What type of rhetorical device is used here? we will win the wage war in several ways

Answers

Answer 1
Alliteration is the answer

Answer 2

Answer:

alliteration

Explanation:


Related Questions

newspaper article A) convince the reader that the writer is a good fit
editorial essay B) convince the audience of the writer's strong feelings
love song lyrics C) inform the reader about a current event or concern
college application essay D) persuade the reader to take action on a local problem

Match the purpose to the correct writing type.

Answers

The correct matches are as follows:
1. Newspaper article: Inform the reader about a current event or concern.
2. Editorial essay: Persuade the reader to take action on a local problem.
3.Love song lyrics: Convince the audience of the writer's strong feelings.
4.College application essay: Convince the reader that the write is a good fit. 

Answer:

C News paper article

A editorial essay

D love song lyrics

B college application essay

Explanation:

Which excerpt from the poem best reflects the Romantic fascination with the supernatural?
A-- “Through caverns measureless to man / Down to a sunless sea.”
B-- “A savage place! As holy and enchanted / As e’er beneath a waning moon was haunted / By woman wailing for her demon lover!”
 C--“The shadow of the dome of pleasure / Floated midway on the waves; / Where was heard the mingled measure / From the fountain and the caves.”
 D--“It was an Abyssinian maid, / And on her dulcimer she played, / Singing of Mount Abora.”


guys is this not a stupid question?? i mean like what poem is it freaking talking about?!!

Answers

I guessed -B- was it right?

Answer:B-- “A savage place! As holy and enchanted / As e’er beneath a waning moon was haunted / By woman wailing for her demon lover!”

Explanation:

Which of these sentence segments does not contain a capitalization error? mrs. hernandes played a haunting spanish melody on the guitar at the summer festival.

Answers

Answer:

The sentence fragment that does not contain a capitalization error is on the guitar.

Explanation:

The sentence fragment that does not contain a capitalization error is on the guitar because it does not require any capital letter. Names of people, titles, nationalities, languages, names of the days of the week, months of the year, holidays and festivals should be capitalized.

Seasons do not require capitalization if they are used as generic common nouns. However, they do require capitalization if the name of the season is used in a title.

All things considered, the correct version of the sentence would be: Mrs. Hernandes played a haunting Spanish melody on the guitar at the summer festival -or Summer Festival, if it is the name of the festival.

What is the past tense of squeeze?

Answers

The past tense of squeeze is squeezed.

I hope this helps!

1. In “The Tall Woman and Her Short Husband” which of the following best describes how most of the residents in Unity Mansions felt about Mrs.Tall and Mr.Short when they first moved to their community?

A) greatly puzzled

B) coolly indifferent

C) sincerely surprised

D) somewhat interested


2. Which of the following lines from “The Tall Woman and Her Short Husband” best supports the answer selected above?

A) “this was a mystery to the dozens of households living i. unity mansions”

B)”ever since this couple had moved in the old residents had eyes them curiously”

C) “Toungues started wagging, especially in wet weather when the two of them went out and it was always Mrs. Tall who held the umbrella. If anything dropped to the ground,though, it was simpler for Mr Short to pick it up.”

D) “ and the neighbors remained S intrigued as at the start of this ill-assorted, inseparable couple. They went on making plau

Answers

Hey there drereynolds3240!
Answer:
1. A
2.D
3. A
4. C
5. B
6. A

100% correct

Hope this helps!

-Jayden

___________ he did to study for the final exam must have been helpful; his grade improved from a B to an A. Which That So what Whatever

Answers

Whatever he did to study

Answer:

Whatever

Explanation:

The correct term that best fits the incomplete sentence is 'whatever.'  Read the following sentences and you will be able to determine that the term 'whatever' is best.

Which he did to study for the final exam must have been helpful; his grade improved from a B to an A.

That he did to study for the final exam must have been helpful; his grade improved from a B to an A.

So what he did to study for the final exam must have been helpful; his grade improved from a B to an A.

Whatever he did to study for the final exam must have been helpful; his grade improved from a B to an A.

In complete sentences, explain how it is used to convey meaning in the poem.

Your voice is like bells over roofs at dawn
When a bird flies
And the sky changes to a fresher color.
Speak, speak, Beloved.
Say little things
For my ears to catch
And run with them to my heart.

Answers

The writer used the figurative language, Hyperbole.Hyperbole is most of the time used as an exaggeration that adds humor to the story. 
For example : “Your voice is like bells over roofs at dawn” the writer means that the voice is loud. “Say little things” - the writer means to talk in a slow manner. “For my ears to catch” - the writer means for her to hear  and get what it means “And run with them to my heart.”  - this way the writer may remember the memories. 

Why did the Ku Klux Klan target scalawags with violence?
A. Scalawags were Northerners who came to the South.
B. Scalawags were wealthy, former plantation owners.
C. Scalawags had opposed secession and the Civil War.
D. Scalawags were powerful members of the White League.

Answers

Scalawags were wealthy white men who supported working with freed black men that came from the North. So, the answer is A. I hope this helps!

The correct option is C. The Ku Klux Klan targeted scalawags with violence because Scalawags had opposed secession and the Civil War.

- Scalawags were Southern whites who supported Reconstruction and the Republican Party after the Civil War. They were seen as traitors by many Southern whites because they had opposed secession and supported the Union during the Civil War.

- Option A: Scalawags were not Northerners; Northerners who came to the South during Reconstruction were known as carpetbaggers.

- Option B: Scalawags were not typically wealthy, former plantation owners. They were usually non-slaveholding small farmers, middle-class professionals, and others who were not part of the pre-war Southern elite.

- Option D: The White League was another white supremacist group that sought to maintain white control in the South. While some scalawags may have been involved in local politics, they were not typically powerful members of the White League.

Therefore, the primary reason the Ku Klux Klan targeted scalawags was because of their opposition to secession and their support for Reconstruction policies, which aimed to extend civil and political rights to freed slaves.

Who here is great at creative writing? Please write a poem about a personal hero using at least three examples of figurative language. The poem must be a minimum of 12 lines, but structure is up to you.

Answers

Grandfather, you are my rock and my compass
Though times change and changes grow with the times
You never falter from the truth
Your guidance still remains a light in the darkness
Your kindness still remains a healing balm in times of deepest need
Your wit remains an artful skill to be admired
As sharp as the keen-edged sword
And ever as fresh as the morning dew
Your knowledge which could fill the sea with its depth
Has never born you up to vanity
The only pride I see in your eyes
Is the kind that makes me proud as well
Proud to have earned your admiration
Proud to have earned your respect
Proud to have earned your trust
Proud to be your grandson
Proud for you to be my hero

Read the outline. A. The qualities of a hero 1. brave 2. fights for a cause 3. leads others 4. takes risks 5. opposes injustice Which item should be a supporting point of level 2? leads others fights for a cause takes risks opposes injustice

Answers

The letter d. opposes injustice.

The answer is D

Hoped I helped


How does a conjunction work in a sentence?
A. It changes or adds to a noun
B. It describes a person, place, thing, or idea
C. It joins nouns, verbs, adjectives, adverbs, phrases, or sentences.
D. It changes or adds to verb or adjective

Answers

C- it joins nouns, verbs, adjectives, adverbs, phrases, or sentences

What happens to Atticus at the end of chapter 22 tkam

Answers

Miss Stephanie tells Jem and Scout about an incident that happened between Atticus and Bob Ewell earlier in the day. On the post office corner, Bob Ewell spat in Atticus's face and told him that he'd get him even if it took the rest of his life. 
Bob Ewell is angry with Atticus for revealing the truth about what happened to Mayella in court. Atticus confirmed what the town had long suspected - that Bob Ewell was an abusive father and terrible person. This threat of Ewell's is not empty. Later in the story, his desire for revenge is attempted on the Finches.
Final answer:

In Chapter 22 of 'To Kill a Mockingbird', Atticus Finch deals with the aftermath of Tom Robinson's trial, maintaining his dignity and integrity despite the verdict.

Explanation:

At the end of Chapter 22 in To Kill a Mockingbird, Atticus Finch is disillusioned but stoic after the guilty verdict is handed down in Tom Robinson's trial. Despite his disappointment, he remains committed to upholding his principles of justice and equality. Although the community of Maycomb is divided, with some scornful and others respectful towards him, Atticus retains his dignity and prepares to continue the legal battle in the appeal process. The emotional toll of the trial begins to show on his family, as his children grapple with the injustice they have witnessed.

what homophone means also

Answers

Homophones are words that sound the same but are spelled differently and have different meanings. For example, too and two. Or Knew and new. 
Pronounced the same but spelled different  

Shall I compare thee to a piece of toast?
Thou art more scrumptious and delectable:
Unevenly the elements may glow’st,
And sticking levers are detestable:
Sometimes too long the slice of bread doth roast,
And seldom do the crumbs not make a mess;
And often it is much too sweet for most,
If one should drizzle honey in excess;
But thy eternal warmth shall never cool,
Nor shall thee lose thy lovely golden hue;
And I’ll rejoice that fate hath not been cruel,
Each morning on beholding thee anew;
On this perception all the world agrees,
That no delicious bread’s divine as thee

What is the Rhyme Scheme of this poem?

Question 1 options:


A. AABBCCDDEEFFGG


B. ABABCDCDEFEFGG


C. ABCBDEFEGGHH

Question 2

The poem ends in a _______?

Answers

B. ABABCDCDEFEFGG
When determining a rhyme scheme, the first line is always labeled A. Any line that ends with the same sound as the first line also receives an A. So in the stanza the first lines ends with the /ost/ sound "toast", "glow'st" has the same sound so it is also labeled A. The line ending in delectable doesn't end with /ost/ so it needs to be labeled with the next letter of the alphabet - B. Since also rhymes with delectable it also received the label B. The next sound is roast and it technically should receive an A. There are varying thoughts on this. Some people say that since it's a new stanza the rhymes don't carry over, but others believe they do. You don't have the A as an option though past the first four lines....Since this poem is a sonnet that follows Shakespeare's Sonnet 18 "Shall I compare thee to a summer's day..." we can assume that the rhyme scheme should be the same as a Shakespearean sonnet which is traditionally ABAB CDCD EFEF GG. 
Question 2: rhyming couplet
There are no options given. Since the first question discussed rhyme scheme I'm going to assume that we are still talking about the poem's form. In this case, the sonnet usually ends in a rhyming couplet. A rhyming couplet is two lines that rhyme, one directly after another. This is another trait of the Shakespearean sonnet. These lines usually are a final summary statement, comment or question.

The rhyme scheme of the given poem is B) ABABCDCDEFEFGG. Thus, option B is correct.

This structure is typical of a Shakespearean or Elizabethan sonnet, which consists of three quatrains followed by a final couplet.

For example, consider the lines:

A: Shall I compare thee to a piece of toast?B: Thou art more scrumptious and delectable:A: Unevenly the elements may glow'st,B: And sticking levers are detestable:

Each end sound follows the ABAB pattern, continuing this structure throughout the poem until it ends with the couplet GG.

Sonnet 18 by William Shakespeare:

This poem is a playful imitation of Shakespeare's famous Sonnet 18, which also follows the ABABCDCDEFEFGG rhyme scheme. Shakespeare's sonnets are known for their strict structure, expressive language, and exploration of themes like beauty, time, and love.

Complete question-

Shall I compare thee to a piece of toast?

Thou art more scrumptious and delectable:

Unevenly the elements may glow’st,

And sticking levers are detestable:

Sometimes too long the slice of bread doth roast,

And seldom do the crumbs not make a mess;

And often it is much too sweet for most,

If one should drizzle honey in excess;

But thy eternal warmth shall never cool,

Nor shall thee lose thy lovely golden hue;

And I’ll rejoice that fate hath not been cruel,

Each morning on beholding thee anew;

On this perception all the world agrees,

That no delicious bread’s divine as thee

What is the Rhyme Scheme of this poem?

Question 1 options:

A. AABBCCDDEEFFGG

B. ABABCDCDEFEFGG

C. ABCBDEFEGGHH

What effect does the style of this long sentence achieve?

Answers

Answer:

The Answer is D

Explanation:

edge 2021, hope this helps :)

The long sentence in the passage creates option 4. the uninterrupted action mirrors how the orders will be carried out when the time comes.

What is style

When the writer puts different pieces of information together in one sentence, it makes the details more important. This can make the sentence stronger and more memorable for the reader.

The long sentence is  showing how the cars move smoothly and nonstop along the route. This means that orders will be done in the same way they were planned, without any stops or delays.  The way the author writes shows how determined and focused the narrator is in reaching their goals.

Read more about long sentence here:

https://brainly.com/question/15176431

#SPJ2

See text below

Read the excerpt from hemingway’s a farewell to arms. I talked with the major and learned that when it should start and our cars should be loaded we would drive them back along the screened road and up to the main road along the ridge where there would be a post and other cars to clear them.

What effect does the style of this long sentence achieve? 1. the long-winded rant paints an image of a narrator who is less than stable. 2. the style reflects the mundane actions and events of daily life in a war zone. 3. the choice of simple words adds realism by mimicking the way people speak in real life. 4. the uninterrupted action mirrors how the orders will be carried out when the time comes.

During the revision process, a writer should
A) State a claim
B) Organize information
C) Use credible sources
D) Add stronger evidencs

Answers

I would say D. because revising is a process in which you want to correct your writing and make it stronger.

Answer:

D) Add stronger evidence.

Explanation:

When writing an essay, an author will begin by deciding what his claim is going to be, and then researching the topic in credible sources. As he begins the writing process, he should state his claim and then provide details that support this position. However, during the revision process, an author has the chance to add stronger evidence to his essay. This is important, as it gives him the opportunity to create a more persuasive text.

What is the main idea to this phrase? (PLEASE ANSWER + BRAINLIEST !!)

Everyone is entitled to all the rights and freedoms set forth in this Declaration, without distinction of any kind, such as race, colour, sex, language, religion, political or other opinion, national or social origin, property, birth or other status.

Answers

This excerpt from the Universal Declaration of of Human Rights elaborates on the fact that everyone is equally deserving of the rights in the declaration regardless of their background and/or lifestyle.

You can easily spot the main idea to any text by narrowing down the phrases and words you could substitute with a general term without losing the original thought.

what literary device does pie use in line 4? what does this add to the effect of the stanza?

Answers

u have to say what line 4 says u cant just exspet people to know their are a lot of line 4's

The mood of a story is the
A. Main feeling expressed by the central character.
B. Emotion or atmosphere created by the author.
C. Happiness felt by readers as conflict is solved.
D. Struggle between two forces or characters.

Answers

The mood of a s tory is the, Emotion or atmosphere created by the author.

What is mood?

Mood is the frame of mind and feelings.

Because an author creates a mood in a story by contracting the emotion and feeling to describe negative or positive feeling in a story. Through mood the conscious of mind is expressed in a story.

Hence the correct option is, B. Emotion or atmosphere created by the author.

To know more about mood:

https://brainly.com/question/20080877

#SPJ3

What is an adverb to describe chapter 7 of lord of the flies?

Answers

Final answer:

The appropriate adverb to describe Chapter 7 of 'Lord of the Flies' could be 'ominously,' reflecting the tense and foreboding mood as the boys' descent into savagery intensifies.

Explanation:

An adverb that could describe Chapter 7 of Lord of the Flies is 'ominously.' This chapter encompasses a shift in the boys' behavior as their society starts to crumble, signaling danger and foreshadowing darker events. The atmosphere is tense, the boys' pursuit of the beast signifies a dive into savagery, and the unease among the boys grows. The description provided suggests a haunting scene, leading to an overall mood that can be conveyed as ominous, which in turn, can be characterized by an adverb like 'ominously' to describe the actions and setting in this chapter. In this chapter, the child crosses the creek to reach the fire with eager steps. This adverb describes the child's attitude and enthusiasm as he approaches the fire. The word 'eagerly' indicates that the child is excited and keen to reach his destination quickly.

What is the best definition for the underlined word based on the following sentence?

"Reverend Dimmesdale, replete with the guilt of his own sin, takes to punishing himself through starvation and whippings."

A. Discouraged
B. Deeply filled
C. Comfortable
D. Happy

Answers

Using context clues, the answer seems to be B. Deeply filled

Answer:

b

Explanation:

1. Consider the individuals in George Orwell’s “Shooting an Elephant” and Doris Lessing’s “No Witchcraft for Sale” who are essentially powerless in their respective societies. How do these individuals behave? What do they do to those who have power in their societies? Why do these people act as they do, and what does their behavior demonstrate about imperialism as a political and social ideology? Use examples from the works you have read in your response.

Answers

The novels the main characters are forced to accept racism, discrimination, and prejudice even if they hate this injustice that's done to them. They both complained about those who have power on the other hand Orwell had to obey authorities. Gideon and Teddy had to deal with the arguments of their elders. People usually act upon an approved worth because of stress and status. Imperialism is shown when people think staying in power or with those that have control is the way to survival. 

Final answer:

In George Orwell's "Shooting an Elephant" and Doris Lessing's "No Witchcraft for Sale," the individuals who are essentially powerless in their respective societies behave in different ways, but ultimately they both comply with the demands of those in power. Their behavior demonstrates the oppressive nature of imperialism as a political and social ideology.

Explanation:

In George Orwell's "Shooting an Elephant" and Doris Lessing's "No Witchcraft for Sale," the individuals who are essentially powerless in their respective societies behave in different ways, but ultimately they both comply with the demands of those in power. In "Shooting an Elephant," the narrator, as a representative of the British colonial power, feels compelled to shoot the elephant in order to maintain his authority and avoid being humiliated by the local population. In "No Witchcraft for Sale," the African servant, Gideon, who possesses knowledge of a valuable medicinal plant, ultimately gives in to the demands of the white family he serves by not revealing the secret behind the plant to them.  They act in these ways because they are aware of the power dynamics in their societies and the consequences of defying those in power. Their behavior demonstrates the oppressive nature of imperialism as a political and social ideology. The powerless individuals are forced to conform to the demands of the powerful in order to protect themselves and avoid punishment. Their compliance highlights the unequal power relations inherent in imperialism and how it perpetuates the subjugation and exploitation of the powerless.

PLEASE HELP!!

Which best describes the new food challenges the Annex residents face?

A) Those who provided their food coupons have been arrested, and now they have no butter or fat to cook with.

B)The Van Daans have run out of money to purchase food and have begun stealing from the Franks.

C)Mrs. Van Daan refuses to cook, and no one else has the experience to do so.

D)Their main food store-the bags of dried beans-are now rotten and inedible.

Answers

Mostly B because of how they experienced some things that could help
It's B

    
Happy to help! :)

Which line is an example of imagery? “Thou art fair, my love” “But fairest she when she doth display” “I think my love as rare/As any she belied with false compare” “black wires grow on her head”

Answers

Black wires grow on her head would be the best example of imagery because it uses descriptive words to describe a sight

The line 'black wires grow on her head' is identified as an example of imagery, appealing to the senses and creating a vivid visual image. Imagery, along with figurative language like metaphors and similes, is commonly used in poetry to stimulate imagination and convey deeper meanings within the text.

The question asks to identify which line is an example of imagery. Imagery is a literary device that appeals to the senses and creates vivid pictures in the mind of the reader. The line "black wires grow on her head" provides a visual that is far more evocative and descriptive than the other lines, thus it is an example of imagery. It compares the woman's dark hair to black wires, eliciting a strong image that enables the reader to visualize her appearance distinctively. Figurative language such as metaphors and similes can contribute to imagery, enhancing the overall effectiveness of the poem.

For example, the line "Her eyes as stars of Twilight fair;" from another poem, functions as a simile, comparing her eyes to twilight stars to evoke a particular image and feeling. Poems often use figurative language to establish connections between different ideas and to stimulate the imagination, allowing readers to not only understand but also feel the expressions the poet wishes to convey.

"You have to be cruel to be kind," is a quote from "Like the Sun." It is an example of what? Paradox Conflict Irony Suspense

Answers

i believe that the answer is irony


its Paradox because its an absurd sounding statement that actually has a good founding in it which is, to cause pain for someones own good. hope this helps!!!
Please give me the brainliest answer 

Would someone Please answer this question please will be thanked and also will pick brainly!! (please be honest)

Answers

It expresses the deeper theme of what the sun is attempting to do.
the answer would be


C) it advances the events of the story.

hope it helps

have a good one David.

What type of propaganda would suggest that making a particular choice could lead to something terrible?


Bandwagon

Card stacking

Fear

Testimonial

Answers

I believe it would be fear!

I hope I helped!

Final answer:

Fear propaganda is used to suggest that not making a particular choice could have terrible consequences, playing on the audience's emotions to motivate a specific action.

Explanation:

The type of propaganda that suggests making a particular choice could lead to something terrible is known as fear propaganda. Unlike bandwagon, which relies on the popularity of an idea, fear propaganda plays on the audience's emotions by presenting a scenario where not following a particular course of action may lead to negative, often exaggerated, consequences. This is done to motivate people to choose a specific action to avoid those feared outcomes.

Describe the limited point of view as compared to the omniscient point of view.

Answers

Limited point of view is limited to one person's perspective, but told by the narrator, while the omniscient point of view describes the point of view of various characters, all told by the narrator.

A limited point of view is one persons perspective. But the omniscient point of view is all told by the narrator.

Order the events of these chapters. (based on book twenty thousand leagues under the sea)

encountered a shoal of argonauts
passed through a milk sea visited the pearl bed and saw a giant pearl encountered a shark
sailed through the Red Sea
passed through a secret tunnel under the isthmus of Suez
battled a giant dugong
Ned plotted an escape
Captain Nemo passed a box of ingots to a diver off Crete
stop at Vigo Bay foiled the escape attempt

Answers

that is in perfect order except they battled a giant dugong and THEN passed through a secret tunnel under the isthmus of Suez. 

Answer:

The correct order in which things happen in Twenty Thousand Legues Under Sea is the following:

encountered a shoal of Argonauts  passed through a milk sea visited the pearl bed and saw a giant pearl encountered a shark sailed through the Red Sea  battled a giant dugong  passed through a secret tunnel under the isthmus of Suez  Ned plotted an escape  Captain Nemo passed a box of ingots to a diver off Crete  stop at Vigo Bay foiled the escape attempt

It was all perfectly lined with, with the exception of these two:

"battled a giant dugong" & "passed through a secret tunnel under the isthmus of Suez". The order in which it happens was swapped in the question.

How does capulet change the wedding plans? what implication does this have?

Answers

Lord Capulet moves up the wedding plans This results in Juliet needing to fake her death sooner than expected. Because of this change, the letter from Friar Lawrence to Romeo does not make it to him on time. Romeo is unaware of Juliet's fake death and thinks that she has died for real. Of course, this results in his own suicide.
Final answer:

Capulet changes the wedding plans by moving the date forward. This decision contributes significantly to the pressure on Juliet, leading her to take a potion to fake her death, which leads to the eventual tragic demise of the main characters.

Explanation:

In Shakespeare's Romeo and Juliet, Capulet changes the wedding plans for his daughter Juliet by moving the date forward. Originally, the wedding between Juliet and Paris was planned for Wednesday. However, out of grief over Tybalt's death and in an attempt to cheer Juliet up, Capulet decides to hold the wedding earlier, by Tuesday instead.

The implication of this change is significant as it places additional pressure and urgency on Juliet to find a way out of this arranged marriage, culminating in her drastic decision to take a potion to feign her death. This in turn sets the rest of the tragic chain of events into motion leading to the death of both main characters, Romeo and Juliet.

Learn more about Capulet's change in wedding plans here:

https://brainly.com/question/33439196

#SPJ6

Other Questions
Describe the effects of Eastern Europes economic problems and ethnic and religious tensions What term refers to the coldest and densest zone, deep below the surface of a lake? Tyree is a skilled cyclist. when practicing on a stationary bike, his coach finds that when the women's cycling team enters the gym, his speed seems to increase significantly. tyree's increase in speed illustrates What factors are associated with recent intimate partner violence? findings from the who multi-country study on women's health and domestic violence? BY THE PRESIDENT OF THE UNITED STATES OF AMERICA. A PROCLAMATION. I, ABRAHAM LINCOLN, President of the United States of America, and Commander-in-Chief of the Army and Navy thereof, do hereby proclaim and declare that hereafter, as heretofore, the war will be prosecuted for the object of practically restoring the constitutional relation between the United States, and each of the States, and the people thereof, in which States that relation is, or may be, suspended or disturbed. That it is my purpose, upon the next meeting of Congress to again recommend the adoption of a practical measure tendering pecuniary aid to the free acceptance or rejection of all slave States, so called, the people whereof may not then be in rebellion against the United States and which States may then have voluntarily adopted, or thereafter may voluntarily adopt, immediate or gradual abolishment of slavery within their respective limits; and that the effort to colonize persons of African descent, with their consent, upon this continent, or elsewhere, with the previously obtained consent of the Governments existing there, will be continued. That on the first day of January in the year of our Lord, one thousand eight hundred and sixty-three, all persons held as slaves within any State, or designated part of a State, the people whereof shall then be in rebellion against the United States shall be then, thenceforward, and forever free; and the executive government of the United States, including the military and naval authority thereof, will recognize and maintain the freedom of such persons, and will do no act or acts to repress such persons, or any of them, in any efforts they may make for their actual freedom. That the executive will, on the first day of January aforesaid, by proclamation, designate the States, and part of States, if any, in which the people thereof respectively, shall then be in rebellion against the United States; and the fact that any State, or the people thereof shall, on that day be, in good faith represented in the Congress of the United States, by members chosen thereto, at elections wherein a majority of the qualified voters of such State shall have participated, shall, in the absence of strong countervailing testimony, be deemed conclusive evidence that such State and the people thereof, are not then in rebellion against the United States. That attention is hereby called to an Act of Congress entitled "An Act to make an additional Article of War" approved March 13, 1862, and which act is in the words and figure following: Be it enacted by the Senate and House of Representatives of the United States of America in Congress assembled, That hereafter the following shall be promulgated as an additional article of war for the government of the army of the United States, and shall be obeyed and observed as such: Article . All officers or persons in the military or naval service of the United States are prohibited from employing any of the forces under their respective commands for the purpose of returning fugitives from service or labor, who may have escaped from any persons to whom such service or labor is claimed to be due, and any officer who shall be found guilty by a court-martial of violating this article shall be dismissed from the service. SEC. 2. And be it further enacted, That this act shall take effect from and after its passage." What is the effect of the following passage on the U.S. government? ...and the executive government of the United States, including the military and naval authority thereof, will recognize and maintain the freedom of such persons, and will do no act or acts to repress such persons, or any of them, in any efforts they may make for their actual freedom.A) It intends to conscript former slaves into the military.B) It intends to prosecute former slave owners.C) It will not stop any slave from moving toward freedom.D) It will use its military and naval authority to stop the war. Which of the following words has the same root as the word biology? a zoology b geology c bibliography d biograph Which expression is equivalent to (2x^5+7x^3)-(5x^2-4x^3) What is the length of chord JK? Who was the first northern democrat elected to the presidency since 1968? determine the qotient of 7,684 and 78 Choose the sentence that best describes the history of Guatemala's capital city.The capital has always been Guatemala City.The capital has always been Antigua.The capital used to be Antigua, but is now Guatemala City.The capital used to be Guatemala City, but is now Antigua. As a healthier alternative to french fries, some fast food outlets offer pre-sliced, bagged apples as a side option. the ingredients list often reads, "apples and ascorbic acid." ascorbic acid is another name for vitaminc. what role does the ascorbic acid play in the product? ascorbic acid is a sequestrant that binds free metal ions and reduces the rancidity of fat in the apples. ascorbic acid is an antioxidant that prevents discoloration when the apples are cut and exposed to oxygen. ascorbic acid is a curing agent that prevents the growth of clostridium botulinum. ascorbic acid is a color additive that makes the color of the apples appear more vibrant. What are the causes of problems the milers and other Native American groups face in Guatemala how are people trying to solve these problems Which diagram shows the most useful positioning of a rectangle in the first quadrant of a coordinate plane? Answers are in the pictures. In an attempt to stem the rising tide of illegitimacy rates and single-parent families among the poor, which act mandated two-parent coverage for all state afdc programs? the family support act in 1988 the supplemental security income the affordable care act temporary assistance to needy families Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? view available hint(s) where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? it would not bind the target dna. ttttagccatttacgattaatcg ttttagccatttacgattaatcg ttttagccatttacgattaatcg? For the electric field shown, which of the following statements describes an increase in voltage?A) A negative charge crosses an equipotential line toward the source charge.B) You cannot tell from the information given.C) A positive charge crosses an equipotential line toward the source charge.D) A positive charge moves along an equipotential line.UPDATE: ANSWER IS C Which organisms are both secondary and tertiary consumers in the food web Laura is completing a craft project that involves covering only the lateral surface of a cylindrical container with fabric. The cylinder has a height of 16.8 in. and a radius of 14.6 in. To the nearest square unit, how much fabric does she need for this project? Use a calculator. Marie has left written instructions directing doctors and family members to avoid or stop using life-sustaining procedures in the event of a terminal condition. such an instrument is called the