Which expression should replace the word numerator in the work shown

Answers

Answer 1
May you post a pic of the work?
Answer 2

B: x-5 is expression should replace the word “numerator” .


Related Questions

What is 13.56 • 10 to the power of -8

I rlly need this for math tomorrow

Answers

Answer 0.0000001356

Step-by-step explanation:Since the exponent of the scientific notation is negative, move the decimal point

8 places to the left.

can someone help me do this problem please

|2x-4|=22

Answers

Answer:

2x-4 = 22

2x = 26

x=13 check |26-4|=22

-(2x-4) = 22

-2x+4 = 22

-2x = 18

x=-9 Check |-18 -4| = |-22| = 22

Answer:

x=13

Step-by-step explanation:

Finding the answer to this is very simple actually. you can actually solve this problem without the || because x has to be a positive value for this to work. 2x-4=22 can be done by adding 4 to both sides and getting the answer 26. Isolate the variable by dividing both sides by 2 to get x=13

11.3 divided by 100

Answers

11.3 divided by 11 is 0.113

How to write 12 ten thousands 8 thousands 14 hundreds 7ones

Answers

Answer:

129,407.

Step-by-step explanation:

12 ten-thousands = 12*10000=120,000.

8 thousands = 8*1000=8000;

this gives us 120,000+8,000=128,000.

14 hundreds = 14*100=1400;

this gives us 128,000+1,400=129,400.

7 ones = 7*1=7;

this gives us 129,400+7=129,407.

Answer:

12,000 8,000 1,400 7

Step-by-step explanation:

I hope u get a tutor if u dont know how to do this I hope this helps

|b|+b^3;b=-2 evaluate the expression

Answers

Answer:

-6

Step-by-step explanation:

[tex] | - 2| = 2 \\ {( - 2)}^{3} = ( - 2)( - 2)( - 2) = ( - 8) \\ \\ | - 2 | + {( - 2)}^{3 } = 2 - 8 = - 6[/tex]

Final answer:

To evaluate the expression |b|+b^3 when b=-2, substitute -2 for b, evaluate |b| and b^3 separately and then add the results.

Explanation:

To evaluate the expression |b|+b^3 when b=-2, we substitute -2 for b in the expression.

The absolute value of a number is that number's distance from zero on a number line, regardless of which direction. This means that the absolute value of any negative number is its positive equivalent. Thus, |b| is the same as |-2|, which equals 2.

Secondly, b^3 means b multiplied by itself twice. So (-2)^3 equals -2*-2*-2 which is -8.

First, we evaluate |b|. The absolute value of -2 is 2, so |b| = 2.

Next, we evaluate b^3. (-2)^3 = -8.

Finally, we add the two results together: 2 + (-8) = -6.

Therefore, when b=-2, the expression |b|+b^3 evaluates to -6.

Learn more about Evaluating expressions

https://brainly.com/question/4344214

#SPJ2

Enter the numerical coordinates of the vertices of quadrilateral ABCD in the table. (Point A has been done for you.) Then predict the numerical coordinates of the vertices of quadrilateral A′B′C′D′ as the figure translates four different ways: 7 units up, 1 unit down, 4 units to the right, and 3 units to the left.

Answers

Answer:

Step-by-step explanation: Edmentum Answer

Answer:

Step-by-step explanation: I got it wrong lol

What is 4/3 - (-3/4)

Answers

Answer:

0 I think

Step-by-step explanation:

Answer:

25/12 or 2 1/12

Step-by-step explanation:

4/3 - (-3/4) =

= 4/3 + 3/4

= 16/12 + 9/12

= 25/12

= 2 1/12

Estimate 29.14 x 5.2

Answers

Answer:

About 151.500

Step-by-step explanation:

Actual answer is 151.528 Just go with mental math.

7/5 rational or irrational​

Answers

Answer:rational

Step-by-step explanation:

Answer:

Step-by-step explanation:

Every integer is a rational number, since each integer n can be written in the form n/1. For example 5 = 5/1 and thus 5 is a rational number. However, numbers like 1/2, 45454737/2424242, and -3/7 are also rational, since they are fractions whose numerator and denominator are integers.

Next number in the sequence 1 4 9 16 25

Answers

The next number in the sequence is 36.

Starting from 1, the number increases by 3, 1 + 3 = 4. But the next number, the number it's being increased by increases by 2. 3 + 2 = 5, 4 + 5 = 9. And again, 5 + 2 = 7, 7 + 9 = 16. And again. 7 + 2 = 9, 16 + 9 = 25. Therefore, it is increased to + 11, and the next number is 36.

I hope this helped, and you have a great day!

Answer:

36

Step-by-step explanation:

1² = 1 2² = 43² = 94² = 165² = 256² = 36

Write to show how you make a ten. Then add. What is 7+8?

Answers

Answer:14

Step-by-step explanation:

Answer:

it's 15

Step-by-step explanation:

Find the quotient:
32) 8,736

Answers

Answer:

273

Step-by-step explanation:

8736÷32=273

273×32=8736

Simplify: -3(4x - 5)

12x -15
12x + 15
-12x + 15

Simplify: -5x + 8 - 11x - 12
-16x - 4
16x + 4
16x - 4

2(4x - 8) - 10
8x + 26
8x - 26
-8x - 26

Answers

Answer:

[tex]8x - 26 \\ -16x - 4 \\ -12x + 15[/tex]

Step-by-step explanation:

2(4x - 8) - 10

8x - 16 - 10

|_______|

8x - 26

-5x + 8 - 11x - 12

___ ___ _____ ____

___ ____

-16x - 4

-3(4x - 5)

-12x + 15

For the third and first exercises, you just use the Distributive Property, and for the second exercise, all you are doing is combining like-terms.

I am joyous to assist you anytime.

Malachi’s garden is 2 3/5 meters long. He wants to plant tomato plants every 1/5 of a meter. How many plants can Malachi fit?

Answers

2 3/5= 13/5
(13/5)/(1/5)=(13/5)5=13
answer: A maximum of 13 tomato plants :)

Answer:

13 plants.

Step-by-step explanation:

We have been given that Malachi’s garden is 2 3/5 meters long. He wants to plant tomato plants every 1/5 of a meter.

To find the number of tomato plant that will fit the garden, we will divide length of garden by 1/5 as:

[tex]\text{Number of tomato plant that will fit the garden}=2\frac{3}{5}\div \frac{1}{5}[/tex]

Convert mixed fraction into improper fraction:

[tex]2\frac{3}{5}\Rightarrow\frac{2\times5+3}{5}=\frac{10+3}{5}=\frac{13}{5}[/tex]

[tex]\text{Number of tomato plant that will fit the garden}=\frac{13}{5}\div \frac{1}{5}[/tex]

Convert to multiplication problem by flipping the 2nd fraction:

[tex]\text{Number of tomato plant that will fit the garden}=\frac{13}{5}\times \frac{5}{1}[/tex]

[tex]\text{Number of tomato plant that will fit the garden}=\frac{13}{1}\times \frac{1}{1}[/tex]

[tex]\text{Number of tomato plant that will fit the garden}=13[/tex]

Therefore, 13 plants will fit Malachi's garden.

one fifth of a number decreased by 7​

Answers

Let n = the number

(1/5)n - 7

what is
[tex] \sqrt{180 } [/tex]
simplified?

Answers

Answer:

Step-by-step explanation:

I don't know exactly how simplified it will be, but you can get the square root smaller.

180: 2*2 * 3*3 *5

For every pair of prime factors you can take 1 of the pair outside the the square root and throw the other one away

sqrt(2*2*3*3*5) = 2 * 3 * sqrt(5) = 6*sqrt(5)

551.985 in expanded notation

Answers

Answer:

(5 x 100) + (2 x 50) + (1 x 1) + (9 x 0.10) + (8 x 0.01) + (5 x 0.001)

Answer:

(5 x 100) + (1 x 50) + (1 x 1) + (9 x 1/10) + (8 x 1/100) + (5 x 1/1000)

step by step explanation:

500 + 50 + 1 + 0.9 + 0.08 + 0.005

= 551.985

A line is parallel to y = 3x - 12 and
intersects the point (1, -2). What is the
equation of this parallel line?

Answers

Answer:

y=3x-5

Step-by-step explanation:

parallel means that both lines share the same gradient.

from the equation y=3x-12 , we can deduce that the gradient is 3 because it is in the gradient-intercept form

now substitute values into formula

y-y1=m (x-x1)

y--2=3 (x-1)

expand brackets and simplify

y+2=3x-3

subtract 2 from both sides of equation

y=3x-5

Identify the x-intercept.

1) y= 1/5x + 3

2) y= 6x - 7

3) y= -8/3x + 9

Answers

Answer:

Step-by-step explanation:

the x-intercept when y = 0

1 ) 1/5 x +3 =0    1/5x = - 3 so : x = -15

2) 6x -7 = 0       6x = 7   so ; x =7/6

3) -8/3x +9 = 0    -8/3 x = -9  so  : x =27/8

the number 3456 is divisible by which single-digit numbers?

Answers

Answer:

1, 2, 3, 4, 6, 8, 9

Final answer:

The number 3456 is divisible by the single-digit numbers 2, 3, 4, 6, and 8.

Explanation:

The number 3456 is divisible by the single-digit numbers 2, 3, 4, 6, and 8.

To determine if a number is divisible by another, we check if the remainder is 0 when dividing the number being tested by the potential divisor. In this case, for example, if we divide 3456 by 2, we get no remainder, so it is divisible by 2.

Similarly, if we divide 3456 by 3, 4, 6, or 8, we get no remainder in each case, so it is also divisible by these numbers.

Learn more about Divisibility here:

https://brainly.com/question/34253396

#SPJ2

12x +10+3+8x ? What do I have to do ?

Answers

Simplifying

12x + 10 + 3 + 8x = 0

Reorder the terms:

10 + 3 + 12x + 8x = 0

Combine like terms: 10 + 3 = 13

13 + 12x + 8x = 0

Combine like terms: 12x + 8x = 20x

13 + 20x = 0

Solving

13 + 20x = 0

Solving for variable 'x'.

Move all terms containing x to the left, all other terms to the right.

Add '-13' to each side of the equation.

13 + -13 + 20x = 0 + -13

Combine like terms: 13 + -13 = 0

0 + 20x = 0 + -13

20x = 0 + -13

Combine like terms: 0 + -13 = -13

20x = -13

Divide each side by '20'.

x = -0.65

Simplifying

x = -0.65

Answer:

You have to do like terms

Step-by-step explanation:

12x+10+8+8x

12x+8x = 20x

10+3 = 13

your answer would be

20x+10

What is 14/18 as decimal

Answers

Answer:

14/18 = 0.778

Step-by-step explanation:

14 divided by 2 = 7

18 divided by 2 = 9

7/9 is the same as 7 divided by 9

= 0.778

The decimal equivalent of [tex]\( \frac{14}{18} \)[/tex] is approximately 0.777777777777778.

To convert [tex]\( \frac{14}{18} \)[/tex] to a decimal, one divides 14 by 18. This can be done by hand or with a calculator. When dividing 14 by 18, the result is a repeating decimal where the digit 7 repeats indefinitely. This repeating decimal can be represented as 0.777777777777778 when rounded to the nearest 10th decimal place.

Alternatively, one can simplify the fraction [tex]\( \frac{14}{18} \)[/tex] before converting it to a decimal. By dividing both the numerator and the denominator by their greatest common divisor, which is 2, the fraction simplifies to [tex]\( \frac{7}{9} \)[/tex]. When 7 is divided by 9, the result is again the repeating decimal 0.777777777777778.

In summary, [tex]\( \frac{14}{18} \)[/tex] simplifies to [tex]\( \frac{7}{9} \)[/tex] and as a decimal, it is approximately 0.777777777777778.

Let's assume that bacteria doubles every 10 minutes. If a culture begins with exactly
30 bacterial cells, how many bacteria will be present after 1 hour?

A 960 Bacteria
B 1000 Bacteria
C 1520 Bacteria
D 1920 Bacteria​

Answers

Greetings!

First off, we should know that there are 60 minutes in an hour. Therefore, the first step we will need to do, is divide 60 by 10.

60 ÷ 10 = 6

As shown above, we now know we will have to double the number 6 times. If we start with 30, this will be our first problem.

(1)   30 + 30 = 60

And so on and so forth...

(2)   60 + 60 = 120

(3)   120 + 120 = 240

(4)   240 + 240 = 480

(5)   480 + 480 = 960

(6)   960 + 960 = 1920

And after our sixth time we have our answer:

1920 bacteria

Hope this helps!

~Fluerie

A farmer plans to use 180 feet of fencing to enclose a rectangular region, using part of a straight river bank instead of fencing as one side of the rectangle, as shown in the figure.

Answers

Final answer:

The farmer can determine the dimensions of the fenced area by solving the formula L + 2W = 180 feet, where L is the length of the fenced region along the river bank and W is the width.

Explanation:

This is a classic application of the perimeter of a rectangle in the field of Mathematics. If the farmer is using part of a straight river bank instead of fencing for one side of the rectangle, then he only needs fencing for the other three sides. The formula to calculate the perimeter of a rectangle is 2(length) + 2(width), but since one side is not fenced, it is length + 2(width) in this case.

If we assume the length (L - along the river bank) and width (W) of the rectangular area, then the equation can be expressed as:

L + 2W = 180 feet

This formula can help the farmer calculate the dimensions of the fenced area needed in order to use his materials most effectively. He needs to solve this equation to find the values of length and width that add up to 180 feet.

Learn more about Perimeter Calculation here:

https://brainly.com/question/34472601

#SPJ2

for every 8 candles that you sell you raise $96 you raise $288 how many candles did you sell

Answers

The answer is 24 hope this helps!
8/96=x/288
96x=2304
(96x/96)=(2304/96)
X=24

Liam bought a comic book and had $5 left. If he had a total of $8 walking into the store, how much did he spend on the comic book?

Liam used the equation 5x=8 to model the problem. He said that x represents the amount of money he spent. Liam said that the solution, x=1.6, means that he spent $1.60. Is he correct? Why or why not? If he is incorrect find the correct answer showing your work.

Pls Help Me

Answers

Answer: The comic book was $3.

Step-by-step explanation:

Instead of 5x=8, it should have been 5+x=8 because he only purchased a single comic book. Subtract 5 from 8 and your X value is 3.

Answer:

Liam spent $3 on the book.

Step-by-step explanation:

Liam bought a comic book and had $5 left.

He had a total of $8 walking into the store, so he spent [tex]8-5=3[/tex] dollars on the comic book.

Liam used the equation 5x=8 to model the problem.

This is wrong. The correct form would have been [tex]8-x=5[/tex] or [tex]5+x=8[/tex] where x represents the amount of money he spent.

Hence, Liam spent $3 on the book.

There was 5/8 of pie left in the fridge. Daniel are 1/4 of the leftover pie. How much of pie did he have?

Answers

Answer:

he had 1/4 of the pie; there's 3/8 left over. That's also 37.5% of the pie left over. Not sure what you're trying to get.

Step-by-step explanation:

1/4 is also 2/8

An equation of a line perpendicular to the line represented by the equation y=-1/2x-5 and passing through (6,-4)

Answers

Answer:

y = 2x - 16

Step-by-step explanation:

Perpendicular Lines have OPPOSITE MULTIPLICATIVE INVERSE Rate of Changes [Slopes]:

-½ → 2

-4 = 2[6] + b

-16 = b

y = 2x - 16 >> Perpendicular Line in Slope-Intercept Form

I am joyous to assist you anytime.

Final answer:

The equation of the line that is perpendicular to y = -1/2x - 5 and passes through the point (6, -4) is y = 2x - 16. This is found using the concept of negative reciprocals and the point-slope form of the line equation.

Explanation:

The equation of the original line given is y = -1/2x - 5. The slope of this line is -1/2. Since a line perpendicular to this line will have a slope which is the negative reciprocal of -1/2, the slope of the line we're seeking is 2 (because -1 divided by -1/2 is 2).

We also know from the question that the line we're seeking passes through the point (6, -4). Using the slope-intercept form of the equation of a line (y = mx + b), where m is the slope and b is the y-intercept, we substitute the slope and the coordinates of the point into the equation to solve for 'b': -4 = 2*6 + b. Solving this equation gives us b = -16.

Therefore, the equation of the line that is perpendicular to y = -1/2x -5 and passing through the point (6, -4) is y = 2x - 16.

Learn more about Perpendicular Lines here:

https://brainly.com/question/18271653

#SPJ3

how many vertical asymptotes does the graph of this function have? f(x)=5/3x(x+1)(x-7)

Answers

Answer:

The graph of the function has three vertical  asymptotes

Step-by-step explanation:

we have the function

[tex]f(x)=\frac{5}{3x(x+1)(x-7)}[/tex]

we know that

To find the vertical asymptotes of a rational function, simply set the denominator equal to 0 and solve for x.

so

[tex]3x(x+1)(x-7)=0[/tex]

The values of x are x=-1,x=0, x=7

using a graphing tool

see the attached figure to better understand the problem

therefore

The graph of the function has three vertical asymptotes

Answer:

3. The answer is 3

Step-by-step explanation:

transform pls in fraction (transformati in fractie pls) 3,(7)

Answers

Answer:

The fraction number is [tex]\frac{34}{9}[/tex]

Step-by-step explanation:

we have

[tex]3.777...[/tex]

This is a repeating decimal  (a decimal that has a digit, that repeat over and over and over again without ever ending)

Convert to fraction number

Let

[tex]x=3.777...[/tex]

[tex]10x=37.777...[/tex]

we know that

[tex]10x-x=37.777...-3.777...[/tex]

[tex]9x=34[/tex]

[tex]x=\frac{34}{9}[/tex]

therefore

The fraction number is [tex]\frac{34}{9}[/tex]

Other Questions
What is the solution to 4x+5y=12x6y=22 Edouard Daladier became Prime Minister of which country in 1933? A __________ is a wide-mouthed body of water close to shore. Cusic Industries had the following operating results for 2019: sales = $34,621; cost of goods sold = $24,359; depreciation expense = $6,027; interest expense = $2,725; dividends paid = $2,023. At the beginning of the year, net fixed assets were $19,970, current assets were $7,075, and current liabilities were $4,010. At the end of the year, net fixed assets were $24,529, current assets were $8,702, and current liabilities were $4,700. The tax rate was 25 percent. a. What is net income for 2019? (Do not round intermediate calculations.) b. What is the operating cash flow for 2019? (Do not round intermediate calculations.) c. What is the cash flow from assets for 2019? (A negative answer should be indicated by a minus sign. Do not round intermediate calculations.) d-1. If no new debt was issued during the year, what is the cash flow to creditors? (Do not round intermediate calculations.) d-2. If no new debt was issued during the year, what is the cash flow to stockholders? (A negative answer should be indicated by a minus sign. Do not round intermediate calculations.) Evaluate M2/P2 for M = 10, N = -5, and P = -2? A.-5 B.5 C.-25 D.25 Read the sentences. Sentence 1: I hope the dinner comes out perfectly, but even if it doesnt, Im pretty sure theyll know how hard I tried. Sentence 2: Then well have coffee cake for dessert, which I made from scratch. Sentence 3: I am making my sisters favorite: roasted chicken, brown rice, and brussels sprouts. Sentence 4: I cannot wait to cook dinner for my family tonight. What is the most logical sequence for these sentences in a story? 1, 3, 2, 4 4, 1, 3, 2 4, 3, 2, 1 3, 2, 1, 4 An RNA virus that infects plant cells is copied into a DNA molecule after it enters the plant cell. What would be the sequence of bases in the first strand of DNA made complementary to the section of viral RNA shown here? 5' CCCUUGGAACUACAAAGCCGAGAUUAA 3' Reasoning if you multiply two decimals that are less than 1,can you predict whether the product will be less thanor greater than either of the factors? Explain What is the greatest common factor of 19 and 18? What happened as a result of the Sand Creek Massacre? Please select the word from the list that best fits the definition Likes to study with music in the background Which function has the given graph? Consider a river flowing toward a lake at an average velocity of 3 m/s at a rate of 500m3/sat a location 90 m above the lake surface. Determine the total mechanical energy of the river water per unit mass and the power generation potential of the entire river at that location. Angelo made the decision to outsource the software components of his consulting company so he could focus on the companys ________, which are sources of competitive advantage, make a contribution to perceived customer benefits, have application in a wide variety of markets, and are difficult to imitate. Food web starting with sun and pointing to grasshopper and squirrel; Grasshopper pointing to squirrel, wolf, and snake; squirrel pointing to wolf, snake, and bird; wolf pointing to decomposition with worms and mushrooms; snake pointing to wolf and decomposition with worms and mushrooms; bird pointing to decomposition with worms and mushrooms; decomposition pointing to the sun stating soil nutrients.If we removed the decomposers from this food web, how would it affect the balance of the ecosystem? There would be an increase in dead matter and a lack of nutrients in the soil. There would be a decrease in dead matter and a lack of nutrients in the soil. There would be an increase in dead matter and an increase in nutrients in the soil. There would be a decrease in dead matter and an increase in nutrients in the soil. Which of the following would NOT be considered an investment in human capital?Aobtaining a college degreeBpurchasing a new computerCattending a first-aid classDpaying for cooking lessons For a class Foo, one difference between a variable declared Foo * and a variable declared Foo & is that only the variable declared Foo & can potentially have the value NULL.Select one:a. FALSEb. TRUE how do chemicals affect our lives? what is the region of very calm seas and little to no wind on either side of equator? Which was not one of the major disagreements that the framers faced at the Constitutional Convention?The process for adding future states to the union.Balancing the power of the large and small states.Balancing the power between the state governments and the federal government.What should be done about slavery.