The equivalent expressions are Choice A: 6.2 + (6.2 + 9.4) and Choice C: -(6.2 + 6.2) + 9.4.

How did we arrive at this assertion?

Let's break down the expressions to see how they are equivalent:

Original expression: (6.2 + 6.2) + 9.4

Choice A: 6.2 + (6.2 + 9.4)

This is the same as the original expression because the parentheses ensure that the addition of 6.2 and 9.4 is done first before adding it to the first 6.2.

Choice C: -(6.2 + 6.2) + 9.4

Here, we have a negative sign in front of the expression (6.2 + 6.2). When we add a negative sign, it's equivalent to subtracting the expression from 0. So, -(6.2 + 6.2) is the same as (-6.2 - 6.2), which is then added to 9.4. This is also equivalent to the original expression.

In both Choice A and Choice C, the final result is the same as the original expression: (6.2 + 6.2) + 9.4.

learn more about equivalent expressions: https://brainly.com/question/2972832

#SPJ3

A 60-foot monument casts a 25-foot shadow. How long is the shadow of a 4.5-foot-tall person​

Answers

Answer:

1.875 feet

Step-by-step explanation:

The length of the shadow is proportional to the height.

25 / 60 = x / 4.5

Cross multiply and solve:

60x = (25)(4.5)

60x = 112.5

x = 1.875

The shadow is 1.875 feet long.

Final answer:

The shadow of a 4.5-foot-tall person would be 1.875 feet long.

Explanation:

The shadow of a 4.5-foot-tall person would be 1.875 feet long.

First, set up a proportion using the given information: Height of monument / Length of its shadow = Height of person / Length of their shadow

Plug in the values: 60 / 25 = 4.5 / x

Solve for x to find the length of the person's shadow: x = (4.5 * 25) / 60 = 1.875 feet

Grade 6,7, and 8 at a middle school each have 180 students. The student council is throwing a school dance and they want to know what Theme to have for the dance. Since the student council cannot ask everyone they will Survey a group of students. Which sample can best help the council to draw conclusions about the preferences of all the students in the school.

A. 6 students from each grade

B. 25 students from each grade

C. 6 students from the entire school

D. 25 students from the entire school

Answers

The answer is B. 25 students from each grade. This is because it will be the most accurate answer of what the school dance will be.
Your answer is B. 25 children a grade would have the most accurate data because you'd be taking 75 children's ideas.

which whole number is closest to the value of square root of 54?
[tex] \sqrt{54} [/tex]
1. 6
2. 7
3. 8
4. 9​

Answers

The answer for this problem is 7
The answer is 7 because 7 • 7 is 49 which is the to the value of the square root of 54.
Hope this helps!

You need 35 black tiles and 28 white tiles to tile a patio. How many
tiles will you need in all? Use the Distributive Property to help you
find the sum.

Answers

In a simple addition problem like this, just directly add the number of black tiles (35) and white tiles (28). So, 35 + 28 equals 63. You will need 63 tiles in all to tile the patio.

The question asks you to find the total number of black and white tiles needed to tile a patio, using the Distributive Property to do the math.

However, the Distributive Property is used for multiplying a number by a group of numbers added together, not for a simple addition problem like this. For this question, you directly add the number of black tiles (35) and white tiles (28).

So, 35 (number of black tiles) + 28 (number of white tiles) equals 63. Therefore, you will need 63 tiles in all to tile the patio.

For more such questions on addition, click on:

https://brainly.com/question/35006189

#SPJ2

'Find the highest common factor of 32, 48 and 72. show your working'

please please help asap <3

Answers

Answer:

HCF(32,48,72) = 8

Step-by-step explanation:

We have ,

32 = 2×2×2×2×2 =

48 = 2×2×2×2×3 = 2⁴×3¹

72 = 2×2×2×3×3 = 2³×3²

Now,

HCF(32,48,72) = 2³ = 8

/* Product of the smallest power of each common prime factors of the numbers */

How do I write 1,948,447 In expanded notation

Answers

Answer:

Step-by-step explanation:1,000,000+900,000+40,000+8,000+400+40+7

What is the range of the function in this table?
|
|
24
3 | 3
4 | 2

Answers

recall that in a function, the output or f(x) or namely the dependent variable set is the range.

[tex]\bf \begin{array}{ccll} \stackrel{domain}{x}&\stackrel{range}{y}\\ \cline{1-2} 2&4\\ 3&3\\ 4&2 \end{array}\qquad \qquad \stackrel{\mathbb{RANGE}}{\{4,3,2\}}[/tex]

Pleassseee help, and show steps

Answers

Answer:

(p +5)²  = 26

Step-by-step explanation:

p²+10p = 1

try to arrange them like a²+2ab+b² ;

     

here,

a² = p²  →      ∴a=p

and,

2ab = 10p

⇒2ab = 10a    [∵a=p]

∴ b=5            [dividing both sides by 2a]

∴b²=5²

hence,

⇒ p² + 2 .p.5 + 5² = 1+5²   [add  5² on both sides ]

⇒ (p +5)²  =1+25

∴  (p +5)²  = 26

             

2a - 14 - 7b + 10
Select ALL coefficients from the expression above. I NEED AN ANWSER ASAP​

Answers

its called be a smart kid and actually paying attention u downs syndrome idiot

Look at these equations.
11 = 5 + a
a + 4 = b + 3
Use both equations to work out the value of b.
Pls Help

Answers

Bonjour cheese gateou! je help tes maths!

11=5+a

11-5=a

6=a

a + 4 = b + 3

a - b = - 4 + 3

a-b=-1

Merci beaucoup...

11 = 5 + a
11 - 5 = a
6 = a

6 + 4 = b + 3
10 = b + 3
10 - 3 = b
7 = b

Find the difference. –12 – (–21) = _____ –33 –9 33 9

Answers

Answer:

9

Step-by-step explanation:

(-)(-) = (+)

(-)(+) = (-)

(+)(-) = (-)

(+)(+) = (+)

-(-21) = (-)(-21) = (+)21 = 21

-12 - (-21) = -12 + 21           use commutative property: a + b = b + a

= 21 + (-12) = 21 - 12 = 9

What is the least common multiple (LCM) of 10 and 12?

Answers

The LCM of 10 and 12 = 60.

Hope this helped!

Answer:

60

Step-by-step explanation:

Some people think this concept is confusing. Let's break it down. First, let's ask, what is a multiple?

We get a multiple of a number when we multiply it by another number other than zero. For example:

Multiples of 10: [tex]10, 20, 30, 40, 50, 60, 70, 80, 90, 100...[/tex]

Multiples of 12: [tex]12,24,36,48,60,72,84,96,108...[/tex]

The Least Common Multiple is the smallest multiple of the two numbers. The smallest multiple we see 10 and 12 have is 60.

WHAT IS 2(2X+5)-6(x+2) when simpified

Answers

Answer:

- 2x - 2

Step-by-step explanation:

Given

2(2x + 5) - 6(x + 2) ← distribute both parenthesis

= 4x + 10 - 6x - 12 ← collect like terms

= - 2x - 2

Other Questions
The processivity of a DNA polymerase depends on all of the following actions, EXCEPT for __________. A. association of the DNA polymerase with a sliding clamp (like eukaryotic PCNA) B. interaction between the thumb domain of DNA polymerase and the DNA C. interaction between the minor groove of DNA and the palm domain of the DNA polymerase D. loss of the hydrogen from the 3-OH of the primer due to interaction with a divalent metal ion associated with the palm domain of the DNA polymerase the romans introduced and estabished a common system of written laws why was that important The economy of early villages and cities was based mainly on What is the solution to 4x+5y=12x6y=22 Edouard Daladier became Prime Minister of which country in 1933? A __________ is a wide-mouthed body of water close to shore. Cusic Industries had the following operating results for 2019: sales = $34,621; cost of goods sold = $24,359; depreciation expense = $6,027; interest expense = $2,725; dividends paid = $2,023. At the beginning of the year, net fixed assets were $19,970, current assets were $7,075, and current liabilities were $4,010. At the end of the year, net fixed assets were $24,529, current assets were $8,702, and current liabilities were $4,700. The tax rate was 25 percent. a. What is net income for 2019? (Do not round intermediate calculations.) b. What is the operating cash flow for 2019? (Do not round intermediate calculations.) c. What is the cash flow from assets for 2019? (A negative answer should be indicated by a minus sign. Do not round intermediate calculations.) d-1. If no new debt was issued during the year, what is the cash flow to creditors? (Do not round intermediate calculations.) d-2. If no new debt was issued during the year, what is the cash flow to stockholders? (A negative answer should be indicated by a minus sign. Do not round intermediate calculations.) Evaluate M2/P2 for M = 10, N = -5, and P = -2? A.-5 B.5 C.-25 D.25 Read the sentences. Sentence 1: I hope the dinner comes out perfectly, but even if it doesnt, Im pretty sure theyll know how hard I tried. Sentence 2: Then well have coffee cake for dessert, which I made from scratch. Sentence 3: I am making my sisters favorite: roasted chicken, brown rice, and brussels sprouts. Sentence 4: I cannot wait to cook dinner for my family tonight. What is the most logical sequence for these sentences in a story? 1, 3, 2, 4 4, 1, 3, 2 4, 3, 2, 1 3, 2, 1, 4 An RNA virus that infects plant cells is copied into a DNA molecule after it enters the plant cell. What would be the sequence of bases in the first strand of DNA made complementary to the section of viral RNA shown here? 5' CCCUUGGAACUACAAAGCCGAGAUUAA 3' Reasoning if you multiply two decimals that are less than 1,can you predict whether the product will be less thanor greater than either of the factors? Explain What is the greatest common factor of 19 and 18? What happened as a result of the Sand Creek Massacre? Please select the word from the list that best fits the definition Likes to study with music in the background Which function has the given graph? Consider a river flowing toward a lake at an average velocity of 3 m/s at a rate of 500m3/sat a location 90 m above the lake surface. Determine the total mechanical energy of the river water per unit mass and the power generation potential of the entire river at that location. Angelo made the decision to outsource the software components of his consulting company so he could focus on the companys ________, which are sources of competitive advantage, make a contribution to perceived customer benefits, have application in a wide variety of markets, and are difficult to imitate. Food web starting with sun and pointing to grasshopper and squirrel; Grasshopper pointing to squirrel, wolf, and snake; squirrel pointing to wolf, snake, and bird; wolf pointing to decomposition with worms and mushrooms; snake pointing to wolf and decomposition with worms and mushrooms; bird pointing to decomposition with worms and mushrooms; decomposition pointing to the sun stating soil nutrients.If we removed the decomposers from this food web, how would it affect the balance of the ecosystem? There would be an increase in dead matter and a lack of nutrients in the soil. There would be a decrease in dead matter and a lack of nutrients in the soil. There would be an increase in dead matter and an increase in nutrients in the soil. There would be a decrease in dead matter and an increase in nutrients in the soil. Which of the following would NOT be considered an investment in human capital?Aobtaining a college degreeBpurchasing a new computerCattending a first-aid classDpaying for cooking lessons For a class Foo, one difference between a variable declared Foo * and a variable declared Foo & is that only the variable declared Foo & can potentially have the value NULL.Select one:a. FALSEb. TRUE