Why is it important to keep your hands higher than your elbows when performing a surgical scrub?

Answers

Answer 1
To prevent H20 from contaminating the washed area, as the water runs off the elbow rather than the hands that will be used in the surgery

Related Questions

When you have good ________, you are able to flex, extend, and rotate your spine. core endurance muscular flexibility muscular control core strength

Answers

The correct answer is core strength

The core refers to an area of the body that includes the mid-section, abdominal area, your sides, and your back. A person with good core strength is able to stabilize, flex, extend and rotate these mid-section areas, including their spine. 

Answer: core strength

When you have good core strength, your core muscles are strong, including your abdominal muscles, back muscles and those around the pelvis. You are able to flex, extend, and rotate your spine. Core-strength exercises are usually done on a carpeted floor or mat.

What is the reason for the cleaning step in the 5-step dishwashing process


Answers

The cleaning step in a five step dishwashing process is to get all of the food and gunk off of the dishes. This is important becuase the food, over time, will get stuck onto the plate which will cuase bacteria to get stored on the dish which will mke the dish unsanitary. Without cleaning properly with soap and water someone could get sick which is why this step is very crucial.



Hope this helps ~Sky

which of the following is a normal part of a healthy, mature male reproductive system?
A) a painless lump or swelling in the testicle
B) a change in the way a testicle feels
C) nocturnal emissions
D) an inguinal gland

Answers

I would go with B.), because when a boy goes through puberty, changes clearly happen, and it makes sense. So, I would go with B.

The normal part of a healthy, mature male reproductive system is nocturnal emissions.

Nocturnal emissions, commonly referred to as wet dreams, are a normal part of male sexual health and typically occur during adolescence and young adulthood, though they may continue throughout life. During a nocturnal emission, involuntary ejaculation of semen occurs during sleep. It is part of the normal reproductive function and does not signify any underlying health issues.

What are three essential tasks required from an effective multidisciplinary Healthcare team?

Answers

Final answer:

An effective multidisciplinary healthcare team must identify and overcome health barriers, create sustainable health interventions, and ensure excellent communication and collaboration among team members.

Explanation:

An effective multidisciplinary healthcare team is crucial for providing comprehensive patient care. The three essential tasks required from such a team include:

Identifying and defining critical problems and barriers to health - Team members need to pinpoint the main issues affecting a patient's health and work together to create a cohesive plan to overcome these challenges.Designing sustainable health education and disease prevention interventions - The team must develop and implement strategies that promote long-term health benefits for patients and the larger community.Effective communication and collaboration - To ensure quality care and efficient treatment, team members must communicate openly and work together seamlessly. This includes respecting each other's roles, using checklists to prevent errors (such as confirming a patient's identity, surgical site, and procedure), and discussing each team member's concerns for patient care like the surgeon, anesthesia staff, and nursing staff do during surgical procedures.

Challenges like work overload, heavy physical work, and interpersonal conflicts need addressing to maintain team effectiveness.

Learn more about Healthcare team here:

https://brainly.com/question/33217106

#SPJ12

Is the primary function of lymphocytes is immunological.
a. True
b. False?

Answers

True! Lymphocytes are a type of white blood cell that function as a part of the immune system.

The statement that the primary function of lymphocytes is immunological. is true.

What are  lymphocytes?

Most animals have lymphocytes as a sort of white blood cell in their immune systems. T cells, B cells, and innate lymphoid cells are all types of lymphocytes, with natural killer cells being a significant subtype. They are the primary class of cells in lymph, thus the term "lymphocyte." White blood cells known as lymphocytes serve as an essential component of the immune system. a particular immune cell subset that is produced in the bone marrow and is present in both the blood and lymph tissue.

B lymphocytes and T lymphocytes are the two primary types of lymphocytes. T lymphocytes aid in the management of immune responses and the killing of tumor cells, whereas B lymphocytes produce antibodies.

Learn more about lymphocytes at

https://brainly.com/question/1995778

#SPJ6

Juan has had his corpus callosum cut. When he touches something with his right hand, what happens?

Answers

a corpus callosum transfers information from one hemisphere to the other. So if he touches something with his right hand, he will feel it on his left side.

Juan, with his corpus callosum cut, will have impaired communication between his brain's hemispheres. If he is right-handed, he might still be able to identify and describe objects with his right hand since it is controlled by the left hemisphere with speech and language functions. This is a manifestation of split-brain syndrome caused by the severed corpus callosum.

When Juan, who has had his corpus callosum cut, touches something with his right hand, the sensory information is processed in his brain's right hemisphere. However, due to the severed corpus callosum, this information cannot be shared with the left hemisphere, where the language and speech centers typically reside. As a result, if Juan is right-handed and touches an object, he may be able to identify it and describe it because the right hand is controlled by the left hemisphere, which also houses speech and language functions. Yet, this integration of sensory and language processing cannot occur as efficiently as it would for someone with an intact corpus callosum.

In instances where people have had their corpus callosum cut to treat conditions like severe epilepsy, a phenomenon known as split-brain syndrome can occur. This condition provides insights into the unique functions of the two hemispheres. For example, if a split-brain patient is asked to pick up an object with the left hand (which is controlled by the right hemisphere), they may complete the task successfully but still be unable to verbally identify the object due to the disconnection between the hemispheres.

Which exercise is likely to target the abdominal muscles? Bicep curls Running Russian twist Biking

Answers

The exercise is likely to target the abdominal muscles in the running twist. Option C is correct.

Russian twist primarily targets the obliques, rectus abdominis, and transverse abdominis. It also targets hip flexors and provides stability to the torso.

The Russian twist is one of the most effective abdominal exercises. It works the obliques as well as the transverse abdominals, both of which are important for maintaining good posture.

It also helps to tone and burn fat while toning the waistline. It also strengthens the spine muscles while improving balance and flexibility.

Therefore, the correct option is option C.

To learn more about abdominal muscles, refer to the link:

https://brainly.com/question/12885640

#SPJ3

On average how many calories of food do we eat w no important nutrients per day

Answers

On average, a woman needs to eat 2000 calories per day, and a man needs to eat 2500.
Hopes this helps, please mark brainliest.

If a test for ferritin and a comprehensive metabolic panel are both performed, can both be reported?

Answers

The test for ferritin and comprehensive metabolic panel can be both reported even if they are both performed for they have different functions. Ferritin test is perform when you have low hemoglobin and hematocrit for this test measures the amount of ferritin, which is a protein that controls iron storage in the body.

Meanwhile, comprehensive metabolic panel help see how well your liver and kidneys are working. In addition, it also measure your electrolyte and acid/base balance, your blood sugar and your blood proteins.

Analyze physical activities from which benefits can be derived.
It is important to participate in a range of exercises to provide a variety of health benefits. Describe two physical activities available to teens and adults in your community that offer different physical benefits, and briefly describe the benefits of each activity

Answers

1. Physical activities that are easily available and can help both teens and adults to strengthen muscles and build bone structure include swimming and playing basketball.
2. Physical activities to lose and maintain recommended healthy weight include Aerobic dancing, jumping rope, and gardening.

In Eastern cultures, ----- form an important part of the family, and their opinions are highly regarded in family decisions.

Answers

In Eastern cultures, elders form an important part of the family, and their opinions are highly regarded in family decisions. Most countries in East Asia have established a culture of close-knit family and along with this is a tradition to value the elders. Every advice coming from the elders are always taken with utmost respect.

Answer: Elders

Explanation:

What appliance can be installed in a home to remove excess moisture therefore helping to eliminate mold growth?

Answers

A dehumidifier. They work similar to an air conditioner. Warm moist air goes in, is cooled and dried, then exits back into the air.

Where do you put your two fingers when checking your heart rate on your neck?

Answers

place it on the side of your windpipe, and wen u count ,.. count the number of beats in 15 seconds..like feel the bone of ur jaw line.. and push in. the when u feel a beat there u go.. sometimes u may have to hold your breath to focus on the beat 

The graph shows the percentage of calories that children and adolescents get from fast food.

Approximately what percentage of calories do obese adolescents obtain from fast food?

1) 10.1
2) 16.4
3) 8.8
4) 18.6

Answers

18.6 . D is the answer.

When Kyle wonders if he made the right decision to eat fruit instead of candy, what is he most likely doing?

1)learning about the decision
2)reflecting on the decision made
3)taking ownership of the decision
4)identifying alternatives to the decision

Answers

The answer is here:
2)reflecting on the decision made

When Kyle wonders if he made the right decision to eat fruit instead of candy, he is reflecting on the decision he made.

What is decision?"It is a conclusion or resolution reached after consideration."What do you mean by right decision?"It means that picking a choice among all the options which seem to be the right one for the individual or group."What do you mean by reflection on the decision?It means to analyze the decision that you have made.It gives clarity about the decision, to plan a strategy, etc.

Kyle is analyzing the choices or decision that he had made while choosing between eating fruit or candy.

Hence, the correct option is: 2)reflecting on the decision made.

To know more about decision making here

https://brainly.com/question/13244895

#SPJ2

Food preparation equipment shall be certified or classified for sanitation by

Answers

Final answer:

Food preparation equipment is usually certified for sanitation by a non-profit organization known as NSF International. They set standards for food safety and sanitation, and certify a variety of food preparation equipment.

Explanation:

Food preparation equipment is typically certified or classified for sanitation by an organization known as NSF International, which stands for National Sanitation Foundation. This non-profit organization sets standards for food safety and sanitation to ensure that food service operations are doing their part to prevent foodborne illness. They certify a range of food preparation equipment including refrigerators, cutting boards, knives, ovens, and more. The certification is crucial as it ensures that the equipment is designed and constructed in a way that it can be cleaned and sanitized properly.

Learn more about Food Preparation Equipment Sanitation here:

https://brainly.com/question/34697860

#SPJ12

Food preparation equipment should be certified or classified for sanitation by certain organizations and agencies to ensure safety and prevent the transmission of diseases.

Food preparation equipment should be certified or classified for sanitation by certain organizations and agencies. In the United States, these include the FDA (Food and Drug Administration), CDC (Centers for Disease Control and Prevention), and EPA (Environmental Protection Agency).

These organizations ensure that the equipment meets safety and sanitation standards to prevent the transmission of diseases and maintain public health.

To know more about Food preparation here:

https://brainly.com/question/29886661

#SPJ12

The best way to destroy harmful germs that may be present in meat is to?

Answers

Become vegetarian...

JUST KIDDING!

Rinse you're meat very well and make sure it is cooked thoroughly.

Answer:

The correct answer is: cooking.

Explanation:

Cooking food often has a hygienic function and eliminates the presence of possible pathogens. The effects vary depending on the type of cooking used and, therefore, the degrees that are applied. Thus, at more than 70 ° C, the pathogenic microorganisms are destroyed, although some do not withstand temperatures above 55 ° C. In many cases, microbial growth is linked to temperature changes. Therefore, heat control is very important to ensure that food is safe.

Heat is an important source of pathogen destruction. The hygienizing function of cooking is due to the fact that there are many pathogenic microorganisms that do not withstand temperatures above 55 ° C. At these degrees, which are reached in most cooking methods, bacterial accumulations begin to degrade and do so more as the temperature is maintained over time or if it increases.

What service would mostlt likely be provided by the americsn diabetie association to someone who has diabetes?

Answers

The American Diabetes Association leads the fight against the deadly consequences of diabetes and fights for those affected by diabetes.
-fund research to prevent, cure and manage diabetes.
-deliver services to hundreds of communities.
-provide objective and credible information.
-give voice to those denied their rights because of diabetes.

Sandra is a special education teacher. What will Sandra prepare that includes individual goals for each student based on each student’s abilities and needs? As a special education teacher, Sandra prepares a(n) , which includes individual goals for each student based on each student’s abilities and needs.

Answers

As a special need educator, Sandra must prepare an Individualized Education Programs (IEPs) for each students to help them develop individual goals based to the students need and abilities.

Moreover, Sandra must coordinate with the child’s parents and general education teachers so they can be updated with the learning progress of the child and she may make recommendations to continue the learning at home.

 

Answer:

IEP

Explanation:

What is the relationship between the acts and EHR as it impacts your role as a Medical Assistant?

Answers

The use of EHR would impact much on the role of the Medical Assistant as it would avoid medical errors. This then would lessen lawsuits thus money would not be put into trash. This would also help the Medical assistant in documenting properly the information.

Distension of the ureter, or this term, can be a result of a ureteral calculus. what is this term?

Answers

The answer is Ureterectasis which means the distension of the ureter or can be a result of a ureteral calculus. A ureteral obstruction is the blockage in the ureters, the one carrying the urine from the kidney to the bladder yet this can be curable.

Final answer:

The term referring to the swelling or distension of the ureter as a result of a ureteral calculus (kidney stone) is hydronephrosis. This condition causes pain, potential kidney damage, and can lead to other symptoms like renal colic and hematuria.

Explanation:

When a ureteral calculus, commonly known as a kidney stone, obstructs the ureter, it can lead to a condition known as hydronephrosis. This term refers to the swelling or distension of the ureter as well as the renal pelvis of the kidney. Kidney stones are hard accumulations of minerals like calcium that form inside the kidneys. If they become large enough, they can get lodged in the urinary tract, particularly the ureters, which are the tubes connecting the kidneys and the bladder. When the stone blocks the flow of urine, it leads to an increase in pressure and the stretching of the ureters and renal pelvis, causing significant pain and possible kidney damage.

Hydronephrosis occurs as a result of the obstruction that prevents urine from draining properly from the kidney into the bladder. The symptoms associated with this condition can include severe pain, known as renal colic, nausea, vomiting, and possibly bloody urine (hematuria) due to irritation of the urinary tract. Treatment for a ureteral calculus might involve pain management, medical therapy to facilitate the passage of the stone, or surgical interventions to remove the stone and alleviate the obstruction.

The Creed of the AMA includes all but the following statements
A. I believe in the principles and purposes of the profession of medical assisting.
B. I endeavor to be more effective.
C. I am loyal to my patients
D. I am dedicated to the care and well-being of all people.

Answers

Answer: C. I am loyal to my patients

The Creed of the American Association of Medical assistants sets forth medical assisting statements of belief that include choices letter A, B, and D but not letter C for the creed states that the medical assistants must be loyal to the physician or employer and not to the patients.

 

Answer:

The answer is option D.

Explanation:

The Creed of the American Association of Medical  collaborators puts forward restorative  helping explanations of conviction that  incorporate decisions letter A, B, and D however not letter C for the ideology expresses that  the medicinal colleagues must be faithful to the doctor or business and not to  the patients.

Which of the following is Incorrectly paired? Government-.gov, Non-profit organization-.biz, Educational institution-.edu, or Published by anyone-.com

Answers

The one that is incorrectly paired is NON PROFIT ORGANISATION: BIZ.
When writing website names, the names used usually reflect the type of business that is involved. Educational websites typically end with dot edu. Government websites usually end with dot gov, non profit organizations ends with dot org while those published by anyone end with dot com.
The one that is incorrectly paired is NON PROFIT ORGANISATION: BIZ.
When you write website names, it reflects on the owner or company of the website in which it must be associated and related to its website address such as educational wbesite shod have.edu

What are the major functions of the respiratory system?

Answers

The major functions of the respiratory system is to provide the blood with oxygen to fuel it to deliver oxygen into the other parts of the body

Hope this helps you!

Answer:

Your respiratory system is the network of organs and tissues that help you breathe. This system helps your body absorb oxygen from the air so your organs can work. It also cleans waste gases, such as carbon dioxide, from your blood

Explanation:

hope it helps you :)

A person who must be twice as close to an object to see it as clearly as a person with normal vision activity has

Answers

the answer is near sighted

How would an individual with emphysema affect each of the following respiratory volumes:

a. Tidal Volume:

b. Expiratory Reserve Volume:

c. Vital Capacity:

Answers

Here's how an individual with emphysema affects each of the following respiratory volumes: 
a. Tidal Volume: The Tidal Volume will decrease
b. Expiratory Reserve Volume: The ERV will decrease
c. Vital Capacity: The Vital capacity will decrease
In this kind of disease, the lung tissue involved in the exchange of gases (oxygen and carbon dioxide) is not performing at its capacity.

The effects of emphysema are the following

A) Tidal Volume

Tidal volume may not change at all, but it takes longer to exhale than with normal lungs, however most of the airway obstruction in emphysema occurs during exhalation causing air to get trapped in the lungs.

B) Expiratory Reserve Volume

Expiratory reserve volume is the additional amount of air that can be expired from the lungs by determined effort after normal expiration. Static hyperinflation is caused by a decrease in elasticity of the lung due to emphysema. So we can say that due to emphysema the ERV decreases.

C) Vital Capacity

Vital capacity is the maximum amount of air a person can expel from the lungs after a maximum inhalation. Mild emphysema is supposed to be accompanied by slight reduction of the vital capacity, and the vital capacity decreases with increasing capacity of emphysema.

What does marijuana do to your body

Answers

Marijuana can affect many parts of your body, but nothing is ever really majorly affected. While there a large list of ways it can affect your body, here is a brief list of ways marijuana can affect your body:


1 )  MEMORY LOSS
This is perhaps the most common and most known effect of marijuana. Studies show that the 'high' caused by marijuana can affect and change how information is processed in your brain. It can affect your ability to form an event into a memory.

2 )  RED EYES
The high caused by marijuana can cause your eyes to become red. This is because the marijuana causes the blood vessels in your eyes to expand, making the eyes appear red.

3 )  THE MUNCHIES
During or after smoking, the person may notice they begin to work up an appetite. This is because the marijuana stimulates the appetite causing the person to becoming hungry or crave some sort of snack.

4 )  CANCER
Many people disagree with the fact that smoking marijuana can cause lung cancer because it is not something that is common. While it is rather rare, it is still possible. Smoking marijuana can cause lung problems, such as lung cancer.

The condition of the environment greatly affects the health of its _____.
1. rocks
2. inhabitants
3. solid waste
4. contaminants

Answers

The answer is 2, the condition of the environment affects everything it inhabitants.

inhabitants should be the correct answer

The habitual manner in which people explain the things that happen to them is their explanatory style.

True

False

Answers

The habitual manner in which people explain the things that happen to them is their explanatory style: false
Explanatory styles is the way in which people perceive or explain the events in their lives. It is in the habitual way in which people explain the bad things that happen to them. In reality, it is a habit- a way of thinking that people use when all others factors are equal and when there are not clear-cut right and wrong answers

~true

~Manii

Alcohol has been found to adversely affect information process at BALs as low as .02 but certainly at ________________ or greater. A. 0.1 B. 0.5 C. 0.08 D. 0.09

Answers

D=0.08 This was in my Drivers book

Answer: Alcohol has been found to adversely affect information process at BALs as low as .02 but certainly at 0.08 or greater.

Explanation:

Due to the process of oxidation that occurs in the liver, it eliminates 90% of the alcohol present in the bloodstream. The lungs eliminates 5% of alcohol during the process of exhalation that can be detected by breathalyzer devices. The kidneys eradicate 5% of alcohol via excretion (urination). The remaining consumption of alcohol in the body then gets chemically broken down into acetic acid.


Other Questions
Describe the effects of Eastern Europes economic problems and ethnic and religious tensions What term refers to the coldest and densest zone, deep below the surface of a lake? Tyree is a skilled cyclist. when practicing on a stationary bike, his coach finds that when the women's cycling team enters the gym, his speed seems to increase significantly. tyree's increase in speed illustrates What factors are associated with recent intimate partner violence? findings from the who multi-country study on women's health and domestic violence? BY THE PRESIDENT OF THE UNITED STATES OF AMERICA. A PROCLAMATION. I, ABRAHAM LINCOLN, President of the United States of America, and Commander-in-Chief of the Army and Navy thereof, do hereby proclaim and declare that hereafter, as heretofore, the war will be prosecuted for the object of practically restoring the constitutional relation between the United States, and each of the States, and the people thereof, in which States that relation is, or may be, suspended or disturbed. That it is my purpose, upon the next meeting of Congress to again recommend the adoption of a practical measure tendering pecuniary aid to the free acceptance or rejection of all slave States, so called, the people whereof may not then be in rebellion against the United States and which States may then have voluntarily adopted, or thereafter may voluntarily adopt, immediate or gradual abolishment of slavery within their respective limits; and that the effort to colonize persons of African descent, with their consent, upon this continent, or elsewhere, with the previously obtained consent of the Governments existing there, will be continued. That on the first day of January in the year of our Lord, one thousand eight hundred and sixty-three, all persons held as slaves within any State, or designated part of a State, the people whereof shall then be in rebellion against the United States shall be then, thenceforward, and forever free; and the executive government of the United States, including the military and naval authority thereof, will recognize and maintain the freedom of such persons, and will do no act or acts to repress such persons, or any of them, in any efforts they may make for their actual freedom. That the executive will, on the first day of January aforesaid, by proclamation, designate the States, and part of States, if any, in which the people thereof respectively, shall then be in rebellion against the United States; and the fact that any State, or the people thereof shall, on that day be, in good faith represented in the Congress of the United States, by members chosen thereto, at elections wherein a majority of the qualified voters of such State shall have participated, shall, in the absence of strong countervailing testimony, be deemed conclusive evidence that such State and the people thereof, are not then in rebellion against the United States. That attention is hereby called to an Act of Congress entitled "An Act to make an additional Article of War" approved March 13, 1862, and which act is in the words and figure following: Be it enacted by the Senate and House of Representatives of the United States of America in Congress assembled, That hereafter the following shall be promulgated as an additional article of war for the government of the army of the United States, and shall be obeyed and observed as such: Article . All officers or persons in the military or naval service of the United States are prohibited from employing any of the forces under their respective commands for the purpose of returning fugitives from service or labor, who may have escaped from any persons to whom such service or labor is claimed to be due, and any officer who shall be found guilty by a court-martial of violating this article shall be dismissed from the service. SEC. 2. And be it further enacted, That this act shall take effect from and after its passage." What is the effect of the following passage on the U.S. government? ...and the executive government of the United States, including the military and naval authority thereof, will recognize and maintain the freedom of such persons, and will do no act or acts to repress such persons, or any of them, in any efforts they may make for their actual freedom.A) It intends to conscript former slaves into the military.B) It intends to prosecute former slave owners.C) It will not stop any slave from moving toward freedom.D) It will use its military and naval authority to stop the war. Which of the following words has the same root as the word biology? a zoology b geology c bibliography d biograph Which expression is equivalent to (2x^5+7x^3)-(5x^2-4x^3) What is the length of chord JK? Who was the first northern democrat elected to the presidency since 1968? determine the qotient of 7,684 and 78 Choose the sentence that best describes the history of Guatemala's capital city.The capital has always been Guatemala City.The capital has always been Antigua.The capital used to be Antigua, but is now Guatemala City.The capital used to be Guatemala City, but is now Antigua. As a healthier alternative to french fries, some fast food outlets offer pre-sliced, bagged apples as a side option. the ingredients list often reads, "apples and ascorbic acid." ascorbic acid is another name for vitaminc. what role does the ascorbic acid play in the product? ascorbic acid is a sequestrant that binds free metal ions and reduces the rancidity of fat in the apples. ascorbic acid is an antioxidant that prevents discoloration when the apples are cut and exposed to oxygen. ascorbic acid is a curing agent that prevents the growth of clostridium botulinum. ascorbic acid is a color additive that makes the color of the apples appear more vibrant. What are the causes of problems the milers and other Native American groups face in Guatemala how are people trying to solve these problems Which diagram shows the most useful positioning of a rectangle in the first quadrant of a coordinate plane? Answers are in the pictures. In an attempt to stem the rising tide of illegitimacy rates and single-parent families among the poor, which act mandated two-parent coverage for all state afdc programs? the family support act in 1988 the supplemental security income the affordable care act temporary assistance to needy families Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? view available hint(s) where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? it would not bind the target dna. ttttagccatttacgattaatcg ttttagccatttacgattaatcg ttttagccatttacgattaatcg? For the electric field shown, which of the following statements describes an increase in voltage?A) A negative charge crosses an equipotential line toward the source charge.B) You cannot tell from the information given.C) A positive charge crosses an equipotential line toward the source charge.D) A positive charge moves along an equipotential line.UPDATE: ANSWER IS C Which organisms are both secondary and tertiary consumers in the food web Laura is completing a craft project that involves covering only the lateral surface of a cylindrical container with fabric. The cylinder has a height of 16.8 in. and a radius of 14.6 in. To the nearest square unit, how much fabric does she need for this project? Use a calculator. Marie has left written instructions directing doctors and family members to avoid or stop using life-sustaining procedures in the event of a terminal condition. such an instrument is called the