which state has more people than any other in australia

Answers

Answer 1
Australian Capital Territory
Answer 2
New south wales has the most people in it 7,616,200 to be exact.


Related Questions

One of the most important style choices that a speaker makes is deciding upon the _____ in the speech.

Answers

Level of formality
Apex correct answer
Hope I helped :)
(I chose this answer and got it correct so it should work sorry if it doesnt for some reason)

Level of formality  Apex


"what is orlando's complaint against his brother oliver?"

Answers

Orlando's complaint is that he doesn't get sufficiently esteemed nor gets the regard of his elder brother. Orlando takes a solid state of mind towards Oliver, his sibling, asserting that he has as a lot of his dad's blood as Jaques and him. He requests that Oliver either give him the treatment and education he merits, or give him an offer of their dad's money so he can head out to make his own particular fortune.

who believed power should not be concentrated in the hands of one individual

Answers

Answer:

Baron de Montesquieu

Research on gender differences in cognitive abilities indicates that there exists

Answers

Twin studies allow researchers to assess hereditary influences, in part, because:genetic overlap is 100% for identical twinsgenderto refer to male-female differences that are learnedsexto designate biological differences.gender identityis an individual's perception of self as male or female.

____ is the strong identity associated with an extreme sense of allegiance to one's culture.

Answers

Nationalism is the strong identity associated with an extreme sense of allegiance to one's culture.
This belief and ideology  is characterized with loyalty and devotion to a nation
 and a sense of national consciousness.
The term nationalism can denote an attitude but also a system created by people who believe their nation is superior to all others. 

According to sociologists, the state has a central role in _____

Answers

DETERMINING THE RIGHTS AND DUTIES OF CITIZENS

The man who sailed to the New World for both the English and the Dutch was:

Answers

The man who sailed to the New World for both the English and Dutch was "Hudson".

Henry Hudson, set sail for the New World by and by in 1610. When he and his group achieved Canada, they cruised north to avoid the French settlements and exchanging posts. Hudson entered a strait which is today named for him.This course gave him access to an incredible, far reaching inland cove which would likewise be named for the adventurer.  

While Hudson had neglected to locate the Northwest Passage, his investigations demonstrated profitable to both the English and the Dutch in later years. In excess of 50 years after the fact, the English followed up Hudson's voyage by coming back to the immense cove that bears his name, setting up a hide exchanging organization, likewise named for the lost adventurer, the Hudson Bay Company.

Answer:

Yup HUDSON is right.

Explanation:

An article that presents original research, like the finding of an experiment or study, conducted by the authors is an example of what kind of source

Answers

An article that presents original research, like the finding of an experiment or study, conducted by the authors is an example of primary source.
Primary source is also called original source or evidence. It is an artifact, a document, diary,  a recording, or original research. The primary source is any source of information that was created at the time under study.

In what two groups did the social democratic party split

Answers

The Social Democratic Party  split into two main groups: Majority Social Democratic Party of Germany (MSPD) and Independent Social Democratic Party of Germany (USPD

The Social Democratic Party (SPD) in Germany split into two main groups during World War I. The Majority Social Democratic Party of Germany (MSPD) supported the war effort and aimed to achieve socialism through gradual reforms within the existing political system.

They were willing to cooperate with the government, believing that working within the system was the best path forward. On the other hand, the Independent Social Democratic Party of Germany (USPD), formed in 1917, opposed the war and advocated for more radical change.

The USPD criticized the MSPD’s collaboration with the government and sought a revolutionary approach to achieving socialism. This split reflected deeper disagreements within the German socialist movement over strategy, war, and the means to achieve their goals.

Shelly is in the grocery store with her dad. as they near the checkout lane, shelly starts whining for a candy bar but her dad says no. shelly begins to cry and cries louder when her dad continues to refuse. at the checkout lane, in front of the cashier, shelly throws herself onto the floor and begins screaming. her dad responds by grabbing a candy bar and giving it to her. she quickly quiets down and eats her candy bar. this exchange gets repeated on subsequent trips to the grocery store.

Answers

Final Answer:

Shelly's behavior of crying and throwing a tantrum in the grocery store, followed by her dad giving in and buying her a candy bar, establishes a pattern of negative reinforcement.

Explanation:

In this scenario, Shelly's behavior of whining, crying, and throwing a tantrum in the grocery store is a form of negative reinforcement. Negative reinforcement involves the removal of an aversive stimulus to increase the likelihood of a behavior being repeated. In this case, Shelly's crying and tantrum serve as the aversive stimulus, and her dad's response of giving her a candy bar removes that aversive experience, reinforcing the undesirable behavior. The pattern repeats because Shelly has learned that engaging in this behavior results in the desired outcome of receiving a candy bar.

This situation exemplifies how negative reinforcement can inadvertently reinforce and perpetuate undesirable behaviors, as Shelly learns that tantrums lead to getting what she wants.

In cases where the prosecution believe it will be difficult to get a conviction, they might agree to a plea bargain allowing community supervision for a long period.

Answers

The statement is "True".

The plea bargain is any understanding in a criminal case between the prosecutor and respondent whereby the litigant consents to confess to a specific deal in return for an assertion by the prosecutor to drop at least one charges, lessen a charge to a lower offense, or prescribe to the judge a particular sentence.

Do popular cartoon characters on food packages influence children's food choices

Answers

yes it does,influence to make good choices

General cognitive ability measures the areas an individual has in common across the more specific cognitive abilities and is comparable to the concept of iq.
a. True
b. False

Answers

it is  true  i hope.
!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!

Erin, who has korsakoff's amnesia, is asked to perform in a memory experiment. erin is likely to

Answers

Erin is likely to be capable of learning but do poorly in explicit tests of memory.
Korsakoff's amnesia, which got its name from Sergei Korsakoff, who first researched it, is a type of amnesia caused by the lack of thiamine (vitamin B1) in the brain. As a result, various types of amnesia can occur, as well as apathy, confabulation, and difficulties with performing learned knowledge, as is the case with Erin above.

Erin, who has Korsakoff's amnesia, is asked to perform in a memory experiment. Erin is likely to be capable of learning but do poorly in explicit tests of memory.

Peer Counseling help plz
Moe wants to help her volleyball team set some goals for their new season. Which tool would best help them think through their goals?

You and Me Circles
Victim Button
Can Do and Not Yet Circles
Strong Giver

Answers

The correct answer to your question is easy, the Can do circle helps the team identify what the can do and what they can't do.

Hope this helps!


Answer:

Can Do and Not Yet Circles  

Explanation:

The best way for Moe to help his team set goals is "Can and Not Yet Circles" so each player has a chance to talk about what goal he has in mind for the new season and the whole team can discuss what can be done and what can not be done to achieve these goals successfully.

Compare and contrast courts of first instance with the two state appellate courts.

Answers

Differences between Trial and Appellate Courts. There are three major differences between trial courts and appellate courts: (1) witnesses and exhibits, (2) judges, and (3) juries. A trial court is the court where a case starts. In the trial court, both sides present evidence to show their version of what happened.difference  

Answer:

ExplanCompare and contrast courts of first instance with the two state appellate courts. ... Most courts of first instance use a jury of citizens to determine the innocence or guilt of the defendant. In contrast, the state appellate courts (both intermediate and the state supreme court) use only judges to rule on appeals cases.

ation:

Shahid was in a serious automobile accident on a snowy evening last winter that caused him to feel anxious every time it snowed and he had to get behind the wheel. after a few months, shahid s fear of driving in the snow disappeared. to shahid s surprise, the first snowfall of the next year once again brought back his fear of driving in the snow. the return of shahid s fear can best be described by the behavioral concept of _

Answers

The correct answer is spontaneous recovery

Spontaneous recovery (SR) refers to a concept from Pavlov's theory of classical conditioning. SR is defined as a phenomenon in which a previously extinguished learned or conditioned response reemerges after a delay. In this instance, Shahid's conditioned fear response when he was driving in the snow was extinguished, but then reemerged a year later through the process of spontaneous recovery.

All these years, he thought, dreaming about a companion. now i meet one and the first thing i do is distrust her, treat her crudely and impatiently. and yet there was really nothing else he could do. he had accepted too long the proposition that he was the only normal person left. it didn't matter that she looked normal. he'd seen too many of them lying in their coma that looked as healthy as she. they weren't, though, and he knew it. the simple fact that she had been walking in the sunlight wasn't enough to tip the scales on the side of trusting acceptance. he had doubted too long. his concept of the society had become ironbound. it was almost impossible for him to believe that there were others like him. and, after the first shock had diminished, all the dogma of his long years alone had asserted itself.

Answers

You came to depend on that sort of thing. Then something occurs and all bets are off. One shocking incident and all the years of logic and acceptance are displaced and, suddenly, the jungle is in front of you again. Man, part animal, part angel. Where had he come across that phrase? He shivered. 
It was entirely an animal in that truck out there."Duel" (1971), a short story, which he later adapted into a screenplay for Duel (1971), Steven Spielberg's first feature-length film.Somewhere In Time is the story of a love which transcends time, What Dreams May Come is the story of a love which transcends death. … I feel that they represent the best writing I have done in the novel form.Introduction to an Omnibus edition of his work, as quoted in Somewhere in Time (1998), p. 318 - 319It is my conviction that basic Reality is not all that perplexing. What seems difficult to assimilate are the manifold detailsof Reality, not its fundamental elements.Introduction to The Path (1999), based on ideas presented in Thinking and Destiny (1946) by Harold W. Percival, p. 11Our world is in profound danger. Mankind must establish a set of positive values with which to secure its own survival. 

A disability often distinguishes individuals from the majority and is both internalized and outwardly stigmatizing. when experienced this way, disability is a __________.

Answers

when experienced this way, disability is a "master status".

In sociology, is the master status refers to the social position that is the essential recognizing normal for a person. The term master status is characterized as "a status that has uncommon significance for social personality, regularly molding a man's whole life."

Nick sees opal, a stranger, drowning in a pool, but does not attempt to rescue her. opal could successfully sue nick for

Answers

Opal could successfully sue Nick for Guilty of Negligence.

In the very first place,when you see a person drowning, it's in your mind to save or let them be. The person drowning may die if not saved immediately and it will be in your conscience if you were not able to save them. You know that the situation is dire but you choose nothing to do about it then maybe you'll get sued for negligence.

When james visits conferences with colleagues, he sees others who lead by shaping the vision of the group and by developing trust through quality interpersonal relationships with group members. james is intrigued by his colleagues and wants to be more like them. he wants to be a _________________ leader. democratic laissez-faire transformational authoritarian?

Answers

He wants to be a "transformational" leader.

Transformational leadership is an administration style that can rouse positive changes in the individuals who take after. Transformational pioneers are for the most part fiery, excited, and enthusiastic. Not exclusively are these pioneers concerned and associated with the procedure; they are likewise centered around helping each individual from the gathering prevail too. 

James wants to embody a leadership style that involves inspiring others and fostering trusting relationships within the group, indicating he aspires to be a transformational leader.

James is intrigued by colleagues who lead by shaping the vision of the group and developing trust through quality interpersonal relationships. He wants to be a transformational leader. This leadership style is characterized by charismatic role models who inspire and intellectually stimulate their group members while showing individualized consideration. Transformational leaders are known for changing the organization or group culture by sharing a vision that motivates others to transcend their self-interest for the benefit of the group. They contrast with democratic leaders who build consensus, laissez-faire leaders who are hands-off, and authoritarian leaders who focus on task accomplishment and rule compliance.

How can the choice to present a news story though the medium of newspaper most affect an audience's experience?

Answers

The answer is "An audience can read longer descriptions of a story participant's experience."

Newspaper advertising has been around longer than some other type of publicizing we see today is as yet the principal sort of promoting that organizations consider doing. When you take a gander at a paper, you'll see it's partitioned into segments and you can read the newspaper in detail.

Answer is an audience can read the story at their own pace

In what ways might anna's infection have played a role in her untimely death?

Answers

Ways that Anna's infection may have played into her untimely death are that the Serratia marcescens, which we distinguished as Anna's bacteria, may have caused a urinary tract disease that prompted a septic stun, which can cause numerous organs to fail functioning and demise because of extreme contamination.

Which two kinds of power have been found to be related most strongly to leader effectiveness in motivating subordinates?

Answers

These are "expert and referent power".

Referent power in authority is the capacity of a pioneer to develop the regard and deference of his supporters in such ways that they wish to resemble him. In short, referent power is showing others how it’s done. While expert power depends on workers' observation that a chief or some other individual from an association has a high state of learning or a specific arrangement of aptitudes that different representatives or individuals from the association don't have.

Select all that apply.
Three ways that unions made their opinions known were through:

-strikes
-collective bargaining
-support of labor legislation
-blacklisting

Answers

I would say that the 3 are strikes, bargaining & blacklisting.

Final answer:

Unions have historically made their opinions known through strikes, where workers stop working to demand change; collective bargaining, where unions and employers negotiate employment terms; and supporting labor legislation that protects workers' rights. Blacklisting, in contrast, is not a union tactic but an employer's reprisal against union activists.

Explanation:

Understanding Labor Union Strategies

Labor unions have historically employed several strategies to voice their opinions and bring about change in the labor market. Among these methods, strikes, collective bargaining, and the support of labor legislation have been pivotal. Strikes involved an organized stoppage of work by employees to force employers to meet demands for better working conditions or economic benefits. Collective bargaining is a negotiation process between unions and employers to reach a mutually agreeable contract. When negotiations are successful, they may result in improved terms such as wages, benefits, and working conditions. Labor unions have also played a significant role in supporting labor legislation that protects workers' rights, such as the National Labor Relations Act of 1935, which among other provisions, granted employees the right to organize and engage in collective bargaining through representatives of their own choosing.

The blacklisting of workers, however, is not a strategy used by unions; rather, it is a punitive action typically taken by employers against workers who are union activists or engage in union organizing.

Kevin is an american who is staying in a hotel in paris, france. to avoid traveler's diarrhea, kevin should add iodine drops to the water. avoid eating fresh fruits and vegetables. not be concerned because france is a low-risk country. drink only water that has been boiled.

Answers

The correct answer is not be concerned because France is a low-risk country

Traveler's diarrhea is usually caused by consuming contaminated food and water when travelling abroad. In order to avoid traveler's diarrhea, it is recommended to drink boiled water that kills any germs and other sources of contamination, and avoid eating fresh fruits and vegetables. However, this only applies to less developed and poorer countries since they are likelier to have unhygienic food and water.  

During which years did the french and indian war take place? A.) 1700-1776 B.) 1754-1763 C.) 1812-1815 D.) 1775-1780

Answers

The answer is B. The French and Indian war took place between 1754 and 1763.
B. The war started between 1754-1763




You are a psychologist interested in how groups behave. you study groups in the laboratory, at the workplace, and in informal settings. most likely, you are a ________ psychologist.

Answers

Social...psychologist.

Why is the concept of a stigma so critical to the concept of deviance?

Answers

When someone is stigmatized, it means that they are outcast by society; thus, a stigma is a social disapproval toward someone. 

When someone is described as deviant, they are seen as being outside the norm. This deviance from the norm often incites stigmatization, portraying the link between the concept of a stigma and deviance.

Research indicates that students who procrastinate:
a. suffer significantly more stress as compared to non-procrastinators.
b. develop more health problems as compared to non-procrastinators.
c. tend to earn lower grades as compared to non-procrastinators.
d. all of the above are true.

Answers

The answer is d. all of the above are true.

Procrastination is a common behavior found in students, wherein they put off studying or important school-related tasks for later occasions. Procrastination is harmful because it can lead to high levels of stress, which in turn can affect health, sleep and lead to poor eating habits. Procrastinators also receive lower grades generally since they do not end up having sufficient time to prepare for exams or complete their assignments. 

Other Questions
How do web based applications and websites differ? Describe the effects of Eastern Europes economic problems and ethnic and religious tensions What term refers to the coldest and densest zone, deep below the surface of a lake? Tyree is a skilled cyclist. when practicing on a stationary bike, his coach finds that when the women's cycling team enters the gym, his speed seems to increase significantly. tyree's increase in speed illustrates What factors are associated with recent intimate partner violence? findings from the who multi-country study on women's health and domestic violence? BY THE PRESIDENT OF THE UNITED STATES OF AMERICA. A PROCLAMATION. I, ABRAHAM LINCOLN, President of the United States of America, and Commander-in-Chief of the Army and Navy thereof, do hereby proclaim and declare that hereafter, as heretofore, the war will be prosecuted for the object of practically restoring the constitutional relation between the United States, and each of the States, and the people thereof, in which States that relation is, or may be, suspended or disturbed. That it is my purpose, upon the next meeting of Congress to again recommend the adoption of a practical measure tendering pecuniary aid to the free acceptance or rejection of all slave States, so called, the people whereof may not then be in rebellion against the United States and which States may then have voluntarily adopted, or thereafter may voluntarily adopt, immediate or gradual abolishment of slavery within their respective limits; and that the effort to colonize persons of African descent, with their consent, upon this continent, or elsewhere, with the previously obtained consent of the Governments existing there, will be continued. That on the first day of January in the year of our Lord, one thousand eight hundred and sixty-three, all persons held as slaves within any State, or designated part of a State, the people whereof shall then be in rebellion against the United States shall be then, thenceforward, and forever free; and the executive government of the United States, including the military and naval authority thereof, will recognize and maintain the freedom of such persons, and will do no act or acts to repress such persons, or any of them, in any efforts they may make for their actual freedom. That the executive will, on the first day of January aforesaid, by proclamation, designate the States, and part of States, if any, in which the people thereof respectively, shall then be in rebellion against the United States; and the fact that any State, or the people thereof shall, on that day be, in good faith represented in the Congress of the United States, by members chosen thereto, at elections wherein a majority of the qualified voters of such State shall have participated, shall, in the absence of strong countervailing testimony, be deemed conclusive evidence that such State and the people thereof, are not then in rebellion against the United States. That attention is hereby called to an Act of Congress entitled "An Act to make an additional Article of War" approved March 13, 1862, and which act is in the words and figure following: Be it enacted by the Senate and House of Representatives of the United States of America in Congress assembled, That hereafter the following shall be promulgated as an additional article of war for the government of the army of the United States, and shall be obeyed and observed as such: Article . All officers or persons in the military or naval service of the United States are prohibited from employing any of the forces under their respective commands for the purpose of returning fugitives from service or labor, who may have escaped from any persons to whom such service or labor is claimed to be due, and any officer who shall be found guilty by a court-martial of violating this article shall be dismissed from the service. SEC. 2. And be it further enacted, That this act shall take effect from and after its passage." What is the effect of the following passage on the U.S. government? ...and the executive government of the United States, including the military and naval authority thereof, will recognize and maintain the freedom of such persons, and will do no act or acts to repress such persons, or any of them, in any efforts they may make for their actual freedom.A) It intends to conscript former slaves into the military.B) It intends to prosecute former slave owners.C) It will not stop any slave from moving toward freedom.D) It will use its military and naval authority to stop the war. Which of the following words has the same root as the word biology? a zoology b geology c bibliography d biograph Which expression is equivalent to (2x^5+7x^3)-(5x^2-4x^3) What is the length of chord JK? Who was the first northern democrat elected to the presidency since 1968? determine the qotient of 7,684 and 78 Choose the sentence that best describes the history of Guatemala's capital city.The capital has always been Guatemala City.The capital has always been Antigua.The capital used to be Antigua, but is now Guatemala City.The capital used to be Guatemala City, but is now Antigua. As a healthier alternative to french fries, some fast food outlets offer pre-sliced, bagged apples as a side option. the ingredients list often reads, "apples and ascorbic acid." ascorbic acid is another name for vitaminc. what role does the ascorbic acid play in the product? ascorbic acid is a sequestrant that binds free metal ions and reduces the rancidity of fat in the apples. ascorbic acid is an antioxidant that prevents discoloration when the apples are cut and exposed to oxygen. ascorbic acid is a curing agent that prevents the growth of clostridium botulinum. ascorbic acid is a color additive that makes the color of the apples appear more vibrant. What are the causes of problems the milers and other Native American groups face in Guatemala how are people trying to solve these problems Which diagram shows the most useful positioning of a rectangle in the first quadrant of a coordinate plane? Answers are in the pictures. In an attempt to stem the rising tide of illegitimacy rates and single-parent families among the poor, which act mandated two-parent coverage for all state afdc programs? the family support act in 1988 the supplemental security income the affordable care act temporary assistance to needy families Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? view available hint(s) where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? it would not bind the target dna. ttttagccatttacgattaatcg ttttagccatttacgattaatcg ttttagccatttacgattaatcg? For the electric field shown, which of the following statements describes an increase in voltage?A) A negative charge crosses an equipotential line toward the source charge.B) You cannot tell from the information given.C) A positive charge crosses an equipotential line toward the source charge.D) A positive charge moves along an equipotential line.UPDATE: ANSWER IS C Which organisms are both secondary and tertiary consumers in the food web Laura is completing a craft project that involves covering only the lateral surface of a cylindrical container with fabric. The cylinder has a height of 16.8 in. and a radius of 14.6 in. To the nearest square unit, how much fabric does she need for this project? Use a calculator.