what is the value of x enter your answer in the Box

What Is The Value Of X Enter Your Answer In The Box

Answers

Answer 1
61.4 is the value of x

Related Questions

A rabbit weighed 4,305.6 grams. What is this weight in kilograms?

Answers

Hello! The answer is 4.3056 kilograms.

Final answer:

To convert 4,305.6 grams to kilograms, divide the gram value by 1000, resulting in 4.3056 kilograms, since there are 1000 grams in a kilogram.

Explanation:

The question asks to convert the weight of a rabbit from grams to kilograms. To perform this conversion, we need to know that 1 kilogram is equal to 1000 grams. Thus, we can convert the rabbit's weight by dividing the total grams by 1000 to get the weight in kilograms.

The rabbit weighed 4,305.6 grams. To convert this to kilograms, we divide by 1000:

Divide 4,305.6 by 1000.The result is 4.3056 kilograms.

Thus, the weight of the rabbit is 4.3056 kilograms.

13/40 as a decimal and percent

Answers

Decimal: 0.325
Percent: 32.5%

Answer:

Step-by-step explanation:

13/40 as a decimal  =  0.325

         0.325

40√ _ 130

          120

           _100

               80

                _200

                   200

13/40 as percent

13/40 x 100% = 0.325 x 100% = 32.5%

solve and express the solution set in simplest form. 8x-2/9 = 2/1

Answers

Final answer:

The solution to the equation 8x-2/9 = 2/1 is obtained by multiplying both sides by 9, adding 2 to both sides, dividing by 72, and simplifying the fraction to get x = 5/18.

Explanation:

To solve the equation 8x-2/9 = 2/1, we first want to isolate the variable x. Here are the steps to do this:

Multiply both sides of the equation by 9 to eliminate the denominator on the left side, which gives us 72x - 2 = 18.

Add 2 to both sides to get 72x = 20.

Divide both sides by 72 to solve for x, resulting in x = 20/72.

Simplify the fraction by dividing both the numerator and the denominator by their greatest common divisor, which is 4. The solution in simplest form is x = 5/18.

A trail is 7/12 mile long, which trail is shorter, than 7/12

3/8,5/6,3/4,2/3

Answers

3/8 i think is the right answer

Among the given options, the trail which is shorter than 7/12 is 3/8

Determining the magnitude of a fraction

From the question, we are to determine which trail is shorter than 7/12

To determine which of the given fractions is shorter than 7/12, we will express all the fractions in a common denominator

The given fraction are

3/8, 5/6, 3/4, 2/3

Using a common denominator of 48,

7/12 = 28/48

For the given options,

3/8 = 18/48

5/6 = 40/48

3/4 = 36/48

2/3 = 32/ 48

Now, we will compare their numerators. The fraction which has a numerator that is smaller than the numerator in 28/48 is the fraction smaller than 7/12.

Among the fraction, 18 is the smallest of the numerators and it is lesser than 28.

18/48 corresponds to 3/8

Hence, the trail which is shorter than 7/12 is 3/8

Learn more on Determining the magnitude of fractions here: https://brainly.com/question/26856397

#SPJ2

what is the cosine ratio for ∠F? p.s. show how you got your answer!

Answers

6/10 its adjacent over hypotenuse

Answer:

cosF = [tex]\frac{3}{5}[/tex] is the answer.

Step-by-step explanation:

In a right angle triangle cosine of any angle = [tex]\frac{Base}{Hypotenuse}[/tex]

In the given triangle base or adjacent side of the angle is = 6

Hypotenuse given as 10

So by putting the values of hypotenuse and base in the formula

∠F = [tex]\frac{6}{10}=\frac{3}{5}[/tex]

Therefore cosine of angle [tex]cosF=\frac{3}{5}[/tex] is the answer.

A survey asks 48 randomly chosen students if they plan to buy a school newspaper this week. Of the 48 surveyed,32 plant to buy a school newspaper. If 360 students bought papers,predict the number of students enrolled at the school.

Answers

The answer is 540 because 32/48 is 2/3 and 360/540 equals 2/3

The number of students enrolled at the school is 540.

A survey asks 48 randomly chosen students if they plan to buy a school newspaper this week. Of the 48 surveyed, 32 plan to buy a school newspaper. If 360 students bought papers, predict the number of students enrolled at the school. To solve this, we use a proportion based on the survey results to predict the total enrollment. The proportion of students who plan to buy the newspaper based on the survey is 32 out of 48, which simplifies to 2 out of 3 when reduced. If 360 students actually bought the paper, and assuming the proportion holds for the entire school, we can set up the equation:

2/3 = 360 / total students

To find the total number of students, solve for 'total students':

total students = 360 × 3 / 2

total students = 540

Therefore, based on the survey results and the actual number of newspapers bought, we can predict there are 540 students enrolled at the school.

A bakery made 10 birthday cakes and 3 wedding cakes in one week. Enter the values that form the ratio of the number of birthday cakes the bakery made to the number of wedding cakes the bakery made.

Answers

The ratio is 10:3. You also cannot simplify this.
The first thing you should do in this case is to define variables:
 birthday cakes = BC = 10
 wedding cakes = WC = 3
 We now write the relationship between the variables, which can be written in different ways.

 Way 1: 
 BC: WC
 10: 3
 Way 2: 
 BC / WC
 10/3
 Way 3:
 BC to WC
 10 to 3
 Answer:
 the values that the ratio of the number of birthday cakes the bakery made to the number of wedding cakes the bakery made are:
 10: 3
 10/3
 10 to 3

Item 9 A company that offers tubing trips down a river rents tubes for a person to use and “cooler” tubes to carry food and water. A group spends $270 to rent a total of 15 tubes. Write a system of linear equations that represents this situation. Use xx to represent the number of one-person tubes rented and yy to represent the number of cooler tubes rented. How many of each type of tube does the group rent?

Answers

The group rents 11 one-person tubes and 4 cooler tubes and the two system of equations are:

x + y = 15

20x + 12.5y = 270

And the solution: x = 11, y = 4.

Define Variables:

x = number of one-person tubes rented

y = number of cooler tubes rented

Translate information into equations:

Total tubes: The group rents a total of 15 tubes. Translate this into an equation:

x + y = 15

Cost: Each one-person tube costs $20 and each cooler tube costs $12.50. Use these known costs to represent the total cost:

20x + 12.5y = 270

System of Equations:

x + y = 15

20x + 12.5y = 270

Solving for x and y:

Elimination

Multiply the first equation by -12.5:

-12.5x - 12.5y = -187.5

Add the top and bottom equations:

7.5x = 82.5

Divide both sides by 7.5:

x = 11

Substitute the value of x back into the first equation to solve for y:

11 + y = 15

y = 4

The group rents 11 one-person tubes and 4 cooler tubes.

Therefore, the two system of equations are:

x + y = 15

20x + 12.5y = 270

And the solution: x = 11, y = 4.

Complete question:

A company that offers tubing trips down a river rents tubes for a person to use and “cooler” tubes to carry food and water. A group spends $270 to rent a total of 15 tubes. Write a system of linear equations that represents this situation. Use x to represent the number of one-person tubes rented and y to represent the number of cooler tubes rented. a one person tube costs $20 and a cooler tube costs $12.50 How many of each type of tube does the group rent? what are the two system of equations?

The system of equations representing the situation is x + y = 15 and 20x + 12.50y = 270. The group rents 11 one-person tubes and 4 cooler tubes.

Let's denote:

x as the number of one-person tubes rented

y as the number of cooler tubes rented

Given:

The cost of renting one-person tube is $20

The cost of renting a cooler tube is $12.50

The total amount spent by the group is $270

We can set up the following system of linear equations to represent the situation:

The total number of tubes rented:

x (number of one-person tubes) + y (number of cooler tubes) = 15 (total tubes)

The total cost spent:

20x (cost of one-person tube) + 12.50y (cost of cooler tube) = 270

So, the system of equations is:

x + y = 15

20x + 12.50y = 270

To find the number of each type of tube rented, we can solve this system of equations.

Now, let's solve this system of equations:

From equation 1, we can express x in terms of y:

x = 15 - y

Substitute this expression for x into equation 2:

20(15 - y) + 12.50y = 270

Now, solve for y:

300 - 20y + 12.50y = 270

-7.50y = -30

y = 4

Now that we have found y, let's substitute it back into equation 1 to find x:

x = 15 - 4

x = 11

So, the group rents 11 one-person tubes and 4 cooler tubes.

Complete Question:

A company that offers tubing trips down a river rents tubes for a person to use and "cooler' tubes to carry food and water. A group spends $270 to rent a total of 15 tubes. Write a system of linear equations that represents this situation. Usex to represent the number of one-person tubes rented and y to represent the number of cooler tubes rented. How many of each type of tube does the group rent?

1 Person Tube = $20, Cooler Tube = $12.50.

The system of equations is ___ and ___.

The group rents ___ one-person tubes and _____ cooler tubes.

Last week, maria drove 231 miles. This week, she drove k miles. Using k, write an expression for the total mumber of miles she drove in two weeks?

Answers

231+k= total miles
since you want to find the total you must add the two numbers
Final answer:

The expression for the total number of miles Maria drove in two weeks is 231 + k miles.

Explanation:

In order to find the total number of miles Maria drove in two weeks, we first need to find the sum of the miles she drove last week and the miles she drove this week.

Last week, Maria drove 231 miles.

This week, she drove k miles.

Therefore, the expression for the total number of miles she drove in two weeks is 231 + k miles.

Learn more about Mathematics here:

https://brainly.com/question/27235369

#SPJ11

Calculate the average rate of change of the function f(x) over the interval -[4,-1] using the formula. A_____ The value of f(-1) is.B._____The value of f(-4) is. C.________ the average rate of change of f(x) over the interval [-4,-1] is D.________
GRAPH WITH QUESTION: Y intercept:5 X intercept: -2.5 slope: 2

A: [f(-4)-f(-1)]/[-5]
[f(-1)-f(-4)]/[-5]
[f(-1)-f(-4)]/[3]
[f(-4)-f(-1)]/[3]
B. 3
2
-1
C. -4
-3
4
D. -2
-1.5
2
4

Answers

First we write the equation of the line in its standard form:
 y-yo = m (x-xo)
 Where:
 m = 2
 We choose an ordered pair:
 (xo, yo) = (0, 5)
 Substituting the values:
 y-5 = 2 (x-0)
 Rewriting:
 y = 2x + 5

 Part A:
 The average rate of change of the function f (x) over the interval [-4, -1] using the formula:
 [f (-1) -f (-4)] / [3]
 Part B:
 The value of f (-1) is:
 y = 2 (-1) +5
 y = 3
 Part C:
 
The value of f (-4) is:
 y = 2 (-4) +5
 y = -3
 Part D:
 the average rate of change of f (x) over the interval [-4, -1] is
 m = [f (-1) -f (-4)] / [3]
 m = (3 - (- 3)) / 3
 m = (3 + 3) / (3)
 m = 6/3
 m = 2

your banking cupcakes for the school dance and your recipe makes 24 cupcakes and needs 2 cups of milk . you need to make 288 cupcakes how many quarts of milk will you need

Answers

6 quarts of milk will be needed
6 quarts, or 24 cups

Trig question -- please help if you can!

I have to write y = r cos(θ + R) and z = r sin(θ + R) in terms of y, z, and R. I'm not really sure how to do this, so would you mind showing work so I can learn the steps properly? (teacher hasn't taught this super well, haha) Thank you!!

Answers

[tex]\bf \textit{Sum and Difference Identities} \\\\ sin(\alpha + \beta)=sin(\alpha)cos(\beta) + cos(\alpha)sin(\beta) \\\\ cos(\alpha + \beta)= cos(\alpha)cos(\beta)- sin(\alpha)sin(\beta)\\\\ -------------------------------\\\\ y=r[cos(\theta +R)]\implies y=r[cos(\theta )cos(R)-sin(\theta )sin(R)] \\\\\\ y=rcos(\theta )cos(R)-rsin(\theta )sin(R) \\\\\\ z=r[sin(\theta +R)]\implies y=r[sin(\theta )cos(R)+cos(\theta )sin(R)] \\\\\\ z=rsin(\theta )cos(R)+rcos(\theta )sin(R)[/tex]

70 POINTS!

{Questions 54 & 58}
The function f is one to one. Find to inverse. State the domain & the range of f & f^-1. Graph f & f^-1, & y=x on the same coordinate axes.

Show work please.

Answers

Notation

The inverse of the function f is denoted by f -1 (if your browser doesn't support superscripts, that is looks like f with an exponent of -1) and is pronounced "f inverse". Although the inverse of a function looks like you're raising the function to the -1 power, it isn't. The inverse of a function does not mean the reciprocal of a function.

Inverses

A function normally tells you what y is if you know what x is. The inverse of a function will tell you what x had to be to get that value of y.

A function f -1 is the inverse of f if

for every x in the domain of f, f -1[f(x)] = x, andfor every x in the domain of f -1, f[f -1(x)] = x

The domain of f is the range of f -1 and the range of f is the domain of f -1.

Graph of the Inverse Function

The inverse of a function differs from the function in that all the x-coordinates and y-coordinates have been switched. That is, if (4,6) is a point on the graph of the function, then (6,4) is a point on the graph of the inverse function.

Points on the identity function (y=x) will remain on the identity function when switched. All other points will have their coordinates switched and move locations.

The graph of a function and its inverse are mirror images of each other. They are reflected about the identity function y=x.

A book is opened, and the PRODUCT of the two visible page numbers is found to be 306. The equation which correctly represents this situation is A) x2 = 306 B) 2x2 = 306 C) x2 + x = 306 D) 2x2 + x = 306

Answers

The answer is C, x^2 + x = 306

Answer:

Option C is correct

[tex]x^2+x = 306[/tex]

Step-by-step explanation:

Let the consecutive page number be  x and x+1

As per the statement:

A book is opened, and the PRODUCT of the two visible page numbers is found to be 306.

" PRODUCT of the two visible page numbers" translated to x(x+1)

then;

[tex]x(x+1) = 306[/tex]

Using distributive property, [tex]a \cdot (b+c) = a\cdot b+ a\cdot c[/tex]

then;

[tex]x^2+x = 306[/tex]

Therefore, the equation which correctly represents this situation is [tex]x^2+x = 306[/tex]

2/5 of house household own pets . Of the household pets 1/3 have cats. What is the fraction of the household own cats

Answers

2/5 have pets, and 1/3 of the 2/5 have cats.

1/3 * 2/5 = 2/15 

2/15 of the households have cats.

Fraction of household owning pets = [tex] \frac{2}{5} [/tex]

[tex] Fraction \; of \; household \; owning \; cats \; \\\\=\; \frac{1}{3} \; of\; Fraction \; of\; household\; owning \; pets \\\\=\frac{1}{3} \times\frac{2}{5} \\ \\Multiply \; numerator\; with\; numerator\; and\; denominator\; with\; denominator\\\\= \frac{1 \times 2}{3 \times 5}= \frac{2}{15} [/tex]

Conclusion:

The fraction of the household own cats is two-fifteenth

3(10+2j) please help me

Answers

30+6j im not sure but i hope it is the correct answer
30 + 6j plz give me the brainliest.

Trigonometric Identities Help!?

Answers

Try this option:
he should find a common denominator (it is cosθ) using only cos-s.

answer:
[tex]cos = \frac{cos^2}{cos} [/tex]

state the degree of the polynomial xy+3x2-7+x

Answers

xy+6-7+x
Combine (6+-7)+xy
xy+x-1
xy+3x^2-7+x the degree is 2 

Just use the 'formula' for finding the degree of a polynomial. ie--look for the value of the largest exponent the answer is 2 since that is the largest exponent.

∠1 and ∠2 are a linear pair. m∠1 = x - 29, and m∠2 = x + 61. Find the measure of each angle.

Answers

Since the angles are a linear pair, then we have to validate the following equation:
 m∠1 + m∠2 = 180
 Substituting the values we have:
 (x - 29) + (x + 61) = 180
 We clear x:
 2x + 32 = 180
 x = (180-32) / (2)
 x = 74
 Therefore, each angle will be:
 m∠1 = x - 29 = 74 - 29 = 45
 m∠2 = x + 61 = 74 + 61 = 135
 Answer:
 
the measure of each angle are:
 
m∠1 = 45
 m∠2 = 135

Answer:

1= 45
2= 135

Step-by-step explanation:

(did it on usatp)

Describe the image of D first reflected across line l, then across line m.

Answers

Answser: the image of D will be the same drawing (D), translated to the right of the line m.

Explanation:

1) The first reflection, accross the line l, will be the letter D turned (with the "belly" to the left instead of the right), located to the right of the line l and to the left of the line m.

2) The second reflection, accross the line m, will turn the letter again leting it equal to the original picture, now translated to the right on the line m.


Answer:

Let's approach this step by step.

First, reflect D across line l.

From there, reflect that image across line m.

Your final image should be the letter D.

Check out the image provided.

 

Hope this helped someone!

Step-by-step explanation:

................

5 -2 (4a + 1) + 3a = 13 what is (a) equal to a) - 6/5 b) - 2 c) 2 d) 6/5

Answers

The best answer is a=-2 because I did the math in my head so fast

The solution of the equation 5 -2 (4a + 1) + 3a = 13 is 2/3.

What is an equation?

An equation is an expression that indicates the relationship between two or more numbers and variables.

A mathematical equation is a statement with two equal sides and an equal sign in between, for instance, 4 + 6 = 10. Both 4 + 6 and 10 can be seen on the left and right sides of the equal sign, respectively.

We are given the equation as follows;

5 -2 (4a + 1) + 3a = 13

Therefore, solving the equation

3(4a+1)+3a=13

12a+3+3a=13

15a+3=13

15a=10

a=2/3

Learn more about equations here;

https://brainly.com/question/25180086

#SPJ2

Find the value of x. Then find the measures of B and C

Answers

recall that the sum of all interior angles in a triangle is 180°, therefore

[tex]\bf \stackrel{A}{(48)}~+~\stackrel{B}{(6x-28)}~+~\stackrel{C}{2x}~=~180\implies 8x+20=180 \\\\\\ 8x=160\implies x=\cfrac{160}{8}\implies x=20\\\\ -------------------------------\\\\ \measuredangle B=6(20)-28\qquad \qquad \qquad \measuredangle C=2(20)[/tex]

Which step in the construction of copying a line segment ensures that the new line segment has the same length as the original line segment?

Answers

Here are the steps I think you probably will go through.
1. Draw a line that is longer than the segment but shorter than the width of the page.
1a. Make sure this line is  at least 1/2 inch from the left hand side.  
2. Use a compass to measure the length of the original segment. Never use a ruler. Rulers do not exist in pure geometry.
3. Measure out the distance on the line you just drew with the compass. One end is on the left hand edge and the other end (the pencil end) is marking the segment so it is the same length as the compass. You are done.

The key step either two or three.

Answer:

The steps to copy a line segment are given below:

1. Lets start with a line segment AB that we have to copy.

2. Now mark a point C. below or above AB, that will be one endpoint of the new line segment.

3. Now, put the compass tip on point A of the line segment AB.

4. Spread the compass up to point B, so as the compass width is equal to length of AB.

5. Without changing the compass width, now place the compass tip on the point C that you made in step 2.

6. Now, draw an arc roughly without changing the compass settings. Mark that point D. This will form the new line segment.

7. Draw a line from C to D.

Now out of these points, i guess steps 5 and 6 are the main steps that ensure that the copied line segment is exactly the same as the original segment.

if y = 6x - 3 which of the following see represents possible inputs and outputs of the function represented as ordered pairs

Answers

If it’s giving you a chart you’ll have to use the inputs which are the x and then simplify each number and it will give you the answer of your outout
y = 6x - 3
 For this case, the first thing we can do is write a table with the input and output values of the function.
 Take an example in the interval from x = 0 to x = 5.
 We have then:
 x    y
 0   -3
 1    3
 2    9
 3    15
 4    21
 5    27

 We now represent the inputs and outputs as ordered pairs:
 (0, -3)
 (1,3)
 (2,9)
 (3,15)
 (4,21)
 (5,27)
 Answer:
 the following is represented possible inputs and outputs of the function represented as ordered pairs

 (0, -3)
 (1,3)
 
(2,9)
 
(3,15)
 
(4,21)
 (5,27)

If h(x) = 3 + 2f(x) , where f(1) = 3 and f '(1) = 4, find h'(1).

Answers

h'(x) = 2f'(x)

h'(1) = 2*f'(1) = 2*4
h'(1) = 8

roberto has 12 tiles. each tile is 1 square inch. he will arrange them into a rectangle and glue 1-inch stones around the edge. how can roberto arrange the tiles so that he uses the least number of stones?

Answers

To answer this you will need to determine which area made with the 12 square tiles would give the shortest perimeter.

Think of all the combinations to get 12 square inches
1x12, 2x6, and 3x4. The perimeters of these are 26 in, 16 in, and 14 in.

You should arrange your tiles using the 3 x 4 option. You would need 14 stones.

Answer:

the answer is 4 and 2

Step-by-step explanation:

simplify 28-(8+4). (4-2).

Answers

The value of 28-(8+4). (4-2) is 4

What is Algebra?

Algebra is the study of abstract symbols, while logic is the manipulation of all those ideas.

The acronym PEMDAS stands for Parenthesis, Exponent, Multiplication, Division, Addition, and Subtraction. This approach is used to answer the problem correctly and completely.

Given;

28-(8+4). (4-2)

=28-(32-16+16-8)

=28-24

=4

Therefore, the value of the algebra will be 4

More about the Algebra link is given below.

brainly.com/question/953809

#SPJ5

Final answer:

To simplify 28-(8+4)·(4-2), calculate the operations within the parentheses first, resulting in 28-12·2. Multiplying 12 by 2 gives 24, and subtracting this from 28 yields the simplified answer, which is 4.

Explanation:

The question requires us to simplify the expression 28-(8+4)·(4-2). We start by simplifying the operations inside the parentheses:


 (8+4) = 12
 (4-2) = 2

Next, we multiply the results from the parentheses:


 12·(4-2) = 12·2 = 24

Lastly, we subtract this value from 28:


 28 - 24 = 4

Therefore, the simplified expression is 4.

The general form of the equation of a circle is x2+y2−4x−8y−5=0.



What are the coordinates of the center of the circle?



Enter your answer in the boxes.

( , )

Answers

Know that the equation for a circle is:
(x - h)² + (y - k)² = r²

where (h, k) is the coordinate for the center and r = radius

Factor into a perfect square for x and y by adding/subtracting grouping constants.

Given equation:
x² + y² - 4x - 8y - 5 = 0

going to group all x terms together and add +4 to both sides to give a perfect square of x. This number is determined by taking the square of half the middle term coefficient. [-4x is middle term. (-4/2)² = 4]

(x² - 4x + 4) - 8y + y² - 5 = 4
(x - 2)² + y² - 8y - 5 = 4

Now for  y-terms, (-8/2)² = 16
add 16 to both sides.

(x - 2)² + (y² - 8y + 16) - 5 = 4 + 16
(x - 2)² + (y - 4)² - 5 = 20
now add that 5 over.

final equation for circle:
(x - 2)² + (y - 4)² = 25

center is (2,4) and radius is 5

 

Answer:

(2,4)

Step-by-step explanation:

what is the ratio of 12 percent

Answers

12 percent is equivalent to 12/100.

Examples:  12 percent of 200 would be found by mult. 200 by 0.12.
                    12 percent of 200 could also be found by mult. 200 by 12/100.
Answer: 3:25
12%=12/100 or 12:100
Simplify
12/4:100/4= 3:25

Another term for dual enrollment is:


Answers

Enrolled concurrently.

Answer:

Another term for dual enrollment is: Concurrent enrollment.

Step-by-step explanation:

Concurrent enrollment or dual enrollment are those programs where students gets enrolled in two schools simultaneously.

There are many types of dual enrollment programs available for students like studying in high school students along with taking college classes etc.

Other Questions
how does an artist create fine lines in an etchingA. drawing whith a pencilB. soaking carving in an acid bathC. rearranging he movable typeD. using a brayer and ink, which conclusion is best supported by Daniels observations and discoveries What type of conflict describes a struggle between characters? A. Man versus man B. Man versus self C. Man versus society D. Man versus personality which of the following is the best definition of three-dimensional drawing? A.a three-dimensional drawing represents, on a three-dimensional plane, the length and width of a solid figure.B. a three-dimensional drawing uses graph paper to show the length and width of a solid figure in such a way that it looks realistic.C. a three-dimensional drawing represents on a two-dimensional plane the length, width, and depth of a three-dimensional figure.D. a three-dimensional drawing uses at least one vanishing point to create the illusion of width. What happened to American life as a result of new technology in the late twentieth century?A.Americans could purchase cars for the first time.B.Americans could shop at home on the Internet.C.Americans could see movies in theaters.D.Americans could fly on airplanes. The sum of two angles in a triangle totals 117 degrees, what is the measure of the third angle What types of anthropologists explore all aspects of living human culturefrom war and violence to love, sexuality, and child rearingand look at the meanings that people from all over the world place on these things? Read this excerpt from "Goodbye to All That" by Joan Didion.We stayed ten days, and then we took an afternoon flight back to Los Angeles, and on the way home from the airport that night I could see the moon on the Pacific and smell jasmine all around and we both knew that there was no longer any point in keeping the apartment we still kept in New York.Which statement best explains how the imagery in the excerpt affects the meaning of the text?It highlights the isolation and loneliness of life in Los Angeles, demonstrating that Didion faces the same problems there that she faced in New York.It captures the beauty and serenity of life in Los Angeles, suggesting why Didion feels more content living there than she did in New York.It provides an unrealistic and idealized impression of Los Angeles, showing that Didion has not changed at all.It depicts the dark and mysterious atmosphere of Los Angeles, indicating why Didion is drawn to this new, exciting city. What is the equation, in slope-intercept form, of the line that is perpendicular to the line y 4 = 2/3(x 6) and passes through the point (2, 2)? y = 2/3x 10/3 y = 2/3x +10/3 y = 3/2x 1 y = 3/2x + 1 Your gross pay on your paycheck is $400. your deductions are as follows: federal income tax - $50.00 state income tax - $20.00 social security tax - $7.00 medicare tax - $3.50 please calculate your net pay (in dollars). question 2 options: Which statement accurately describe the role of decomposers in the carbon cycle? When parking downhill on a road with a curb, you should turn your front wheels __________ .A. parallel to the curbB. towards the curbC. towards the street Which of the following terms describes the primary core of a comet? two cards are drawn without replacement from a standard deck of 52 playing cards. find the probability that both are odd numbers (aces are considered odd because they have a value of 1 or 11). 14) Which BEST describes the way the Fourteenth Amendment affected the states?A)States had to give all citizens, regardless of their race or religion, equal protection under the law.B)States could no longer make any laws that were not approved by the federal government.C)States had to pass laws that gave more rights to freed slaves than to other citizens.D)States could no longer institute poll taxes or tests for citizens before they voted.2) The term "Reconstruction" in United States history refers to the period after what event?A)the Civil WarB)the Revolutionary WarC)the Constitutional ConventionD)the Declaration of Independence The major problem with hydrogen as an alternative source of energy is that none exists on the surface of the earth. a. True b. False Analyze the following statement: Marcus notices that he runs faster in the mornings rather than the evenings. Is the statement an example of correlation or causation? A. Correlation, because time of day doesn't cause a person to run faster or slower B. Causation, because Marcus has noticed this over several trials C. No relationship, because time of day has nothing to do with how fast a person runs D.There is not enough information to make a conclusion Which head glands secrete sucrase, lipase, amylase, and invertase? What is the measure of an angle that turns through 3/4 of a complete circle What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatctcatccagcattctgaaagggtaatgaataattattccgctgagttcatgaggtatccgaaggaggagcaacacttaggctataagagtatcatgcacatagatcgggataaatcgcctatcatatgtgacaacaatttcatgattaaaagt code for?