Why are ancient African civilizations important?

Answers

Answer 1
Final answer:

Ancient African civilizations, including Egypt, Carthage, and Axum, have greatly influenced modern society. They made substantial contributions in architecture, agriculture, technology and gave birth to elaborate trade networks. Therefore, studying these civilizations helps in understanding the origins of many contemporary practices.

Explanation:

Ancient African civilizations have crucial importance in history because they have shaped many aspects of the modern world. For starters, these civilizations, such as ancient Egypt, Carthage, and Axum, made significant contributions to areas like architecture, agriculture, and technology. These contributions hugely influenced the development of human society.

For instance, ancient Egypt is known for its impressive architectural feats, including the pyramids and the Sphinx, which demonstrate the advanced knowledge and skills that this civilization possessed. Moreover, It is also famous for its hieroglyphic writing, proving an understanding of complex record keeping and communication.

On the other hand, civilizations like Carthage and Axum were important trade centers, and they greatly contributed to the economic development and intercultural interactions between Africa and the rest of the world. Their intricate trade networks set the path for global trading systems that we know today. Thus, studying these Ancient African civilizations helps us understand the roots of many modern practices and achievements.

Learn more about Ancient African civilizations here:

https://brainly.com/question/33514407

#SPJ2

Answer 2
Final answer:

Ancient African civilizations, such as the Egyptians, Nubians, Axumites, and Carthaginians, are essential to study because they made significant contributions to culture, science, and technology that still impact modern society. They provide insight into societal evolution and function, and their study promotes a better understanding of African history, challenging mistaken racist views.

Explanation:

Ancient African civilizations are important because they made significant contributions to culture, science, and technology that affect our world today. For example, the Ancient Egyptians, one of the most well-known civilizations, gave us remarkable architectural feats such as the Great Pyramids and advancements in mathematics, astronomy, and medicine. Other civilizations like the Nubians, Axumites, and Carthaginians were respective powerhouses of trade, agriculture, and naval warfare. These civilizations influenced future empires and laid the foundations for modern society which is why understanding them is so critical.

Studying these civilizations also offers valuable insight into how societies evolve and function. It emphasizes the fact that African civilizations were as developed and influential as other ancient societies, countering racist notions of African history and civilization. Therefore, learning about ancient African civilizations is not only important for understanding historical and technological developments but also for promoting cultural diversity and equality.

Learn more about Ancient African civilizations here:

https://brainly.com/question/33514407

#SPJ2


Related Questions

who Is the ally of the American colonies in American revolution

Answers

Answer:

I Believe it was France because the primary ally for the American colonies was France. At the start of the war, France helped by providing supplies to the Continental Army such as gunpowder, cannons, clothing, and shoes. In 1778, France became an official ally of the United States through the Treaty of Alliance.

Brainliest much appreciated :-)

france is answer YAY

dvhtuilyguivtyrghuk

Was Hammurabi concerned about public opinion?

Answers

Hammurabi did not sense to show signs of concern regarding the opinions of the public in the society at the time of his rule.

Who was Hammurabi?

Hammurabi was the king of the Babylonian dynasty, who had established his reign for a period that lasted over four decades.  He was more concerned about maintaining peace in the society rather than actually implementing what the public desired.

Hence, it can be concluded that Hammurabi had no signs of concern towards the public opinion.

Learn more about Hammurabi here:

https://brainly.com/question/11688861

#SPJ2

Final answer:

Hammurabi was concerned about how he was perceived by his subjects, indicating a care for public opinion. His legal code distinguished between social classes, reflecting societal norms and reinforcing his rule as divinely sanctioned. The public display of laws and their association with gods highlight his efforts to appear as a just and pious ruler.

Explanation:

It appears that Hammurabi was indeed concerned about public opinion, or at least the perception of his rule as just and divinely sanctioned. The Code of Hammurabi, a comprehensive set of laws, was created as part of his efforts to unify his empire and establish order. This code was meticulously inscribed on stone pillars and publicly displayed for all to see, suggesting Hammurabi's desire to present himself as a just ruler and ensure that his laws were known and followed by his subjects.

The different punishments and expectations for various social classes within the code indicate a society structured on inequality, with nobles, commoners, and the enslaved receiving different treatments under the law. Such a system was reflective of the values of the time and was possibly intended to maintain the social order that was familiar to the people, legitimizing Hammurabi's rule in their eyes.

Furthermore, Hammurabi is depicted receiving his laws from the deity Shamash, which further underscores the idea that the laws were believed to be of divine origin thus reinforcing the legitimacy of his authority. This indicates a strategic engagement with public opinion, rooted in presenting the code as an extension of divine will rather than a mere human construct.

In conclusion, Hammurabi's engagement with building projects, legal codifications, and religious representation suggests he was indeed a ruler deeply concerned with his public image and the opinion of his subjects, as a means to consolidate power and ensure the smooth running of his empire.

Despite the disintegration of the Abbasid Caliphate, Islam continued to spread across Afro-Eurasia in the period 1200-1450 primarily because of which of the following?

A. The conquest of the Christian Crusader States in the Levant

B.The activities of Sufi missionaries

C.The voyages of the Muslim eunuch Zheng He

D. The translation activities of Muslim scholars

Answers

Despite the disintegration of the Abbasid Caliphate, Islam continued to spread across Afro-Eurasia in the period 1200-1450 primarily because of the activities of Sufi missionaries.

Answer: Option B

Explanation:

The activities of Sufi missionaries gained pace after the downfall of the Abbasid Caliphate. These missionaries were determined to disseminate the religion through a better understanding of the religion and by propounding that Islam is all about love and compassion.

Most Sufi missionaries took up campaigns to convert non-Muslims to Islam through non-violent means.

The answer is B. The activities of Sufi missionaries made Islam continued to spread across Afro-Eurasia.

 

 

EXPLANATION

 

Islamic missionary exertion is also known as Dakwah. Its purpose is to invite people to Islam. After the 7th century (the death of the Islamic prophet Muhammad), Islam was spread rapidly, starting from the Arabian Peninsula to the rest of the world. Islam was spread through Muslim conquest, and even by trade and exploration.

 

In 1200-1245, Islam kept being spread because of Sufi missionaries. Berke, Genghis Khan’s grandson, converted to Islam. He was one of the few Mongol rulers to eventually convert to Islam. Saif Ud-Din Dervish was the one who converted him. The Mamluk ruler Baibars converted a lot of Golden Horde Mongols to Islam.  

They played a very important role in Islam conversion. This happened because Baibars had a strong connection with the Mongols of Golden Horde. Baibars then took the Mongols od Golden Horde to Egypt, and their arrival to Egypt made a lot of them ended up accepting Islam. This has developed until three of the four khanates of the Mongol Empire became Muslim.

 

Missionaries would discover an easier passage to the lands because of the conquest of Anatolia by the Seljuk Turks. Turkic form of Shamanism was still practiced in Anatolia, before the stages of the Ottoman Empire. They then started to give in and believed in the mysticism that was offered by the Sufism. Jalal ad-Din Muhammad Rumi, the one who migrated from Khorasan to Anatolia, gave teachings that could be good examples of Sufism’s mystical aspect.

LEARN MORE

If you’re interested in learning more about this topic, we recommend you to also take a look at the following questions:

Abbasid dynasty is known for: https://brainly.com/question/4468775  

Post-partition fighting between Hindus and Muslims: https://brainly.com/question/3202077  

KEYWORD: Abbasid Caliphate, Islam, Sufi, dakwah  

Subject: History

Class: 7-9

Subchapter: Sufism

What was Rome’s relationship with france

Answers

Answer:

Julius Caesar's campaigns in Gaul (58-51 BC) are collectively termed the Gallic Wars. In 58 BC, Gallic agitation against the Suevi, a German tribe that had recently conquered territory in Gaul, and the threat of invasion by the Helvetii, a Celtic tribe from the area that is now Switzerland, gave Caesar a pretext to advance his career through war. Lack of cavalry support almost caused Caesar's defeat by the Helvetii at Bibracte, but his legions rallied and forced the Helvetii to withdraw (58). In the same year Caesar's army defeated and killed the Suevi's leader Ariovistus in Alsace after a hard campaign.

In 57, Caesar successfully met the attacks of the Gallic tribes of the Belgae and Nervii and established Roman control over what is now Belgium and northern France. The following year he conquered the Atlantic coast, thus isolating the central Gallic tribes, and massacred the German Usipites and Tencteri, who had entered Belgium. His invasions of Germany (55) and Britain (55 and 54) accomplished little but provided much publicity for Caesar.

The winter of 54 and most of 53 were spent in suppressing sporadic revolts in northern Gaul. The biggest threat came in 52 when a coalition of tribes in central Gaul under Vercingetorix (chieftain of the Averni) rose against the Romans. Caesar finally besieged Vercingetorix at Alesia. Famine overcame the defenders while Caesar's troops defeated a Gallic rear attack. Vercingetorix was brought to Rome, exhibited in Caesar's triumphal march, and executed. Serious Gallic resistance had now ended, but minor uprisings caused Caesar considerable frustration during 51 BC.

The Gallic Wars provided Caesar with wealth, a trained loyal army, and enormous popularity to use against his rivals at Rome.

Allen M. Ward, Professor of History, University of Connecticut, Storrs.

Source: The New Grolier Multimedia Encyclopedia, Release #9, ©1997

Bibliography: Caesar, Julius, The Conquest of Gaul, trans. by S. A. Hanford (1951); Gelzer, Matthias, Caesar, Politician and Statesman (1968); Holmes, T R. E., Caesar's Conquest of Gaul, 2d ed. (1911). Gaul

Gaul (from the Latin Gallia) was the ancient name for an area roughly equivalent to modern France, Belgium, Luxembourg, and Germany west of the Rhine. In Italy, the Po Valley was called Gallia Cisalpina ("Gaul this side of the Alps") by the Romans. The Celts, whom the Romans called Galli (Gauls), began to cross the Rhine into Gaul c.900 BC and by the 5th century BC had established a fairly uniform culture typified by the art of La Tene. Along the Mediterranean coast Greek civilization was introduced with the founding of Massilia (now Marseille) c.600 BC.

To protect its ally Massilia and ensure communications with Spain, Rome annexed a strip of territory between the Cevennes and the Alps in 121 BC. Roughly equivalent to the modern Provence, this became known first as Gallia Transalpina ("Gaul across the Alps") and later as Gallia Narbonensis ("Narbonese Gaul"). Julius Caesar conquered the rest of Gaul, called Comata ("Long-haired Gaul"), during his Gallic Wars (58-51 BC). Three new Roman provinces eventually emerged: Belgica, Lugdunensis, and Aquitania.

Emperor Claudius I, who was born at Lugdunum (now Lyon), admitted Gallic nobles to the Roman Senate in AD 48. He also ordered the suppression of the druids, the Celtic priests. Native deities were amalgamated with Roman counterparts, and emperor worship was encouraged. By the 4th century AD, however, Christianity predominated and weakened Celtic culture further by using Latin in worship.

In the 1st and 2d centuries AD, Gaul flourished through the export of food, wine, and pottery. In the 3d century it suffered devastating barbarian raids, however, and the Roman emperors' ineffective defense led to the creation c.260 of a short-lived kingdom of the Gauls. Beginning in 406 various Germanic tribes, especially Vandals, ravaged Gaul. The Visigoths (see Goths), nominally Roman allies, settled in Aquitaine, where they cooperated with the Roman general Flavius Aetius in the defeat (451) of the Huns. By 478 the Visigoths had also acquired Narbonensis. Meanwhile, the Franks took over northern Gaul, and the Alamani and Burgundians settled in the east. The last Roman territory in Gaul fell to Clovis, king of the Franks, in 486.

Most of the factories were located in the state of which two regions?

New England
Mid-Atlantic
Southern
Midwestern

there could be more than one!!!

Answers

Atlantic southern mid west /pacific

Answer:

Railroad

Explanation:

Answer:

Mid-Atlantic and New England

Explanation:

What year was the constitution ratified by the states

Answers

Answer:

On June 21, 1788

Explanation:

the Constitution became the official framework of the government of the United States of America when New Hampshire became the ninth of 13 states to ratify it.

The U.S. Constitution was ratified on June 21, 1788, when New Hampshire became the ninth state to approve it. The process concluded with Rhode Island's ratification on May 29, 1790. The inclusion of the Bill of Rights, ratified in 1791, addressed many concerns surrounding the Constitution's ratification.

Ratification of the U.S. Constitution

The Constitution was created on September 17, 1787, and the ratification process began shortly thereafter. The document was debated and had to be ratified by at least nine states to go into effect. Delaware was the first to ratify it on December 7, 1787. The pivotal moment in the ratification process occurred on June 21, 1788, when New Hampshire became the ninth state to ratify the Constitution, ensuring its adoption. However, the process continued until May 29, 1790, when Rhode Island, the thirteenth and final state, ratified it. This period saw heated debate between the Federalists and Anti-Federalists, with the Federalists' most notable contributions being The Federalist Papers, which argued for the Constitution's adoption.

Ultimately, the Constitution went into effect when the eleventh state ratified it—a condition set by a resolution passed by the Continental Congress on September 13, 1788. The Bill of Rights was added and ratified on December 15, 1791, to address concerns raised during the ratification debates.

9. What are the Four Noble Truths

Answers

Answer:

Suffering, The Cause of Suffering, The End of Suffering, and The Path

Explanation:

The Four Noble Truths comprise, or consist of, the essence of Buddha's teachings. Suffering exists; it has a cause; it has an end; and it has a cause to bring about its end.

They are the truth of suffering, the truth of the cause of suffering, the truth of the end of suffering, and the truth of the path that leads to the end of suffering.

Where were the first true slave societies in world history?
Angola and Kongo
Colonial America
Greece and Rome
Songhai and Mali

Answers

Answer:

Greece and Rome

Greece and Rome, were the first true slave societies in world history. Thus, option (c) is correct.

What is slave?

The term “slave” refers to someone who is under the work, ownership, and control of another. The slave also called it “slavery.” The person is entirely dependent on a powerful person, such as a landlord. There are several types of slavery, including personal property slavery, forced labor, and sexual slavery.

According to the slave societies in the ancient period of the time. There are the two places in they justify the world history are the Greece and Rome. During the period of the 4th and the 6th centuries. On the other hand, Rome was the 30 % in the slave population.

As a result, the Greece and Rome, were the first true slave societies in world history. Therefore, option (c) is correct.

Learn more about on slave, here:

https://brainly.com/question/17214427

#SPJ2

elvaluate the expression.
9!/3!
a) 3
b) 6
c) 60,480
d) 362,874​

Answers

Answer:

The Answer Is A) 3

Explanation:

During the early 1800s, what factor most contributed to the South having an agricultural
economy?
The South was too hot for factories.
The South had fertile soil and a warm climate.
The South had cheap land.
The South had a large concentration of skilled labor.

Answers

Answer:

The correct answer is B. The south had fertile soil and a warm climate.

Answer:

The South had fertile soil and a warm climate

Explanation:

During the early 1800s, two factors contributed the most with the profitability of large-scale farms in the South: the temperate climate and the productive soil of the region, that produced tobacco and cotton. As a result, industrialization fell into the background as the agriculture economy was so prosperous.

Which of the following ideas was Bush attempting to express in his speech?

Check all of the boxes that apply.

justice

hatred

patriotism

cooperation

discrimination

Answers

Answer:

Justice, Patriotism and Cooperation

Explanation:

Answer:

The Correct Answer is

Justice , patriotism and cooperation

Explanation:

The Bush Doctrine believes that rivals of the United States practice terrorism as a weapon or Ideology of war against the country. The responsibility of the United States is to defend itself by supporting democracy where the terrorists are positioned to weaken the basis for terrorist movements.Bush promotes the privatization of Social Security by enabling people to set up private retirement accounts. In his speeches also encouraged the development of Medicare to incorporate prescription medicines utilizing private insurance through his Medicare program.

which group attended sporting events at the turn of the 20th century apex

Answers

Answer:

At the turn of the century, sporting events were attended by people of all social classes. These events became popular because people had more free time and needed a way to relax.

Answer:

The group that participated in sporting events at the turn of the twentieth century was a group of men, women, children, and anyone interested in sports.

Explanation:

At the height of the twentieth century, the practice of sports became very popular and many people were interested in some sport. As the twentieth century was a more modern and inclusive century, there were no restrictions when playing men-only sports where neither women nor children could participate. At the height of the twentieth century, anyone with an interest could choose the sport that they liked best and participate in it. For this reason, we can say that the group that participated in sporting events at the turn of the twentieth century was a group of men, women and children.

NEED THIS ASP


On a typical day, Juan spends seven hours in school and two hours doing homework. He sleeps about eight hours each night and has about three hours of leisure time. The other four hours he spends doing chores, eating, and working.

In a typical day, how do you spend your time? Write a short paragraph that describes your schedule.

Answers

Answer:

16

Explanation:

because you just add them up :/

Answer:

Lately, I have been waking up at the dawn of the day, to go to the gym. After, finishing exercising, I go home and take a shower. When done, I eat and get ready to study. Finally having done with all my work, I either watch TV, or play games before hitting the hay.

Explanation:

Thomas Jefferson played a significant role in the Revolutionary War because he did what?

Answers

Final answer:

Thomas Jefferson played a significant role in the Revolutionary War by drafting the Declaration of Independence.

Explanation:

Thomas Jefferson played a significant role in the Revolutionary War by drafting the Declaration of Independence. He is considered the author of this historic document, which declared the American colonies' intention to break away from British rule and establish their own independent nation. Jefferson's role in drafting the Declaration of Independence showcases his contributions to the Revolutionary War and his commitment to the cause of liberty and self-governance.

98 Points plz answer fast) Using the map above, what number is on the state with the capital city of Juneau?

Answers

number 49 - juneau is the capital of alaska

Hey!

-----------------------------------------------------

Answer:

49

-----------------------------------------------------

Facts:

The capital of Alaska is Juneau!

Alaska used to be part of Russia until the USA bought it for $7.2 million.

-----------------------------------------------------

Hope This Helped! Good Luck!

Multiply.

​ 16⋅34 ​

Express your answer in simplest form.

 

A) 16

B)410

C)310

18


Answers

Answer:

Well the answer is actually 544. 16 x 34 = 544. If there is more the problem, please write. None of your answers or you question makes sense. The only one that MIGHT make sense is A) 16. This is because 544/34 = 16, a factor you started with. Hope this helps please mark brainliest I would really appreciate it. :)

PLEASE HLEP ASAP I WILL GOVE U 50POINTS

Answers

The answer is H and I.

Answer:

i did this and the person was correct

Explanation:

solve for c :

c + 8 = -11

c= ______​

Answers

Answer: c=19

Explanation:

You can add anything to both sides of the equation as long as they are equal. Like a balance.

C + 8 = - 11

Subtract 8 from both sides

C + 8 - 8 = - 11 - 8

C = -19

Does that help?

Why should goals be set for a group discussion?

Answers

Goal should be set for a group discussion to put in consideration of your fellow peers examples and answers for the same question. If goals are set for a group discussion, you have something to work for in a period of time should I be sidetracked and ready for the next group discussion.

In what year did the Mexican Revolution against Porfirio Diaz begin?

Answers

The Mexican Revolution started in 1910, when liberals and intellectuals began to challenge the regime of dictator Porfirio Díaz

Answer:

1910

Explanation:

The Revolution began on November 20, 1910, as many factions in Mexico joined the call to arms of Madero, after the old Porfirio decided to reelect and dishonor his word of leaving the Presidency.

The call to arms on 20th November 1910 meant to overthrow the old system that Porfirio Díaz had led.

An industrial and modernized country did not obtain the promises of modernity and a great social disparity turned into social unrest.

The movement that started in 1910, ended dictatorship in Mexico and a constitutional republic that incorporated social and political reforms.

Francisco Madero, Pascual Orozco, Pancho Villa and Emiliano Zapata, were among the caudillos who fought long to create better conditions, yet in the aftermath, their differences would turn into divisions that would delay the conflict into civil war.

After 10 years Mexican government acknowledged the labor unions and peasants organizations, among many other banners that caused the war.

How did World War I change the lives of American women

Answers

Answer:

They became more independent and started getting rights

World War I changed the lives of women in America by allowing them to work in various employments.

What was the WWI?

WWI was started after the murder of Ferdinand in the year 1914 and ended in the year 1918.

During WWI, the women were allowed to take up the employment being left by the men due to war. They were shifted to many professions like teaching, tailoring, clerical works, official duties, etc. More than two million women were working in the employment sector in the era of WWI.

Therefore, the increase in employment for American women transformed their lives drastically during WWI.

Learn more about the WWI in the related link:

https://brainly.com/question/1449762

#SPJ1

which part of the world during the early modern era (1400-1750) experienced the most dramatic transformation? Europe, Asia, Africa, or the Americas?

Answers

Answer:

The Americas suffered the most dramatic transformation due to the arrival of the Europeans, mainly Spain and Britain.

Explanation:

While all continents went through a process of transformation during the early modern era, it was the Americas who suffered the greatest changes.  The arrival of Europeans in the 16th and 17th centuries caused radical transformations in the way people lived.  The British wiped out most of the native population in North America, while the Spanish imposed a whole new way of life on the indigenous communities, changing their language, religion, traditions, food, and customs.

After the arrival of the Europeans, life for the original inhabitants of the Americas would never be the same.

How are John Locke’s ideas reflected in American government?

A.The powers of government are divided among its branches

B.The government is responsible for ensuring life,liberty, and property

C. All government power resets with the people

D. In a social contract, some freedom must be abandoned for the good of all

Answers

Answer: B. the government is responsible for ensuring life, liberty, and property

Explanation: Locke identified the basis of a legitimate government.  He believed a ruler gains authority through the consent of the governed. He wanted to include life, liberty, and property.

Which statement about cowboy life is true? Hard-working Chinese tracklayers were treated with new respect by their supervisors The railroad opened new markets for trade, and spurred the creation of time zones. Native Americans were eager to use the railroads for travel. Tracklayers received a lot of money and health benefits for their efforts.

Answers

Answer:

opened new markets for trade and spurred the creation of timezones

Daniel Webster was an outspoken advocate of states' rights.

True
False

Answers

Answer: false

Explanation:

trust me that's the correct answer

The 14 amendment clause means that

Answers

14th Amendment to the U.S. Constitution. ... In addition, it forbids states from denying any person "life, liberty or property, without due process of law" or to "deny to any person within its jurisdiction the equal protection of the laws

Answer:

The 14th Amendment contained three major provisions: The Citizenship Clause granted citizenship to All persons born or naturalized in the United States. The Due Process Clause declared that states may not deny any person "life, liberty or property, without due process of law."

HOPE THIS HELPED!!!!!!!! XDDDDD

Why is it important to include a works-cited list in a historical essay?
O
A. To grab the reader's attention and keep him or her reading
O
B. To make sure your evidence clearly supports your thesis
O
c. To avoid the need to include any direct quotations
O
D. To show your reader where your evidence comes from

Answers

Answer:

D

Explanation:

You don't want to plagiarize or take someone else's work and call it your own. Also, the reader can check your facts and see how true it is

Final answer:

Including a works-cited list in a historical essay allows the reader to know where your evidence comes from, furthers the reader’s potential research, and gives credit to the authors you referenced.

Explanation:

It is crucial to include a works-cited list in a historical essay primarily for reason D: to show your reader where your evidence comes from. When writing an essay, particularly a historical essay, you often reference data and insights from different sources. Including a works-cited list not only demonstrates your academic honesty, but also allows the reader to trace your research path, providing them with the means to delve deeper into the topics that interest them. It's also a way to give credit to the authors whose work has contributed to your research. It's a crucial part of ethical writing standards which help to avoid plagiarism.

Learn more about Works-Cited List

https://brainly.com/question/30586182

#SPJ3

A written constitution is important to citizens because-

Answers

Answer:

A written constitution is important because it binds down rulers or people that have power, and stops them from creating unjust laws and policies. (it guarantees safety and fairness)

which of the following was the most important reason native americans relations with english settlers differed from native americans relations with other groups of europeans settlers in the 1600s
A. Larger numbers on English colonists settled on Land taken from native Americans
B. English settlers were technologically more advanced than other European settlers
C.native Americans understood the English language better than other European languages
D. English colonization along the eastern seaboard provided fewer opportunities for conflict between the two sides then colonization in the interior.

Answers

Answer:

A. Large numbers of English colonists settled on land taken from the Native Americans.

Explanation:

The way in which different European colonists interacted with the Native Americans marked the future of the relationships between these groups.  French settlers had a more peaceful interaction and did not take over land occupied by native groups.  The English, however, did invade territories where Native Americans lived and had a much more violent way of treating them.

Which two statements best show the effect of the Congress of Vienna on Europe?
It resulted in an agreement to suppress nationalism.
It helped Britain gain control over France.
It led to a decrease in the number of republics.
It caused frequent revolts in Latin American countries.

Answers

Answer:

It led to a decrease in the number of republics.

It resulted in an agreement to suppress nationalism.

Explanation:

At the Vienna Congress, an attempt was made to restore the world order that existed before the French Revolution of 1789. In Europe, the balance was restored between the five major powers - France, England, Prussia, Russia, and Austria. It opposed revolutionary movements, contributed to weakening the forces of nationalism, and uphold the balance of power

On June 9, 1815, the General Act of the Congress of Vienna was signed.

As a result, the following decisions were made:

- The Kingdom of Poland became part of the Russian Empire.

- Holland and Belgium united and formed the United Kingdom of the Netherlands with the accession of Luxembourg.

- In Northern Italy, Lombardy and Venice united in the Lombardo-Venetian kingdom, which was controlled by Austria.

- The British returned the previously lost colonies and confirmed their right to own Malta.

- France remained within the borders of 1792, and occupation troops were stationed on its territory; the Bourbon dynasty was restored on the French throne.

- The Pope again restored power over the Vatican and the Papal region.

- The German Confederation was formed.

- Denmark, which was an ally of France, lost Norway, which was transferred to Sweden.

 

As a result of the congress, the Vienna system of international relations was formed, and the Holy Alliance of European States was created with the goal of ensuring the inviolability of European monarchies.

Answer:

1 and 3

Explanation:

Other Questions
Dr. Han is studying which brain structure is associated with aggressive behavior among rats. Which part of the brain is she likely to see activated when using neuroimaging techniques? Please i need big helpChoose the adjective clause in the following sentence: The jeans that I want to buy are very expensive.to buyare very expensivethe jeans thatthat I want to buyI want True or false tasks are required activities that need to take place in order to complete a goal Two train whistles have identical frequencies of 175 Hz. When one train is at rest in the station and the other is moving nearby, a commuter standing on the station platform hears beats with a frequency of 4.05 beats/s when the whistles operate together. What are the two possible speeds and directions the moving train can have? slower speed m/s Correct: Your answer is correct. faster speed m/s Changed: Your submitted answer was incorrect. Your current answer has not been submitted. The processivity of a DNA polymerase depends on all of the following actions, EXCEPT for __________. A. association of the DNA polymerase with a sliding clamp (like eukaryotic PCNA) B. interaction between the thumb domain of DNA polymerase and the DNA C. interaction between the minor groove of DNA and the palm domain of the DNA polymerase D. loss of the hydrogen from the 3-OH of the primer due to interaction with a divalent metal ion associated with the palm domain of the DNA polymerase the romans introduced and estabished a common system of written laws why was that important The economy of early villages and cities was based mainly on What is the solution to 4x+5y=12x6y=22 Edouard Daladier became Prime Minister of which country in 1933? A __________ is a wide-mouthed body of water close to shore. Cusic Industries had the following operating results for 2019: sales = $34,621; cost of goods sold = $24,359; depreciation expense = $6,027; interest expense = $2,725; dividends paid = $2,023. At the beginning of the year, net fixed assets were $19,970, current assets were $7,075, and current liabilities were $4,010. At the end of the year, net fixed assets were $24,529, current assets were $8,702, and current liabilities were $4,700. The tax rate was 25 percent. a. What is net income for 2019? (Do not round intermediate calculations.) b. What is the operating cash flow for 2019? (Do not round intermediate calculations.) c. What is the cash flow from assets for 2019? (A negative answer should be indicated by a minus sign. Do not round intermediate calculations.) d-1. If no new debt was issued during the year, what is the cash flow to creditors? (Do not round intermediate calculations.) d-2. If no new debt was issued during the year, what is the cash flow to stockholders? (A negative answer should be indicated by a minus sign. Do not round intermediate calculations.) Evaluate M2/P2 for M = 10, N = -5, and P = -2? A.-5 B.5 C.-25 D.25 Read the sentences. Sentence 1: I hope the dinner comes out perfectly, but even if it doesnt, Im pretty sure theyll know how hard I tried. Sentence 2: Then well have coffee cake for dessert, which I made from scratch. Sentence 3: I am making my sisters favorite: roasted chicken, brown rice, and brussels sprouts. Sentence 4: I cannot wait to cook dinner for my family tonight. What is the most logical sequence for these sentences in a story? 1, 3, 2, 4 4, 1, 3, 2 4, 3, 2, 1 3, 2, 1, 4 An RNA virus that infects plant cells is copied into a DNA molecule after it enters the plant cell. What would be the sequence of bases in the first strand of DNA made complementary to the section of viral RNA shown here? 5' CCCUUGGAACUACAAAGCCGAGAUUAA 3' Reasoning if you multiply two decimals that are less than 1,can you predict whether the product will be less thanor greater than either of the factors? Explain What is the greatest common factor of 19 and 18? What happened as a result of the Sand Creek Massacre? Please select the word from the list that best fits the definition Likes to study with music in the background Which function has the given graph? Consider a river flowing toward a lake at an average velocity of 3 m/s at a rate of 500m3/sat a location 90 m above the lake surface. Determine the total mechanical energy of the river water per unit mass and the power generation potential of the entire river at that location.