which characteristic of Byron's style made him an atypical romantic poet

Answers

Answer 1
cynicism- generally wasn't found in Romanticism
Answer 2

Final answer:

Byron's incorporation of personal experiences with a reflective skepticism and his engagement with realistic social causes made him an atypical romantic poet, blending classical admiration with candid expressions of his own life.

Explanation:

One characteristic of Byron's style that made him an atypical romantic poet is his tendency to combine his personal experiences and narratives into his poetry, often in a manner that emphasized not only idealistic views of love and nature but also reflective skepticism and a fascination with the human condition. Unlike typical Romantic poets who often sought to portray an idyllic version of the world, Byron included a more complex and sometimes darker view of reality. This is evident in poems like "She Walks in Beauty" where he writes about the ones he loved the most and in his advocacy for realistic causes such as the Greek war for independence, indicating his active engagement with the world around him.

Byron's multifaceted personality and his willingness to explore not just the beauty but also the flawed aspects of humanity and society, as well as his critical view on the truth-value of one's own meditations, provided his work with a layer of sophistication that at times departed from the more straightforward celebratory tone of Romantic idealism. His works often revealed a blend of admiration for classical literature and an unguarded approach to his own life, including his sexual encounters and personal struggles, which he candidly expressed in his poetry and letters.


Related Questions

identify the word in italics. One may help someone either on purpose or without knowing. demonstrative pronoun indefinite pronoun interrogative pronoun relative pronoun not a pronoun\

Answers

One may help someone either on purpose or without knowing.

indefinite pronoun

Which of the following big ideas is expressed implicitly over the course of the entire article "Fast Track to Success"?

One needs to learn from experts and be determined to be the best in the field.

To achieve your dreams, you have to exercise, practice, and make good choices.

A successful individual is one who works hard and helps others.

One should not let others determine what he or she can or cannot do.

Answers

The best answer for this question would be:

 

To achieve your dreams, you have to exercise, practice, and make good choices.

 

In this big idea, the path to success leads to a lot of practice and a lot of training from life experiences and even lessons from different people, with that you can be able to make good choices.

Answer:

A successful individual is one who works hard and helps others.

Explanation:

This is correct because one must work hard to be successful and helping others is also a key to success.

According to the speaker in "The Nymph's Reply to the Shepherd," what conditions, if they were true, would persuade her to join the shepherd in his pastoral paradise? Select all that apply.

Answers

Answer:

If youth never gave way to old ageIf consequences did not follow actions

Explanation:

"The Nymph's Reply to the Shepherd" is a poem, written by Walter Raleigh, which was intended to be a response to a poem written by Christopher Marlowe called "The Passionate Shepherd to His Love".

The following excerpt from Raleigh's poem exemplifies that the nymph would follow the shepherd if youth never gave way to old age:

But could youth last and love still breed,

Had joys no date nor age no need,

Then these delights my mind might move

To live with thee and be thy love.

While the concept of consequences that follow actions can be found in numerous instances within the poem, with the following as an example:

The flowers do fade, and wanton fields,

To wayward winter reckoning yields,

A honey tongue, a heart of gall,

Is fancy’s spring, but sorrow’s fall.

Answer:

If youth never gave way to old age

If consequences did not follow actions

Explanation:

correct on odyssey

Which pronoun signals a first-person narration?
a
you
b
they
c
our
d
his

Answers

The correct answer is:  [C]:  " our " .
_________________________________________________________
Note:  "our" is the first person, plural, possesive form.
_________________________________________________________

An "our" pronoun signals a first-person narration. Thus, option (c) is correct.

What is pronoun?

The term pronoun refers to the linguistic grammar. A pronoun is a small kind of words such as I, we, he, she, they, you, this, they, me, us, them, him, my, are, and mine etc. The pronoun is replaced to noun. There are types of pronoun such as possessive, relative, intensive, demonstrative, reflexive, personal, indefinite, and interrogative.

It was the first-person narration, a narrator was the tell the story from the own point of view. It was the narrator is speaking was the developed of the story as the used "our" plural, possessive form of the pronoun signals a first-person narration. I, me, my, mine, our, was the used for the narrator.

As a result, the significance of the pronoun signals a first-person narration are the aforementioned. Therefore, option (c) is correct.

Learn more about on pronoun, here:

https://brainly.com/question/7942658

#SPJ6

From “Life in a Love” by Robert Browning But what if I fail of my purpose here? It is but to keep the nerves at strain, To dry one’s eyes and laugh at a fall, And, baffled, get up and begin again,— So the chase takes up one’s life, that’s all.

What do these lines show about the speaker and his attempt to gain the woman’s love?


He will never give up the pursuit of his beloved.

He accepts that he will die if she does not return his affection.

He views his efforts to win her affection as silly.

He will find a new love if she does not care for him.

Answers

He will never give up the pursuit of his beloved.

The correct answer is A) he will never give up the pursuit of his beloved.

What the lines show of the speaker and his attempt to gain the woman's love is that he will never give up the pursuit of his beloved.

"Life in a Love" is a poem written by Robert Browning. It was published in the book "Men and Woman" in 1855. It refers to a woman that could leave the speaker. He pursues the woman and tels that he is going to continue to insists. And if he fails one time, he will keep on trying.

The lines in the excerpt exemplify this: "And, baffled, get up and begin again,— So the chase takes up one’s life, that’s all."

As the weather becomes warmer and people travel outside more often, daring pests creep indoors to explore kitchens and pantries. It is important to know that insects and mice can contribute to the spread of germs and diseases. At the very least, these pests can damage food supplies or cause itchy bug bites. From the largest mice to the tiniest fleas, these creatures can turn a peaceful home into a crawling nightmare!

2Many people, however, hesitate to use commercial sprays near children and pets or in places where they store food. The harsh chemicals in these sprays can cause serious injuries if they aren’t used properly. Luckily, there is now another choice for people who want to avoid these dangerous chemicals. The experts at Growing Garden Supply are happy to help you discover all-natural ways of keeping these creatures outdoors, where they belong.

3This week, pots of peppermint and lavender plants are on sale. These herbs not only let off fragrant scents, but they also can be used to keep pests out of your home. Place a pot of lavender in the kitchen to ward off mice and use mint as an all-purpose pest remover. The scent of crushed mint leaves is unpleasant for mice, ants, and fleas. Sprinkle a few along the edge of your home to discourage pests from entering. Happily, mint leaves are completely safe for humans to eat. Try some in a cup of tea, or use them to add flavor to baked goods.

4After seeing the great results from the mint and lavender plants, why not start an entire garden of plants that are unappealing to pests? Growing Garden Supply has an excellent selection of bitter cucumber seeds and garlic bulbs. Slices of cucumbers and garlic can help chase away ugly roaches and mosquitoes, and the leftovers taste wonderful in summer salads and pasta dishes.

5People who are eager for an immediate fix to their pest problems might prefer a liquid spray. Fortunately, we have many plant oils and spray bottles in stock! Some of these essential oils can be combined for an even greater effect. Remember, essential oils cannot be stored in plastic or metal for long periods—the oils will eat away at the container. Instead, check out Growing Garden Supply’s impressive collection of beautiful glass jars, available in a variety of shapes and sizes. This will solve all of your oil storage problems.

6Once the house is free of pests, consider natural ways of keeping wildlife from attacking your garden and yard. Choosing the right plants to grow together can be a natural way of keeping hungry caterpillars and rabbits away. Ask our specially trained employees for more helpful suggestions on pest prevention both in and outside the home.

he purpose of this passage is to A) inform readers of the dangers of commercial chemicals. B) tell readers about the types of animals that spread disease. C) persuade readers to purchase an all-natural pest prevention product. D) show readers why it is important to follow directions when using sprays.

Answers

Answer:

Researchers believe that rodents and insects helped spread several of history's plagues.

Explanation:

The passage persuades readers to buy natural pest prevention products by highlighting the dangers of chemical sprays and promoting natural alternatives like peppermint, lavender, and essential oils. It also addresses the importance of biodiversity and natural pest control methods.

The passage's primary purpose is to persuade readers to purchase an all-natural pest prevention product. It discusses the risks associated with commercial chemical sprays and highlights safer, natural alternatives like plants (mint, lavender) and essential oils that repel pests. This information is geared towards encouraging people to avoid chemicals in favor of natural solutions offered by a specific company, Growing Garden Supply. Mention is also made of the role that predators and parasites play in managing pest populations, emphasizing the value of natural pest control strategies that contribute to a healthier environment.

In addition to pest prevention products, the passage also suggests methods for keeping wildlife away from gardens and yards by selecting the right plants, thereby leveraging natural repellent properties. Furthermore, the safety and effectiveness of pesticides, as well as the importance of promoting biodiversity to enhance natural pest control, are subtly underlined.

A claim is a statement that

Answers

It is a statement that is a perspective, stance, position, or viewpoint on a topic.

early in part 2 Montag realizes what made clarisse so likeable. what was it

Answers

Clarisse makes other people feel like they matter. Montag realizes that Clarisse is more interested in learning about others than about herself. Montag says that she was the first person to look at him as if he had counted. We see the contrast to this when he is with his wife who tells him all about what she watches on television and her own time with her friends than ask him about his day. 

What is Noah’s point of view of jasper?

Answers

Noah's Ark narrative encompasses themes of obedience, preservation of life, and glimpses of Noah's humanity, as interpreted in various artworks and historical texts. Noah's demeanor reflects a complex blend of faithfulness and fallibility, illustrating a multifaceted character interpretation from ancient to contemporary times.

The narrative of Noah's Ark as it is known from the Christian Bible and represented in art, presents various themes and interpretations that touch upon the character of Noah and his relationship with God and the world around him. Noah's point of view, as discerned from historical and artistic representations, seems to focus on his obedience to God's will, his role as a preserver of life through the ark, and his humanity, which is exposed through moments of weakness and contemplation.

Artistic interpretations, like the painting 'The Deluge' by Villalpando, reflect on the gravitas of the situation, presenting Noah's Ark as a symbol of salvation amidst chaos and destruction. This reflects the broader theme of God's mercy juxtaposed against his justice. Another dimension is presented in the story of Noah's ark and the dove, which is often interpreted as reflecting God's faithfulness and a promise of peace.

The Curse of Ham, a story connected with Noah that evolved over time, controversially became associated with justifications of slavery and racial theories that are not inherent to the original biblical text. This highlights how Noah's story and viewpoints attributed to him have been interpreted and reinterpreted in various cultural and historical contexts.

Nori is writing an essay to analyze an advertisement for a piece of athletic equipment. What elements should he include in order to write an effective analysis? Check all that apply. personal opinions about the product being advertised the advertising techniques used to persuade the viewer information about competing products and advertisers what tools the advertiser uses to sell the product the purpose of the advertiser’s message

Answers

2.the advertising techniques used to persuade the viewer. In order to do this, Nori need to determine whether the advertisers using a visual or principle attraction method for this product
4.what tools the advertiser uses to sell the product. This could range from newspaper, billboard, television, or phamplets
5.the purpose of the advertiser's message. Nori need to do this in order to find out the customer segmentation of the product

The elements that should be included in order to write an effective analysis are the advertising techniques used to persuade the viewer. The tools the advertiser uses to sell the product and the purpose of the advertiser’s message.

What is an effective analysis?

Effective analysis implies making a productive and constructive evaluation of certain topics. It requires the analyst to follow defined steps for getting desired results.

What are the elements for effective analysis?

Nori should assess techniques that are employed for attracting customers' attention to understand its efficiency.

The tools used for product promotion shows the success of the marketing as an appropriate selection of marketing tool would ring higher sales.

The message of the product is again essential for evaluation as it demonstrates how the product is beneficial and gives utility.

Learn more about analysis here:

https://brainly.com/question/5579259

Read the excerpt from Ernest Hemingway’s “Soldier's Home.” A distaste for everything that had happened to him in the war set in because of the lies he had told. All of the times that had been able to make him feel cool and clear inside himself when he thought of them; the times so long back when he had done the one thing, the only thing for a man to do, easily and naturally, when he might have done something else, now lost their cool, valuable quality and then were lost themselves. What does the excerpt reveal about Krebs?

Answers

Hemingway conveys double entendre between Krebs's soldier and civilian lives. The excerpt shows the ambiguity or precisely black and white nature of the lives. Krebs cannot do the things in his civil life that he has done in his military life. The author counts the disadvantages of these opportunities of Krebs's civilian life in the given excerpt. In order to escape from this unwanted reality he must become someone else. So that, he must lie and he must leave his formed identity.  

Answer:

He is dissatisfied and feels disillusioned with his surroundings.

Explanation:

What is Lincoln’s purpose in writing this document?

Answers

To explain the moral reasons for abolishing slavery

How does o. Henry develop the plot in the cactus

Answers

Final answer:

O. Henry develops the plot in 'The Cactus' through vivid descriptions, effective character development, well-organized sequences of events, and introducing conflict within the narrative. The theme of pride leading to downfall is woven into the story via the protagonist's character. The story effectively combines these aspects to tell a compelling narrative.

Explanation:

In his short story, 'The Cactus', O. Henry uses a variety of techniques to develop the plot. This includes vivid description, rising action building towards the climax, and complex character development to guide his narrative.

Similar to Mark Twain's strategy, O. Henry guides his plot towards its climax with captivating language describing evolving situations. For example, the scene where Trysdale wrestles with his misinterpretation of the cactus and its symbolic meaning indicates the growing dangers and hazards in his love life.

O. Henry's character development is crucial to the plot too. The protagonist, Trysdale, suffers due to his arrogance which leads to his misunderstanding about the cactus. Through his character, O. Henry tells us that excessive pride can blind one to the truth.

Equally, setting and sensory details play a pivotal role. The writer organizes the sequence of events in an organized way. Conflict is introduced, much like in Twain's work, allowing the theme of self-reliance and not second-guessing oneself to come forth.

Learn more about Plot Development here:

https://brainly.com/question/765953

#SPJ12

Final answer:

In "The Cactus," O. Henry develops the plot through a combination of finger spelling, vivid descriptions, elements of conflict, and maintaining focus on the central narrative. This blend of elements helps set the stage for a gripping narrative that's both refreshing and enlightening to readers.

Explanation:

In O. Henry's short story, "The Cactus," the narrative is strategically constructed to set the stage for an intriguing plot. O. Henry uses a variety of literary techniques, including finger spelling, vivid description, and elements of conflict, to build the narrative.

An essential finger spelling moment presents the rising action that prepares the readers for the upcoming climax. Through vivid descriptions, he intensifies the story, particularly by highlighting the multiplicative dangers and imagined perils, keeping readers engrossed.

The plot also features elements of conflict that thickens the plot and stimulates interest. This conflict not only heightens the reader's curiosity about the protagonist's issues but also assists O. Henry in establishing the theme. The theme, subtly sowed within the text, becomes evident to the readers as they derive meaning from the details in the text.

O. Henry also skilfully incorporates other aspects such as maintaining focus on the central narrative, providing detailed descriptions, and conducting a thorough development of characters, settings, and sensory details, and presenting a well-organized sequence of events. This blend of various elements results in a gripping narrative that's refreshing and enlightening to the reader.

Learn more about Plot Development here:

https://brainly.com/question/765953

#SPJ12

Which of the following business documents most likely would contain instructions?

a.) sales report
b.) printer warranty
c.) meeting minutes
d.) employee list

Answers

a.) Printer warranty

Answer:

b.) printer warranty

Explanation:

A sales report will talk about quantities sold, most likely. When they were sold, what time, and many other things that influence sales. A meeting minutes will most likely have the most important point (or only) of the meeting. An employee list's objective is clear on the name itself. A Printer warranty document most likely contains information on how not to break the contract that grants the warranty and some other informative content, making it the answer.

Write a sentence that begins with an introductory phrase and describes this picture.

Answers

wheres the picture at tho.

the answer is "After seeing this shoe, I am convinced that people will wear anything."

Complete the sentence the word or phrase that has the most positive connotation

When we saw her barefoot and wearing flowers as a crown, we knew the girl was.

free-spirited
out-there
eccentric
radical

Answers

Final answer:

The word with the most positive connotation to complete the sentence is 'free-spirited', as it captures the carefree and natural charm described, without implying any extreme deviation from the norm.

Explanation:

In the context of the provided extracts and the objective to use a word with the most positive connotation, the appropriate completion for the sentence would be 'free-spirited'. The girl being described as barefoot and wearing flowers as a crown suggests a carefree, natural, and unaffected charm - which is best captured by the term free-spirited. This term conveys a sense of innocence and a joyful embrace of life without the implications of peculiarity or extremism that the other options might suggest.

The other choices, such as 'out-there', 'eccentric', and 'radical', either have neutral or slightly negative connotations, or imply a stronger deviation from the norm than is suggested by the description. In the literary extracts provided, the characters exhibit a nonconformity or unique beauty that can be positively correlated with the concept of being free-spirited, rather than strongly counter-cultural or unconventional.

Final answer:

The most positive connotation in the given context is 'free-spirited', which implies a sense of independence and carefreeness that aligns with the imagery of a girl wearing a flower crown and being barefoot.

Explanation:

The sentence that has the most positive connotation is: When we saw her barefoot and wearing flowers as a crown, we knew the girl was free-spirited. This phrase conveys a sense of lightness, independence, and a carefree quality, which fits the positive and liberating imagery of the question context

This essay originally appeared in a book that explores whether success comes more from talent or opportunity. Based on the details in section 1 (lines 1-52), what does Gladwell believe about the success of students enrolled in the KIPP Academy?

Answers

Gladwell believes students in a KIPP school succeed despite facing circumstances that would otherwise lead to failure.

Rather than failure, however, these students succeed. Gladwell argues that the culture of the school and its community -- he uses the term "cultural legacy" is what leads to success.

Gladwell argues cultural legacies are so powerful they help people defy the odds and succeed. He believes more needs to be learned about them.

How does the setting in "Harrison Bergeron" affect George?
A. George becomes distracted by media before he is able to formulate a thought,
B. George wears ankle chains that prevent him from connecting meaningfully with society.
C. George has become more loving toward his wife now that they are finally equal.
D. George has no need for human interaction due to television programming.

Answers

Answer:

The correct answer is option A.

Explanation:

In "Harrison Bergeron", the characters have to wear a little device that prevent them from using their capacities. In the case of George, Harrison's father, he is distracted by media before he is able to formulate a thought. That is why, when Harrison is arrested their parents are watching the event on the TV but none of them has a reaction. George does not react because he is preventing from thinking and his wife because she cannot even remember what she has seen on TV.

What are the effects of the imagery used in this poem? Check all that apply. The reader can visualize the fields. The reader can imagine the humming sound of the bees. The reader can feel a bee sting. The reader can imagine the sounds of laughter. The reader feels what playing an instrument is like.

Answers

A poem is a piece of writing that relies on rhyme, rhythm, and meter to evoke feelings or to convey the setting and story.

What is the meaning of the Poem?

In order to generate emotion or to express setting and plot, a poem uses rhyme, rhythm, and meter. There are numerous varieties of poetry, including ballads, haiku, verse, and haiku. Poetry's fundamental components include meter, rhyme, scheme, verse, and stanzas. Students must first grasp these structural components in order to delve further into poetry.

The word "poem" is derived from the Greek word poma, which means a "thing made," and a poet was referred to in antiquity as "a maker of things."A poem is a piece of literature that employs creative word choices to communicate concepts, feelings, or a narrative to the reader. A poet is someone who composes poetry. Many poetry contain aural words or phrases.

Learn more about the Poem here:

https://brainly.com/question/12155529

#SPJ2

Final answer:

Imagery in poetry enhances reader engagement by activating the senses, allowing readers to not just visualize but also experience the poem's content, whether it's visualizing fields, hearing bees, feeling a sting, or imaging laughter and music.

Explanation:

The question regards the effects of imagery in poetry, specifically how it enables the reader to engage with the content through the activation of their senses. Imagery is a critical literary device that poets use to immerse a reader in the story by appealing to the five senses: sight, sound, smell, touch, and taste. This sensory activation allows readers to not only envision the scenes within the poem but also to experience them on a personal level.

The reader can visualize the fields. This is an example of visual imagery, allowing the reader to “see” the fields in their mind's eye.The reader can imagine the humming sound of the bees. This utilizes auditory imagery, enabling the reader to “hear” the sounds described.The reader can feel a bee sting. This would be an example of tactile imagery if the poem effectively makes the reader “feel” this sensation.The reader can imagine the sounds of laughter. Again, this is auditory imagery, bringing the sound of laughter to the readers’ imagination.The reader feels what playing an instrument is like. Depending on the description, this could involve auditory, tactile, or even visual imagery, allowing the reader to “experience” playing an instrument.

Through the use of various forms of imagery, poets can create a vivid, multisensory experience that resonates with readers, making the poetic narrative more immersive and emotionally compelling.

How was Orwell treated by the local Burmese?

Answers

Orwell appears as a symbol of colonial oppression to the burnese and is put in a position where he is the target of hate and disdain. They lash out verbally when they know they can get away with it. Orwell, playing his part, maintains the role of a British officer despite the conditions. The constant ridicule is also the factor that drives Orwell to complete the killing of the elephant. It isn't until after the incident he realizes true strength would have been in walking away.
Final answer:

During his time in Burma, George Orwell was often treated with suspicion and hostility by the local Burmese due to their resentment towards British colonial rule.

Explanation:

In his book, "Burmese Days," George Orwell described how he was treated by the local Burmese during his time as a police officer in Burma. Orwell mentioned that he was often treated with suspicion and hostility by the Burmese due to their resentment towards the British colonial rule.

Orwell cited instances where he was insulted, spat at, and even had stones thrown at him by the local Burmese. He experienced firsthand the resentment and animosity towards the British imperialists, which shaped his perspective on colonialism and influenced his literary works.

It's important to note that Orwell's personal experience may not be representative of the attitude of all local Burmese towards British officials during that time.

Learn more about treatment of Orwell by the local Burmese here:

https://brainly.com/question/29523343

#SPJ3

"The rate of incarceration of women in prison in 1998 was 57 per 100,000."

Is this a Major Support or Minor Support?

A. Minor Support
B. Major Support

Answers

The rate of incarceration of women in prison. this is an major because of how there’s an increase amount of women in prison

what effect does the deforestation have on earth

Answers

It kills/destroys forests and the animals that live there. Possibly killing endangered animals. To answer the question it kills animals or scaring them off to roam around in other places. And it lowers the amount of trees to take in CO2 and expel Oxygen  

Based on Tan's reflective essay, how does her mother's English shape Tan's own identity?

Answers

Tan's mother's English shapes Tan's own identity because it made her more aware of certain sociolinguistic systems present in society, and more aware of language itself. For example, she explains that when she was younger, she had to pretend to be her mom in order to be taken more seriously or to be treated fairly, since her English sounded "normal" while her mother's sounded "broken." 

Plato's sample answer:

Tan’s mother’s imperfect English played a vital role in helping Tan explore and understand the world of language. Tan grew up listening to her mother’s “impeccable broken English,” which helped her discover and comprehend the “different Englishes” and made her ponder the “language in daily life”:

I spend a great deal of my time thinking about the power of language—the way it can evoke an emotion, a visual image, a complex idea, or a simple truth. Language is the tool of my trade. And I use them all—all the Englishes I grew up with.

She also states that not only was her mother’s broken English perfectly coherent to her, but it also played a very significant role in shaping her identity:

But to me, my mother's English is perfectly clear, perfectly natural. It's my mother tongue. Her language, as I hear it, is vivid, direct, full of observation and imagery. That was the language that helped shape the way I saw things, expressed things, made sense of the world.

Her mother’s English was one of the reasons that she developed a love for language. For Tan, her relationship with her mother caused her to have an intimate relationship with words:

I began to write stories using all the Englishes I grew up with: the English I spoke to my mother, which for lack of a better term might be described as "simple"; the English she used with me, which for lack of a better term might be described as "broken"; my translation of her Chinese, which could certainly be described as "watered down"; and what I imagined to be her translation of her Chinese if she could speak in perfect English, her internal language, and for that I sought to preserve the essence, but neither an English nor a Chinese structure.

Walpole also kept the peace as the day's rival political parties, the Whigs and the Tories, argued over the direction of the country. The Whigs or Tories were mainly conservative and pro-nobility. The Whigs or Tories were more liberal and often sided with the rising middle class.

Of the bolded text which answer belongs in each spot?

Answers

Walpole also kept the peace as the day's rival political parties, the Whigs and the Tories, argued over the direction of the country. The Tories were mainly conservative and pro-nobility. The Whigs were more liberal and often sided with the rising middle class.

What are the three major patterns of exposition?

Answers

Three patterns for exposition in writing are the illustrative, analytical and the argumentative patterns

What is one impact of the language used by Prospero in this excerpt from the Tempest?
Ariel: Before you can say 'come' and 'go,' etc....

Prospero: Dearly my delicate Ariel. Do not approach Till etc...

Answers

It illustrates Prospero's power over Ariel

Ariel is forced to serve the magician Prospero in William Shakespeare's play the Tempest.

Birdsong, beautiful bursts of ballads

What rhetorical device did the student use in this line ?

Anaphora

Alliteration

Onomatopoeia

Simile

Answers

Alliteration

Alliteration is the repetition of the same sound at the beginning of a group of words. In this case the /b/ sound is repeated at the beginning of all the words. 
Anaphora is the repetition of a clause or phrase at the beginning of a group of sentences.
Onomatopoeia is a word that sounds the same as its meaning. For example: clack, clang, boom, snap.
Simile is a comparison between two unlike things using like or as. She floated like a cloud above the horizon. In this example, she and cloud are being compared.
Final answer:

The student used the rhetorical device of alliteration in the given line.

Explanation:

The rhetorical device used in the line 'Birdsong, beautiful bursts of ballads' is alliteration. Alliteration is the repetition of similar sounds at the beginning of nearby words. In this line, the repeated initial sound of the words 'Birdsong', 'beautiful', and 'bursts' creates a musical and rhythmic effect.

Learn more about rhetorical device in a line here:

https://brainly.com/question/24956793

#SPJ3

Read the excerpt from Frederick Douglass’s speech “What to the Slave is the Fourth of July?”

Go where you may, search where you will, roam through all the monarchies and despotisms of the Old World, travel through South America, search out every abuse, and when you have found the last, lay your facts by the side of the everyday practices of this nation, and you will say with me, that, for revolting barbarity and shameless hypocrisy, America reigns without a rival.

Which phrase best describes the connotation of the word “reigns”?
a sense of opportunity and growth
a sense of fear and anxiety
a sense of compassion and humanity
a sense of oppression and domination

Answers

A sense of oppression and domination

Answer:

I would say that the phrase that best describes the connotation of the word reigns in this excerpt from Frederick Douglass's speech What to the Slave is the Fourth of July? is the last one: a sense of oppression and domination.

Explanation:

In this excerpt, the speaker is trying to show his audience that, after all the experiences around the world they could get, they will end up choosing America's freedom and way of living. The message is: “go travel the world and compare this way of living with others, and you will come back and appreciate this one”; because, after all, America has no rival. The word reigns, in this excerpt means domination, prevalence, and it involves a sense of oppression because the region is under a certain domain and people there live by those rules.

British authors Bowler, Pratchett, and Kinsella share which of the following sentiments with regard to the craft of writing?

A. Monetary success provides the most meaningful support for successful writing.
B. Successful writers aspire to reach a greater level of popularity with each new work.
C. Formulaic plot patterns achieve the best results for successful writers.
D. Successful writers seek to generate in the reader some of the same passion that inspired their work.

Answers

The correct answer is B

Why is Rosencrantz’s repeated line “He murdered us,” significant?

Answers

The line has two meanings.

First, Rosencrantz is referencing the questions game. Rosencrantz says that Hamlet "murdered" them at the game, meaning that he easily beat them.

The line, of course, has a deeper, ironic meaning -- one that the audience would recognize. Rosencrantz and Guildenstern will die, thanks to Hamlet -- making Rosencrantz's line an example of both foreshadowing and irony.
Other Questions
How much more would $1,000 earn in 5 years in an account compounded continuously than an account compounded quarterly if the interest rate on both accounts is $3.7% How to do this Im lost How do web based applications and websites differ? Describe the effects of Eastern Europes economic problems and ethnic and religious tensions What term refers to the coldest and densest zone, deep below the surface of a lake? Tyree is a skilled cyclist. when practicing on a stationary bike, his coach finds that when the women's cycling team enters the gym, his speed seems to increase significantly. tyree's increase in speed illustrates What factors are associated with recent intimate partner violence? findings from the who multi-country study on women's health and domestic violence? BY THE PRESIDENT OF THE UNITED STATES OF AMERICA. A PROCLAMATION. I, ABRAHAM LINCOLN, President of the United States of America, and Commander-in-Chief of the Army and Navy thereof, do hereby proclaim and declare that hereafter, as heretofore, the war will be prosecuted for the object of practically restoring the constitutional relation between the United States, and each of the States, and the people thereof, in which States that relation is, or may be, suspended or disturbed. That it is my purpose, upon the next meeting of Congress to again recommend the adoption of a practical measure tendering pecuniary aid to the free acceptance or rejection of all slave States, so called, the people whereof may not then be in rebellion against the United States and which States may then have voluntarily adopted, or thereafter may voluntarily adopt, immediate or gradual abolishment of slavery within their respective limits; and that the effort to colonize persons of African descent, with their consent, upon this continent, or elsewhere, with the previously obtained consent of the Governments existing there, will be continued. That on the first day of January in the year of our Lord, one thousand eight hundred and sixty-three, all persons held as slaves within any State, or designated part of a State, the people whereof shall then be in rebellion against the United States shall be then, thenceforward, and forever free; and the executive government of the United States, including the military and naval authority thereof, will recognize and maintain the freedom of such persons, and will do no act or acts to repress such persons, or any of them, in any efforts they may make for their actual freedom. That the executive will, on the first day of January aforesaid, by proclamation, designate the States, and part of States, if any, in which the people thereof respectively, shall then be in rebellion against the United States; and the fact that any State, or the people thereof shall, on that day be, in good faith represented in the Congress of the United States, by members chosen thereto, at elections wherein a majority of the qualified voters of such State shall have participated, shall, in the absence of strong countervailing testimony, be deemed conclusive evidence that such State and the people thereof, are not then in rebellion against the United States. That attention is hereby called to an Act of Congress entitled "An Act to make an additional Article of War" approved March 13, 1862, and which act is in the words and figure following: Be it enacted by the Senate and House of Representatives of the United States of America in Congress assembled, That hereafter the following shall be promulgated as an additional article of war for the government of the army of the United States, and shall be obeyed and observed as such: Article . All officers or persons in the military or naval service of the United States are prohibited from employing any of the forces under their respective commands for the purpose of returning fugitives from service or labor, who may have escaped from any persons to whom such service or labor is claimed to be due, and any officer who shall be found guilty by a court-martial of violating this article shall be dismissed from the service. SEC. 2. And be it further enacted, That this act shall take effect from and after its passage." What is the effect of the following passage on the U.S. government? ...and the executive government of the United States, including the military and naval authority thereof, will recognize and maintain the freedom of such persons, and will do no act or acts to repress such persons, or any of them, in any efforts they may make for their actual freedom.A) It intends to conscript former slaves into the military.B) It intends to prosecute former slave owners.C) It will not stop any slave from moving toward freedom.D) It will use its military and naval authority to stop the war. Which of the following words has the same root as the word biology? a zoology b geology c bibliography d biograph Which expression is equivalent to (2x^5+7x^3)-(5x^2-4x^3) What is the length of chord JK? Who was the first northern democrat elected to the presidency since 1968? determine the qotient of 7,684 and 78 Choose the sentence that best describes the history of Guatemala's capital city.The capital has always been Guatemala City.The capital has always been Antigua.The capital used to be Antigua, but is now Guatemala City.The capital used to be Guatemala City, but is now Antigua. As a healthier alternative to french fries, some fast food outlets offer pre-sliced, bagged apples as a side option. the ingredients list often reads, "apples and ascorbic acid." ascorbic acid is another name for vitaminc. what role does the ascorbic acid play in the product? ascorbic acid is a sequestrant that binds free metal ions and reduces the rancidity of fat in the apples. ascorbic acid is an antioxidant that prevents discoloration when the apples are cut and exposed to oxygen. ascorbic acid is a curing agent that prevents the growth of clostridium botulinum. ascorbic acid is a color additive that makes the color of the apples appear more vibrant. What are the causes of problems the milers and other Native American groups face in Guatemala how are people trying to solve these problems Which diagram shows the most useful positioning of a rectangle in the first quadrant of a coordinate plane? Answers are in the pictures. In an attempt to stem the rising tide of illegitimacy rates and single-parent families among the poor, which act mandated two-parent coverage for all state afdc programs? the family support act in 1988 the supplemental security income the affordable care act temporary assistance to needy families Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? view available hint(s) where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? it would not bind the target dna. ttttagccatttacgattaatcg ttttagccatttacgattaatcg ttttagccatttacgattaatcg? For the electric field shown, which of the following statements describes an increase in voltage?A) A negative charge crosses an equipotential line toward the source charge.B) You cannot tell from the information given.C) A positive charge crosses an equipotential line toward the source charge.D) A positive charge moves along an equipotential line.UPDATE: ANSWER IS C