Why did many reformers want to improve education in the United States in the early 1800s? A. American democracy needed educated citizens. B. New factories required educated, highly skilled workers. C. Higher standards would attract wealthy, foreign students. D. Educated women could run for public office.

Answers

Answer 1
I think the answer is A. American democracy is needed to educated citizens. Because the American democracy is needed to educated citizens to many reformers wanted to improve education in the early 1800s.

Answer will be bolded.

Hope it helped
Answer 2

Answer:

A

Explanation:


Related Questions

Why did the ancient Greeks celebrate the Olympic games?


to train warriors


to honor Zeus


to prevent warfare


to forge alliances

Answers

To Honor Zeus Their god

why would leaders in Iran want to limit American cultural infusion?

american corporations would become to powerful

Iran is to poor to support a great american cultural infusion.

american ideas conflict with traditional iranian ideas.

american culture is too religious,

Answers

Iranian leaders do not like American culture with its excess and what would be considered loose morals in that part of the world. Many Americans drink alcohol, which is not acceptable in Iranian society. Women dress immodestly, tattoos and piercings are acceptable in most of America, and sexual relations are less restricted. Americans tend to spend excessively, which would be difficult for a poor country like Iran. America's religion is very different from Iranian religion.

The correct answer is C) American ideas conflict with traditional Iranian ideas.

Leaders in Iran want to limit American cultural infusion because American ideas conflict with traditional Iranian ideas.

Iran is a very conservative country. People from Iran are Muslims, they practice the strict teachings of Islam. They have to follow strict rules on how to pray and how many times they have to pray during the day, they have to fast during the Ramadan, women had to cover their heads and dress conservatively, among many other things. American ideas are more liberal, women are free to do and act as they want, citizens are free to do what they want legally and under the laws of the Constitution. So there are many cultural differences between the two countries.

Who is represented in the electoral college?

Answers

hi!

The Electoral College consists of 538 electors. A majority of 270 electoral votes is required to elect the President. Your state's entitled allotment of electors equals the number of members in its Congressional delegation: one for each member in the House of Representatives plus two for your Senators.

hope this helped!

Answer:

the 50 states and the district of Columbia

Explanation:

Who is represented in the electoral college?

 

the House of Representatives and the Senate

***the 50 states and the District of Columbia

supporters of candidates from each party

the three branches of government


"In mid-2007, Venezuelan President Hugo Chavez fined and arrested news journalists who were critical of his government. Later that year he ordered history books re-written to include thoughts and interpretations that met with his approval."

This passage is an example of Chavez' power as
A) an author.
B) a Democrat.
C) an autocrat.
D) a legislator.

Answers

C) an autocrat is the answer


The correct answer is C. An autocrat.

Explanation

Autocracy is a type of government whose highest law is the will of a single individual. In an autocracy, a person holds all the power. This term can also be used when referring to a group of subjects who exercise power without limitations or regulations. According to the foregoing, Venezuelan President Hugo Chavez, when he manipulated the history books with thoughts that were from his line of thought and confronted journalists who criticized his government by taking them to jail and fining them, acted autocratically due to who wielded all power without limits. So, the correct answer is C. An autocrat.

the type of leader who came to power in greece around 600 b c was...?


Answer choices:
an ephor
a democrat
a tyrant
an oligarch,

Answers

The leader that came to Greece around that time was a tyrant. This type of leader usually came from an aristocratic background. These rulers were cruel to their people and oppressive. Thrasybulus of Miletus was one of the most famous tyrants.

What music festival is said to have begun the “summer of Love”

Answers

the montery pop festivle is the correct answer

i believe the monterrey pop festival? 

"in states without a lieutenant governor, who is usually next in succession to the governor's office?"

Answers

The correct answer is the leader of the state senate.

They are people who are basically second in command to the official governor. It's something like a vice president is to a president. If the governor dies then the lieutenant governor takes their position, and if the lieutenant governor dies, then the leader of the senate for that state takes it. This is common and is found in almost all states.

Answer:

Etheir the Secretary of the State or the President Pro Tempore of the senate

Explanation:

Which occurs during disequilibrium? Check all that apply.

1.Supply and demand meet.
2.Supply is less than demand.
3.Supply and demand set prices.
4.Supply is greater than demand.
5.Supply and demand set production.

I put 2 and 4, are those right?

Answers

During desequilibrium supply is less than demand or supply is greater than demand.

The market is experiencing a disequilibrium  when the market price is above or below the equilibrium price, so disequilibrium refers to the moment when the quantity of supply does not equal the quantity of demand. So that, during disequilibrium supply is less than demand, which would result in shortage or supply is greater than demand as well and would lead to surplus.

So, option 2 and 4 are the correct ones.

Answer: Supply is less than demand, Supply is greater than demand

Explanation:

I need the answer to those three questions . Please help .

Answers

A on the first one
Number two is C
The third one is D
The last one is D

"which american reform movement is william lloyd garrison most closely associated with"

Answers

I believe that the answer would be the issue of slavery he was an avid supporter of the north during the war.

Answer:

Abolition movement

What contributed to the postwar construction boom?

A. Prices for labor and material were high.
B. Builders lacked mass-production techniques.
C. The wide availability of low cost mortgages for African Americans.
D. Few houses were built during the Great Depression.

Answers

The correct answer is D.

The first two statements represent factors that would cause construction of homes to decrease, not increase.

Statement C is also incorrect because many African-Americans were denied mortgages after World War II. Banks would refuse to give low cost mortgages to African-Americans even though they served in the US military. Along with this, African-Americans were also excluded from many suburban neighborhoods, showing that they were not the target audience of this construction boom.

This shows that D is the correct answer. This makes sense, as the Great Depression was an era in which hundreds of thousands of Americans became homeless and could not afford to buy a new house. Since not many people were able to afford new homes, they were not built.

Answer:

D

Explanation:

Most colonists liked being British citizens, until the government in England pushed them too far. Which of these are reasons the colonists were angry with Britain?

Answers

You didn't provide any reasons so it's hard to pick a specific answer. However, the reason why the colonists were extremely angry with Great Britain were the imposing of all these unnecessary taxes. There was the Tea Act, the Stamp Act, etc. All of these taxes were what drove the colonists crazy.

When social classes are separated into three groups, they are the:
_____ class
_____ class
_____ class

Please help!!!!,

Answers

The three social classes are the lower class, middle class and the upper class. They are in hierarchy in terms of money income, quality of education and having a stable job or work.

Final answer:

Social classes when categorized into three groups comprise the upper class, middle class, and lower class. These classes reflect differences in wealth, power, occupation, and lifestyle, significantly affecting individuals' opportunities and quality of life.

Explanation:

When social classes are separated into three groups, they are the: upper class, middle class, and lower class. The upper class consists of wealthy and powerful individuals or families who own and control the means of production and represent a small percentage of the population but a significant portion of wealth. The middle class is the broadest group, encompassing professional workers, small business owners, and low-level managers, often referred to as "white collar" workers. The lower class includes individuals working wage jobs ("blue collar" workers), with less economic security, as well as unemployed or homeless individuals.

Social mobility describes the ability to move between these classes, influenced by factors like education, occupation, and income. Class traits, also known as class markers, distinguish the behaviors, customs, and norms defining each class. Social class impacts various life aspects, including educational and professional opportunities, healthcare access, and housing.

what did nixon predict would happen in the south if the u.s withdrew from vietnam

Answers

Nixon administration in the paris peace accord predicted an endless war in south Vietnam. a few years after the withdrawal, the war did not stop, but Saigoi also fell to communist forces.

How did the achievements of the Han dynasty affect later generations of Chinese people, as well as other people?

Answers

The Han dynasty spans from 206 BCE to 220 CE. It is regarded by scholars as one of the greatest dynasties of the China Empire. Its achievements span virtually every field. From the creation of irrigation and water conservation projects to the invention of paper, the contribution to humanity of the Han Dynasty is enormous. These achievements affected Chinese and other people by creating a culture so vast and ancient that still resonates today.   

Answer:

The Han dynasty spans from 206 BCE to 220 CE. It is regarded by scholars as one of the greatest dynasties of the China Empire. Its achievements span virtually every field. From the creation of irrigation and water conservation projects to the invention of paper, the contribution to humanity of the Han Dynasty is enormous. These achievements affected Chinese and other people by creating a culture so vast and ancient that still resonates today.  

Explanation: im taking the quiz right now on my zoom.

The Zulus were located primarily in

Crimea

South Africa

India

Sudan

Answers

The Zulus were primarily located in what is now known to be South Africa.

South Africa

Hope this helps

Why do you think we learn about violent events ion history like the Nazi movement? How is this different from watching violent stories on TV?

Answers

We learn about violent events like the Nazi movement in order to understand what happened, why it happened, and how to not let it happen again. It is clear that the Nazi movement was an awful series of events in world history. The millions of innocent citizens murdered by the Nazi's during World War II was unprecedented. However, if we never learn about events like this and why they happened, we would never be able to learn how to prevent them from happening again.

Ultimately, learning about this movement is much different than watching violent stories on TV. The stories on TV are often fictionalized or including elements of acting. However, the Nazi movement resulted in the deaths of real people in cruel and unusual ways.

Why did congress pass the voting rights act of 1965?

Answers

It was passed in order to prevent racist people from southern states from banning African-Americans from voting. They had things like literacy tests or vote taxes or similar things that would pose a problem for African-Americans of the time and all these types of laws became prohibited and were declared unconstitutional by the congress.
Final answer:

The Voting Rights Act of 1965 was passed by Congress to counteract continuous attempts at disenfranchising African American voters. It prohibited laws discriminating against voters based on race and expedited voter registration for African Americans. However, its effectiveness was reduced following the 2013 Supreme Court ruling in Shelby County v. Holder.

Explanation:

Congress passed the Voting Rights Act of 1965 as a response to ongoing attempts at African American disenfranchisement during the civil rights struggle of the 1960s. This act aimed to clear hurdles for African American voters by prohibiting states and local governments from passing laws that discriminated against voters based on race. It essentially outlawed literacy tests and other barriers that predominantly kept ethnic minorities from voting. This act also granted the U.S. attorney general the power to dispatch federal examiners to regions with a history of discrimination to oversee and supervise voter registration and elections. Nonetheless, the effectiveness of this act was significantly reduced after the Supreme Court ruling in Shelby County v. Holder (2013), which removed key provisions of the VRA, pushing control for election policy to the state and local level.

Learn more about Voting Rights Act of 1965 here:

https://brainly.com/question/17064307

#SPJ12

In late 18th century america, the second great awakening was a period of what?\

Answers

Christian renewal movement

Answer:

The Cristian renewal movement

(I promise i didn´t copy)

FLVS lesson 5.06 Friend or Foe, Mexico. Is there a better assessment for this lesson than the one provided in the FLVS course? I'm looking for an alternative assessment.

Answers

no there is not I have tried to find a better one

Smh i wish but no there isnt but what history teacher do you have assigned ?

According to president Truman, for what reason was the atomic bomb used on Japan?

Answers

Germans were already defeated, so this only left Japan. Truman knew that if we kept fighting that there will be lots and lots of casualties. So Truman had no choice but to make the difficult decision on dropping the bomb on Nagasaki and Hiroshima. So to sum it up the reason was to prevent any more casualties and to end the war. 

To end the war once and for all. An invasion of Japan would’ve led to millions more killed and Truman felt the a bomb was the best option to avert that

In this type of government, political and governmental power is held by the citizens of the country

Answers

Democracy--a democracy in its true form is a government with control of and by the people. 

There are different forms of democracy and like many forms of government the true form rarely exists in a state. The US is a democratic republic where the people have a say through representation in Congress. There is also socialist democracies in which the people have a say (often through representation) but also the government controls means of production. This form is a blend of democracy and socialism. 

What did Charlemagne territory cover

Answers

Charlemagne went to his aid in Rome and defeated the rebellion, it legitimised his rule over his Italian territories and attempted to revive the imperial.

What is an exception to the general idea that markets lead to an efficient allocation of resources?


perfect competition

black market

imperfect competition

unfair competition

Answers

imperfect competition is your correct answer

The correct answer choice is:


Imperfect competition


In economics, imperfect competition may be a form of market structure showing only few options of competitive markets. Varieties of imperfect competition include: monopolistic competition: A state of affairs during which several companies with slightly or totally different product contend.

What was the most important effect of the hundred years' war?

Answers

War stimulated technological experimentation: artillery. Cannons revolutionized warfare, strengthened the military power of the national states.

I have a Brainliest reward

Answers

B. is run by a bourd of directors

Why is a financial system necessary for business?

Answers

it is necessery because people need help though this is unrealated.
Final answer:

A financial system is crucial for business as it facilitates the efficient allocation of resources, promoting economic growth and stability. It acts as a bridge connecting savers and borrowers, ensuring that investments are directed towards productive avenues. This system ensures the continuity of financial transactions which is vital for the sustainable development of businesses.

Explanation:

Why is a Financial System Necessary for Business?

The essence of a financial system lies in its ability to facilitate economic activities by connecting savers, investors, and borrowers. It serves as the bedrock for economic growth, ensuring that financial resources are allocated efficiently to where they are most needed. This allocation supports a variety of purposes, from personal investments like buying homes and paying for education, to business expansions through the acquisition of equipment, building additional facilities, and hiring employees.

A stable and secure financial system is pivotal not only for the protection of individual savings but also for the sustainability of the financial system itself. The significance of such stability was highlighted during the 2008-2009 financial crisis when disruptions in financial services underscored the vulnerabilities in the financial infrastructure. During such crises, the ability to access funds, obtain financing, and conduct ordinary business transactions can be severely hindered, underscoring the importance of a robust financial system.

In essence, the financial system plays a dual role; it stimulates economic growth by directing savings towards productive investments and ensures smooth operational continuity of financial transactions. This symbiotic relationship between savings and investments is fundamental for achieving economic objectives, which in turn bolsters business development and growth. Without a functional financial system, the economy could stagnate, leading to recession or prolonged inflation, emphasizing the role of institutions like the Federal Reserve in maintaining the integrity of the financial system.

Who did the states' rights party nominate for president in 1948? select one:
a. george wallace
b. strom thurmond
c. henry wallace
d. joe mccarthy?

Answers

The correct answer is B. Storm Thurmond.

Storm Thurmond was a great choice for this particular party, as he represented the discontent Southerners had with president Truman. Thurmond, a South Carolina governor, did not like Truman's national policies that forced social changes in the South. Thurmond though that issues such as civil rights legislation should be determined by states on an individual basis. Outside of the South, he did not have much success in the 1948 election.

Media is one means of influencing public opinion. What are other constructive ways for you to form your own opinion on an issue? Select all that apply.
A. Discuss with your parents their opinions and how they formed them
B. Listen to a wide variety of television and radio news
C. Pick a topic and research it in a variety of media outlets
D. Volunteer at political rallies and events
E. Attend city council hearings and other civic events in your area

Answers

Hey there!

I think A, D & E

Hope this helps you!

Always remember, you are a Work Of Art!
- Nicole <3 :)

In my view, all alternatives contribute to the formation of opinion on some subject.


To get an opinion on a subject, first of all, you need to read and be informed. In this sense, research in the media (C), news (B) are the beginning, where you get integrated on the subject. After absorbing the initial knowledge, democratic debate on the subject can enrich their knowledge and it can be done through conversations with your parents (A), in political rallies (D), since politics is usually the place for talk about ideas. Finally, attending hearings and other civic events (E) also contribute, since in these locations you can watch specialists debating the subjetcs.

What were the four underlying causes of world war i? describe how each cause led to unrest in europe and the middle east?

Answers

One way to remember the FOUR main causes of World War I is to remember the acronym M – A – I – N. (M = Militarism, A = Alliances, I = Imperialism, and N = Nationalism.) MILITARISM was one of the four major causes of the war. It was an “arms race.” Because Britain had a large navy, Germany wanted a large navy too.
Other Questions
14) Which BEST describes the way the Fourteenth Amendment affected the states?A)States had to give all citizens, regardless of their race or religion, equal protection under the law.B)States could no longer make any laws that were not approved by the federal government.C)States had to pass laws that gave more rights to freed slaves than to other citizens.D)States could no longer institute poll taxes or tests for citizens before they voted.2) The term "Reconstruction" in United States history refers to the period after what event?A)the Civil WarB)the Revolutionary WarC)the Constitutional ConventionD)the Declaration of Independence The major problem with hydrogen as an alternative source of energy is that none exists on the surface of the earth. a. True b. False Analyze the following statement: Marcus notices that he runs faster in the mornings rather than the evenings. Is the statement an example of correlation or causation? A. Correlation, because time of day doesn't cause a person to run faster or slower B. Causation, because Marcus has noticed this over several trials C. No relationship, because time of day has nothing to do with how fast a person runs D.There is not enough information to make a conclusion Which head glands secrete sucrase, lipase, amylase, and invertase? What is the measure of an angle that turns through 3/4 of a complete circle What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatctcatccagcattctgaaagggtaatgaataattattccgctgagttcatgaggtatccgaaggaggagcaacacttaggctataagagtatcatgcacatagatcgggataaatcgcctatcatatgtgacaacaatttcatgattaaaagt code for? Which is a pro-election of federal judges argument?A. When judges are elected they can be biased by party politics. B. When judges are elected there they can focus more time on reviewing law.C. Judges are more accountable to the people and what they think is just when they are elected Which statement displays an effect of developing a successful atomic bomb? Question 11 options: A.encouraged private sector employees to not share their discoveries with the government B.was the final time that the government and private sector combined to form any great invention C.served as a model for future government or private research and development labs to create innovationsD.proved that military innovation is always ahead of private innovation the graph shows the percentage of dog breeds affected by elbow dysplasia, which causes dogs to limp. What???s the most likely explanation for the mixed breed???s disease incidence? The probability is 0.2 that a person shopping at a certain store will What is the differecne of the following polynomials? (6x^2 - 3x^3) - (2x^3 + 4x^2 -5) Congratulations As you know, the position for which you are applying requires superlative problem-solving skills in a variety of arenas, and the ability to think critically on the fly is essential. To evaluate your ability in this area, the practical portion of the interview process consists of a series of locked-room puzzles. You will need to use all of your ingenuity to find the key to unlocking each room. There are six rooms total; four of the rooms will have individual time limits, while the remaining two rooms will be untimed. You will be observed by the interview team from a remote location, and your progress through the rooms will be recorded. For which type of communication would this paragraph be used?A)casual noteB)informal emailC)formal business If 1495 J of heat is needed to raise the temperature of a 337 g sample of a metal from 55.0C to 66.0C, what is the specific heat capacity of the metal? Evaluate the expression when a=15 and b=5. b2 ------------ = a + 5Help Do you think that humans and humpback whales share a common evolutionary lineage? Help Im really stuck and need help fastttttttt!!!!!!!? which is an example of circadian rhythm in plants? Which of the following bodies of water is located between the countries of Malaysia and Indonesia and connects the Pacific Ocean to the east with the Indian Ocean to the west? Bodies of Water in Eastern Asia (Points : 1) The Strait of Sunda The Strait of Malacca The Makassar Strait The Java Sea, Who ran as a third party candidate in the 1968 presidential election answer.com\? The Sixth Amendment states that in criminal prosecutions, people have the right to speedy trial with a