Which law was passed in the Southern states to oppress blacks and force them into a status of second class citizens

Answers

Answer 1
the Southern states used Jim Crow Laws to discriminate African Americans

Related Questions

name some of the democratic reforms made during the golden age of athens

Answers

A wise and able statesman named Pericles led Athens during much of its golden age. ... He so dominated the life of Athens from 461 to 429 B.C. that this period often is called the Age of Pericles. He had three goals: (1) to strengthen Athenian democracy, (2) to hold and strengthen the empire, and (3) to glorify Athens. lol both googled it


What are/were the political hurdles in passing the bill into law?

Answers

The bill first has to be approved by 2/3 of Congress, then the governor or President has to sign or veto the bill

1)How did the Roman Empite benefit by moving the capital to the eastern city?(Remaned Constantine)

2) Why was Byzantium a strategic place to locate Constantine's new city?

3) Explain the benefits of Constantine's decision to shift his capital and how it helped Christianity spread through the Roman Empire?

Answer the following. For each question answer in one or two sentences.

Answers

Byzantium was on the trade route between Europe and Asia and was bordered by the Mediterranean Sea and the Black Sea.Traders stopping in Byzantium would be exposed to Christianity and spread it to other countries.Byzantium was far from Rome and was located on a strait, which made it difficult for enemies to attack the city.

The Phoenicians founded many city-states. These city-states often competed against each other. Do you think it would have made more sense to cooperate?

Answers

Cooperation between Phonecian city-states was unlikely because of their geographical locations - they were scattered along the Mediterranean coasts. Though some Phonecian city-states may have cooperated especially in trading, their prosperous condition despite being independent from each other is why they didn't need to create a united front.
Final answer:

While cooperation among Phoenician city-states might have unified their political and economic resources, competition drove technological advancements and trade. Individual pursuits and alliances helped them adapt and survive under different foreign influences. Their maritime prowess and innovations like the bireme and purple dye production were significant contributions to their success.

Explanation:

The question of whether it would have made more sense for the Phoenician city-states to cooperate rather than compete is a thought-provoking inquiry into the dynamics of ancient civilizations. While competition among the independent city-states of the Phoenicians led to a thriving culture of maritime trade and innovation, cooperation could potentially have unified their political and economic resources. The Phoenicians' dedication to maritime prowess and trade established them as vital contributors to the Mediterranean trade network. However, given that various Phoenician cities like Sidon, Tyre, and the powerful Carthage often found themselves under different spheres of foreign influence or actively competing for regional dominance, it can be argued that their individual pursuits and alliances fine-tuned their adaptability and survival strategies.

For example, Carthage became a substantial power in the western Mediterranean thanks to its strategic location and the influx of immigrants, mainly because of the independent innovation and growth fostered by its unique situation. The complexity of geopolitical dynamics during the era, which also saw interactions with the Greeks, Persians, and Africans, influenced the balance between competition and cooperation. In retrospect, while collaboration might have offered certain advantages, competition and independence were also drivers of growth and technological advancement, such as their seaworthy biremes and the coveted production of purple dye.

Which of these BEST describes how public opinion is usually researched in the United States?

Answers

Answer:

The answer for question is "A random sample of the population is surveyed".

Answer:

its d

Explanation:

What was the Hellenistic Era?

Answers

The Hellenistic period covers the period of Mediterranean history between the death of Alexander the Great in 323 BC and the emergence of the Roman Empire as signified by the Battle of Actium in 31 BC and the subsequent conquest of Ptolemaic Egypt the following year. The Ancient Greek word Hellas (Ἑλλάς, Ellás) is the original word for Greece, which the word Hellenistic was derived from.
The Hellenistic period covers the period of Mediterranean history between the death of Alexander the Great in 323 BC and the emergence of the Roman Empire as signified by the Battle of Actium in 31 BC

What made the Korean War particularly tragic

Answers

the korean war was a proxy war between the Soviets through North Korea, and USA through South Korea.
It was a tragic war because its effects were devastating and it led to numerous loss of lives. In addition, it made millions of people face hunger,drought and famine. it also separated families.
worst of all, it had no effects as dictatorial regimes continued to fluorish in the North.

Which geographic factor had the greatest influence on the early history of South Asia and China?
A- river valleys
B-Island locations
C-vast coastlines
D-tropical rain forests

Answers

The answer is A) river valleys.

Hope this helps!

How does the decision in meyer v. nebraska expand the definition of liberty protected by the fourteenth amendment?

Answers

Expands to education and further defines the amendment. 

This case was about a teacher teaching the German language to a student before 8th grade which was not allowed in Nebraska. The Supreme Court stated there was no harm in teaching German and therefore the state could not infringe on the person's right to learn or obtain education. 
Final answer:

The Meyer v. Nebraska decision broadened the concept of liberty within the Fourteenth Amendment to include not only freedom from physical restraint, but also freedoms related to employment, family, religion, and education.

Explanation:

The decision in Meyer v. Nebraska expanded the definition of liberty protected by the Fourteenth Amendment by interpreting it to include more than just physical restraint. The case decided that liberty also encompasses the right of the individual to contract, engage in common occupations, marry, maintain the home, bring up children, worship God according to the dictates of their conscience, and generally enjoy privileges long recognized at common law as essential to the orderly pursuit of happiness by free men. Importantly, the ruling held that liberty includes the ability to acquire useful knowledge, prepare for professional careers, and establish a home and bring up children, which extends liberties into the area of education. Therefore, the state could not restrict foreign language instruction in private schools.

Learn more about Meyer v. Nebraska here:

https://brainly.com/question/36894121

#SPJ3

What was true about President Franklin D. Roosevelt?

Answers

The answer is C. He refused to let his disability impact his goals

The answer is: C. He refused to let his disability impact his goals.

Franklin D. Roosevelt suffer from a paralytic illness that rendered him paralyzed from the waist down. This condition proved to be a major obstacle for him but it didn't stop him from achieving his goals, mainly becoming president for an unprecedented four terms.

The point where the demand curve and the supply curve intersect represents __________.

Answers

The point where the demand curve and the supply curve intersect represents the equilibrium price. This is the price that balances the quantity supplied (supply)  and the quantity demanded (demand). This is the price at the point of intersection of a supply and demand curve. Sometimes called the market-clearing price because at this price everyone in the market has been satisfied.

The point where the demand curve and the supply curve intersect represents the equilibrium price.

This price strikes a balance between the quantities that are supplied (supply) and required (demand). This price represents where a supply and demand curve cross. Because everyone in the market has been pleased at this price, it is also referred to as the market-clearing price.

The price at which the supply and demand for commodities are balanced is known as the equilibrium price. In order for supply and demand to be equal or nearly equal, a consumer cost must be allocated to a good or service.

Learn more about on demand curve, here:

https://brainly.com/question/13131242

#SPJ6

she term was muckcracker was used during the progressive moment to describe

Answers

Muckrackers were used to describe journalists who would uncover corrupt leaders and organizations, and are the 'watchdogs' to make sure that the people were well-informed, and the corrupt organizations were brought to justice


hope this helps

how presidential powers clearly tied to his/her responsibilities

Answers

Presidential Roles include:
Chief of State
Chief Executive
Chief Diplomat
Commander-in-Chief
Legislative Leader 
Chief of Party
Guardian of the Economy

Presidential powers all stem from being able to carry out certain tasks related to these roles and responsibilities. While the President may not have the direct power to control or do things his powers allow for influence that can often be felt decades later. 

Chief of State - often related to being that "inspiring" example of America, patriotic speeches, welcoming foreign guests; everything to help pump up and show why America is so great; show pride
Chief Executive - run the "business" of government and the many employees that work under him, conduct meetings to help problem solve any possible issues. What and how to enforce laws
Chief Diplomat - Determines the tone and what is said to foreign governments through the many diplomats around the world. Helps create and direct foreign policy 
Commander-in-Chief - decides where troops go and what weapons will be used. Generals take orders from President
Legislative Leader - influence laws (he can't make them) veto and sign laws
Chief of Party - help members of the party get elected/re-elected; campaign for reelection if possible; support those that have supported him 
Guardian of the Economy - address and try to help stop any problems, if possible. Help the economy to run smoothly; monitor things like unnemployment and taxes

Columbus states that he "unfurled the king's standard." Columbus made sure to tell the king he flew the king's flag in order to ?

A. illustrate how he loves Spain
B. show his priorities after he landed
C. show his loyalty to the king
D. Explain the chronology of his actions

Answers

He wanted to show his loyalty to the king.
I mean, yeah, he did love Spain but ultimately, he wanted to show respect and his loyalty to his king.

Why did former uk prime minister david cameron quit? select one:
a. he didn't quit, he died in office.
b. he was impeached in response to handling finances of the uk poorly.
c. he couldn't reach an agreement with the opposition party on issues of energy and the environment.
d. he quit when a referendum resulted in the uk voting to leave the european union?

Answers

The answer should be D. He quit when a referendum resulted in the UK voting to leave the European union. I know that A is incorrect, because he never died in office, and B, and C don't make sense to his choice in leaving the office.
Hope this helps!:)

Instead of helping the people of the Congo, according to the passage, what did King Leopold actually do? Give at least 3 examples of what he did and how he was able to accomplish these tasks.

Answers

Instead of helping the people of Congo, he spent "Millions on religion and art", spent "millions to keep the press of the two hemispheres quiet" and focused upon himself and his own image more than that of his people. He was able to achieve this because of his role as King, and the riches of Congo.

What are 3 important facts about king George lll

Answers

he was the first king to study science, he became heir to the throne in 1751, his father died in1751

King George III opposed slavery, supported the abolishment of the slave trade in England, and his health issues and personal rule significantly shaped his reign and contributed to the American Revolution.

Three important facts about King George III are notable in understanding his reign and impact on history. Firstly, while he is often remembered for the loss of the American colonies, King George III had a strong moral compass and showed a longstanding opposition to slavery.

He supported the abolition of the slave trade in England in 1807, which was a significant position considering many of the Declaration of Independence signers were slave owners. Secondly, despite his good intentions, George III faced personal and political struggles. His reign was marred by mental health issues, eventually leading to his confinement due to madness, and he suffered from blindness in old age. Lastly, George III's political actions, particularly in meddling with state affairs and insistence on ruling personally, contributed significantly to the tensions between England and the American colonies. This meddling and the imposition of various Acts culminated in strained relations and ultimately the American Revolution.

Which of these events came first?

a.Julius Caesar’s assassination
b.Rome becoming a republic
c.Caesar Augustus taking power
d.Rome becoming an empire

Answers

The answer would be C as Rome became an empire because of Caesar and the other stuff happend after.


Read this list:
No one, not even a king, is above the law.Citizens should be guaranteed a fair justice system. Parliament can limit the king's ability to raise money.

Which historical document established these important principles?
A.The Magna Carta
B.The Mayflower Compact
C.The Petition of Right
D.The English Bill of Right

Answers

A. The Magna Carta.

magna Carta limited kings power

Answer:

Option A.

Explanation:

The Magna Carta, is the right answer.

A document originally announced by the King of  England on 15th June 1215 came to be known as the Magna Carta. It was a charter of English liberties, according to which, everyone including the king was subject to the law. This document has 63 clauses that include the date of its publication and other necessary details.

As the Civil War began, the South’s strategy was to
use its superior resources to overcome the North.
defend itself until Northern forces gave up the fight.
elect a proslavery president to the White House.
block supply ships from entering Southern ports.

Answers

Defend until the North gave up--essentially the South believed they had more conviction than the North and that would win out. 

The South had an idea to fight for and believed they could survive on their own. The South relied on their ports and did not have as many supplies as the North but they had something to fight for. The North lacked morale and a mission. It was also believed by some that the South had the right to leave and the North had no right to stop them through military action. 

As the Civil War began, the South’s strategy was to defend itself until Northern forces gave up the fight. Option B is correct.

What is Civil War?

A civil war, often known as an intrastate war, is an organized conflict within a single state (or country). One side's objective may be to seize power in the nation or a specific area, secure regional independence, or alter governmental practices.

The phrase is a calque of the Latin phrase bellum civile, which in the first century BC was used to describe the multiple civil wars of the Roman Republic.

The majority of contemporary civil wars involve outside forces.

About two thirds of the 138 intrastate conflicts between the end of World War II and 2000 saw international action, according to Patrick M.

Thus south want to defend themselves until northern forces give up their fight.

To know more about Civil War refer:

https://brainly.com/question/466971

#SPJ5

In what two ways did Mao Zedong impose communism in China through the cultural revolution

Answers

The right answers are:

B. Mao's Red Guards started harassing Chinese Intellectuals who supported capitalism

&

D. Mao expected the Red Guards to Remain loyal to his teachings in the Little Red Book

Just took the test right now, and I got 100% with these answers.

The two ways that the Mao Zedong impose communism in China through the Cultural Revolution was that Mao's Guards started harassing Chinese Intellectuals who supported capitalism, and he expected the Red Guards to Remain loyal to his teachings in the Little Red Book.

What is communism?

Communism is a social, philosophical, political, and economic theory and movement that aimed at establishing a communist society.

A socioeconomic order based on the ideals of common or social ownership of all property, as well as the removal of social classes, money, and the state.

Mao Zedong imposed communism in China during the Cultural Revolution in two ways that the Mao's Guards began targeting Chinese intellectuals who backed capitalism, and he wanted the Red Guards to be loyal to his Little Red Book teachings.

Therefore, the communism is an ideology that states all property and wealth are communally-owned.

Learn more about the communism, refer to:

https://brainly.com/question/12349431

#SPJ3

Who is the most popular anti-Stratfordian candidate today? Edward de Vere Christopher Marlowe Francis Bacon Queen Elizabeth William Shakespeare

Answers

It is  Edward De Vere and plz mark me as brainlist

Answer:

The most popular anti-Stratfordian candidate today is Edward de Vere.

Hope this helps! :D

Secretary of Defense Robert McNamara and other top advisors believed that the U.S. needed to increase its military presence in Vietnam in order to defeat the communists. Which of the following was passed by Congress and authorized the use of military force in Vietnam?

Answers

Robert S. McNamara. Was the secretary of defense under Kennedy. He helped develop the flexible response policy. He was against the war in Vietnam and was removed from 1964 Congressional resolution that authorized President Johnson to commit US troops to south vietnam and fight a war against north Vietnam.

The correct answer to this open question is the following.

Secretary of Defense Robert McNamara and other top advisors believed that the U.S. needed to increase its military presence in Vietnam in order to defeat the communists. The measure that was passed by Congress and authorized the use of military force in Vietnam was the Gulf of Tonkin Resolution.

The Gulf of Tonkin Resolution led to the escalation of American troops in the War of Vietnam. It gave the President of the United States the ability to send troops without the specific Congress' approval.

On August 7, 1964, Congress passed the Gulf of Tonkin Resolution. It permitted President Lyndon B. Johnson to maintain peace in Southeast Asia.

Why were the citizens of Washington, DC, not allowed to vote in presidential elections until 1961?

Answers

Answer:

C.   They did not have any electors to represent them.

Explanation:

As it was not a state, it had no representation in Electoral College or the Congress.

Who was the owner it the New York journal

Answers

Answer:

William Randolph Hearst

Which best explains how the Medicis were able to convince the Catholic Church to become a patron of the arts during the Renaissance? The Medicis became church leaders and pushed the church to support art. The Medicis gave the church luxury goods in exchange for supporting art. The Medicis gave the church textile goods in exchange for supporting art. The Medicis became government leaders and pushed the church to support art..

Answers

The answer is: The Medicis became church leaders and pushed the church to support art. 

The Medici turn out to be leaders of Christendom over their two well-known 16th century popes, Leo X and Clement VII. They were large supporters of the arts who ordered masterpieces for instance, Michelangelo's The Last Judgment; though, their supremacies accorded with dilemmas for the Vatican, together with Martin Luther's Protestant Reformation and the notorious sack of Rome in 1527.

The Medicis became church leaders and pushed the church to support art. 

Hope this helps;)

Which statement best describes the effect of the Fall of Berlin?

Answers

Best effects of the fall of Berlin are as follows:

1. Reunification – It is where East and West Germany first signed a treaty of an organization that unites their economies, unites their government and legal systems which leads Germans facing economic complications in its conversion to a free-market economy, sell their business whom owned by the East German government and they experienced sluggish economic growth. 

2. Germans can freely travel in and out of East Germany

Option C) Deadly battle primarily between Soviets and Germans that led to formal German surrender ending the European front in WWII known as V-E day, 1945

The Fall of Berlin refers to the final major offensive in the European theater of World War II, culminating in the capture of Berlin, the capital of Nazi Germany, by Soviet forces. Option C accurately describes the events surrounding the Fall of Berlin.

Here's an explanation of why option C is the correct choice:

1. "Deadly battle primarily between Soviets and Germans": The Battle of Berlin, which began in April 1945, was primarily fought between the advancing Soviet Red Army and the defending German forces. It was one of the bloodiest battles of the entire war, characterized by intense urban combat as Soviet troops fought their way into the heart of Berlin against determined German resistance.

2. "Formal German surrender ending the European front in WWII known as V-E Day, 1945": The Battle of Berlin concluded with the unconditional surrender of German forces on May 8, 1945. This surrender marked the end of the war in Europe and is commonly referred to as Victory in Europe Day (V-E Day). The fall of Berlin was a pivotal moment in the war, symbolizing the defeat of Nazi Germany and the conclusion of the European front.

Option C accurately captures the key elements of the Fall of Berlin and its significance in ending World War II in Europe.

Complete Question:

Which statement best describes the effect of the Fall of Berlin?

A) Accidental conflict between the Russians and US where mistaken intelligence led to Russian forces bombing US troops

B) Agreement between Germany, France, the US, and Russia to divide the Japanese Empire among the winning nations

C) Deadly battle primarily between Soviets and Germans that led to formal German surrender ending the European front in WWII known as V-E day, 1945

D) Major offensive in October of 1943 where German forces dug in and repelled Russian attackers from the west and Italian forces from the north

What technology was new to World War II and helped the United States MOST in its war with Japan?

Answers

Answer:

Aircraft Carriers

Explanation:

Airplanes were nothing new to warfare by the time World War II came along. However, aircraft carriers WERE a new technology. It allowed the U.S. Navy to take its airplanes throughout the Pacific, weakening Japan severely. Remember that machine guns were actually first used in warfare at the end of the 1800s.

How did the growth of Christianity and Islam differ during the postclassical era? A. While Christianity expanded in influence, the number of people who practiced Islam decreased. B. While followers of Christianity conquered nations to expand their numbers, Islam did not spread beyond a regional religion. C. While Christianity spread, Europe became politically weaker; however, the Islamic Empire entered a Golden Age. D. While Islam spread, Mesopotamia experienced a decline in civilization; however, Christianity entered a Golden Age.

Answers

C is the final answer :)

Final answer:

Christianity and Islam differed in their growth during the postclassical era, with Christianity expanding through Europe during the Dark Ages, while Islam experienced a Golden Age with rapid expansion across North Africa, Asia, and the Middle East characterized by significant scientific and cultural achievements.

Explanation:

The growth of Christianity and Islam during the postclassical era differed significantly. Christianity spread from the eastern Mediterranean and became deeply integrated into the structure of the waning Roman Empire, while later expanding throughout Europe during the Middle Ages, a period also known as the Dark Ages for Europe due to political fragmentation and social turmoil. Conversely, Islam, which originated on the Arabian Peninsula based on the teachings of Muhammad, spread rapidly across North Africa, through the Middle East, and into Asia following a massive military campaign, followed by diplomatic and commercial exchanges.

During the Dark Ages in Europe, the Islamic Empire was experiencing its Golden Age, a period of flourishing in the arts, sciences, and mathematics, with significant advancements and cultural achievements. The Arab institutions of higher learning kept Greek classical texts alive and contributed to various fields such as architecture and science. Islam spread through military conquests, trade connections, and by the appeal of its unifying principles to various regional groups.

Both religions have continued to grow in numbers, with Christianity having about 2 billion followers as of 2010, and Islam being the second-largest religion with approximately 1.5 billion followers, influential in shaping the civilizations of the Middle East and North Africa. These two world religions have maintained a significant geographical and cultural presence up to the present day, impacting societies on multiple levels, from educational institutions to trade relationships.

why did Great Britain and France want colonies?

Answers

French and Indian War/Seven Years' War, 1754–63. The French and Indian War was the North American conflict in a larger imperial war between Great Britain and France known as the Seven Years' War. The French and Indian War began in 1754 and ended with the Treaty of Paris in 1763.
Great Britain and France wanted colonies because:

Might: Having large amounts of colonies spread throughout the world showed that the country was extremely strong (need of superior troops), wealthy (to transport people and materials) and have a strong leadership
Resources: Having more colonies generally meant more resources. More resources meant that the country can continue with their technological advances and run the country mush more easily.
Population: The more population means that they can tax the people (more governmental income), and even call on the people to join the army in war.


hope this helps
Other Questions
which of the following is the best definition of three-dimensional drawing? A.a three-dimensional drawing represents, on a three-dimensional plane, the length and width of a solid figure.B. a three-dimensional drawing uses graph paper to show the length and width of a solid figure in such a way that it looks realistic.C. a three-dimensional drawing represents on a two-dimensional plane the length, width, and depth of a three-dimensional figure.D. a three-dimensional drawing uses at least one vanishing point to create the illusion of width. What happened to American life as a result of new technology in the late twentieth century?A.Americans could purchase cars for the first time.B.Americans could shop at home on the Internet.C.Americans could see movies in theaters.D.Americans could fly on airplanes. The sum of two angles in a triangle totals 117 degrees, what is the measure of the third angle What types of anthropologists explore all aspects of living human culturefrom war and violence to love, sexuality, and child rearingand look at the meanings that people from all over the world place on these things? Read this excerpt from "Goodbye to All That" by Joan Didion.We stayed ten days, and then we took an afternoon flight back to Los Angeles, and on the way home from the airport that night I could see the moon on the Pacific and smell jasmine all around and we both knew that there was no longer any point in keeping the apartment we still kept in New York.Which statement best explains how the imagery in the excerpt affects the meaning of the text?It highlights the isolation and loneliness of life in Los Angeles, demonstrating that Didion faces the same problems there that she faced in New York.It captures the beauty and serenity of life in Los Angeles, suggesting why Didion feels more content living there than she did in New York.It provides an unrealistic and idealized impression of Los Angeles, showing that Didion has not changed at all.It depicts the dark and mysterious atmosphere of Los Angeles, indicating why Didion is drawn to this new, exciting city. What is the equation, in slope-intercept form, of the line that is perpendicular to the line y 4 = 2/3(x 6) and passes through the point (2, 2)? y = 2/3x 10/3 y = 2/3x +10/3 y = 3/2x 1 y = 3/2x + 1 Your gross pay on your paycheck is $400. your deductions are as follows: federal income tax - $50.00 state income tax - $20.00 social security tax - $7.00 medicare tax - $3.50 please calculate your net pay (in dollars). question 2 options: Which statement accurately describe the role of decomposers in the carbon cycle? When parking downhill on a road with a curb, you should turn your front wheels __________ .A. parallel to the curbB. towards the curbC. towards the street Which of the following terms describes the primary core of a comet? two cards are drawn without replacement from a standard deck of 52 playing cards. find the probability that both are odd numbers (aces are considered odd because they have a value of 1 or 11). 14) Which BEST describes the way the Fourteenth Amendment affected the states?A)States had to give all citizens, regardless of their race or religion, equal protection under the law.B)States could no longer make any laws that were not approved by the federal government.C)States had to pass laws that gave more rights to freed slaves than to other citizens.D)States could no longer institute poll taxes or tests for citizens before they voted.2) The term "Reconstruction" in United States history refers to the period after what event?A)the Civil WarB)the Revolutionary WarC)the Constitutional ConventionD)the Declaration of Independence The major problem with hydrogen as an alternative source of energy is that none exists on the surface of the earth. a. True b. False Analyze the following statement: Marcus notices that he runs faster in the mornings rather than the evenings. Is the statement an example of correlation or causation? A. Correlation, because time of day doesn't cause a person to run faster or slower B. Causation, because Marcus has noticed this over several trials C. No relationship, because time of day has nothing to do with how fast a person runs D.There is not enough information to make a conclusion Which head glands secrete sucrase, lipase, amylase, and invertase? What is the measure of an angle that turns through 3/4 of a complete circle What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatctcatccagcattctgaaagggtaatgaataattattccgctgagttcatgaggtatccgaaggaggagcaacacttaggctataagagtatcatgcacatagatcgggataaatcgcctatcatatgtgacaacaatttcatgattaaaagt code for? Which is a pro-election of federal judges argument?A. When judges are elected they can be biased by party politics. B. When judges are elected there they can focus more time on reviewing law.C. Judges are more accountable to the people and what they think is just when they are elected Which statement displays an effect of developing a successful atomic bomb? Question 11 options: A.encouraged private sector employees to not share their discoveries with the government B.was the final time that the government and private sector combined to form any great invention C.served as a model for future government or private research and development labs to create innovationsD.proved that military innovation is always ahead of private innovation the graph shows the percentage of dog breeds affected by elbow dysplasia, which causes dogs to limp. What???s the most likely explanation for the mixed breed???s disease incidence?