How many lines are on a sonnet

Answers

Answer 1
The answer is (14 lines)  hope it helps and have a good day!
Answer 2

Answer: there are (fourteen) lines in  a sonnet


Related Questions

Think of a time when you were learning how to do something new. In the space below, write four to five sentences describing this experience. Make sure to use transition words, such as "first," "then," or "finally" to show the sequence of events.

Answers

When I first started to learn how to ride my bike it was scary and I fell and scraped my knees a lot.
Then my dad supported me until I was able to ride on my own and that was nice to have my dads support
Then finally I am able to ride hands free, down a hill, at breakneck speed.

Hope this is what you needed. =)
When I was in dance class I was learning how to do a back tuck and it was hard to do because I berly had my back flip so I kelp trying and trying and I did it I was happy so I did on hard floor and it was easy to now that I did it on the hard mat

Combine the following sentences using appositive or appositive phrases. Use commas as they are needed
1. Franklin D. Roosevelt was the only child of a wealthy couple. He was elected president four times.

Answers

An appositive or appositive phrase are words that are used to rename a noun that is right beside it.  Combining the sentences using an appositive would be:

Franklin D. Roosevelt, the only child of a wealthy couple, was elected president four times.

The appositive phrase is "the only child of a wealthy couple" as it is used to rename Roosevelt. 
Franklin D. Roosevelt, the only child of a wealthy couple, was elected president four times.

Appositive phrases are phrases that rename the noun that comes right before them. So, in this sentence "Franklin D Roosevelt" is the noun. Another way to describe him is "the only child of a wealthy couple". That is the appositive phrase. 

Sentence:


Today, Rome’s influence is still being felt. It is a prime location for tourism, as its archeological and artistic offerings are second to none. Neoroman architecture fits the world, and even fields like Chemistry and Egyptology cannot escape their ties with Roman history.


Question:


“Neoroman” implies that these structures are:


A) Built by ancient Romans


B) Built in honor of the Ancient Romans


C) Built in Rome


D) None of the above

Answers

A).
Hope this works
It seems easy

Read the excerpt from Flannery O’Connor’s “The Life You Save May Be Your Own.” He was more depressed than ever as he drove on by himself. The late afternoon had grown hot and sultry and the country had flattened out.
Which best describes the irony in the excerpt?
A) The heat of the day is indicative of Mr. Shiftlet’s negative feelings of his life and situation.

B ) Mr. Shiftlet would have preferred to travel with his new wife, Lucynell, but she has left him at the diner.

C ) The young boy rejected Mr. Shiftlet’s offer to give him a ride, and now the man finds himself alone.

D ) Mr. Shiftlet has the car he wanted and managed to rid himself of his wife, but he still is not happy.

Answers

D ) Mr. Shiftlet has the car he wanted and managed to rid himself of his wife, but he still is not happy.

At the beginning of the story, Mr. Shiflet appeared at Lucynell's house and saw the car just abandoned at the house. He wanted it. He realized in order to get the car, he would need to marry Lucynell. This wasn't hard because her mother did not want to be responsible for her any more and Lucynell was enamored with him. Mr. Shiflet decided to marry Lucynell, and the two of them drove away to start a life together. However, Mr. Shiflet didn't really want a wife so after a while of driving he left her at a diner. The statement is ironic because all he wanted was to be by himself driving the car to wherever he wanted, but he's not happy like he thought he would be.

Mr. Shiftlet has the car he wanted and managed to rid himself of his wife, but he still is not happy. Therefore, the correct option is option D.

What is an excerpt?

An excerpt is indeed a quotation from that other resource that the author introduces with fresh language in a sentence. This phrase is taken from Thomas Jefferson's 1801 inaugural speech: As he warned his audience, "I may often go wrong by defect of judgement," Jefferson admitted the fallibility of human nature. "I shall frequently err through lack of judgement" is the excerpt.

This is a brief passage from a lengthy work, hence being an excerpt first from Declaration of Independence: "When it comes to necessary for one nation to cut the political ties that have bound them to another, and also to assume among powers of the world," says the philosopher Aristotle.  Mr. Shiftlet has the car he wanted and managed to rid himself of his wife, but he still is not happy.

Therefore, the correct option is option D.

To know more about excerpt, here:

https://brainly.com/question/29708851

#SPJ5

should candy and pop come with school lunch pros and cons

Answers

it should as it gives energy and keeps the kids awake and ready to learn in school
It shouldn’t because sugar has no scientific evidence of giving energy nor does it have any nutritional properties

Grass by Carl Sandburg
1. An allusion is a brief and indirect reference to a person, place, thing or idea of historical, cultural, literary or political significance. It does not describe in detail the person or thing to which it refers. Identify the allusions and discuss why these particular ones are used.
2. A. The dominant rhetorical strategy is personification (giving human qualities to nonhuman objects or ideas). What is personified?
B. How does this help produce the tone of the poem? Remember, tone is how the author feels about the subject.


3. If one of Sandburg’s contentions is that people forget about war and fallen heroes, does the fact that many war memorials and statues, cannons, and plaques dot the landscape at the site of the Battle of Gettysburg contradict this?

Answers

1. The Allusions in this poem are all famous historical battle sites. Austerlitz and Waterloo are two famous sites of battles led by Napoleon in the 1800s. Gettysburg is a famous site where there was a pivotal battle during the Civil War. Ypres and Verdun are both places where battles were held during World War I. All of these battle sites mark areas and moments of significant bloodshed, which relates to the overall idea of the poem that even the most gruesome history can be brushed over, and can produce growth. The grass in the poem wishes to cover the death and the darkness left behind by tragedies such as these. 

2. Grass is personified in this poem. It continuously speaks throughout the poem (a human quality), and says "Let me work". Doing work is seen as a predominantly human activity, which also lends to the personification of the grass. 

3. This is mostly an opinion question, but it could either be argued that either:

- Yes, this is contradictory, because there are all of these tokens that cover over the land where this tragic event took place, turning it into a tourist site, rather than a solemn gravesite

or

- No, because these memorial items represent the loss that happened at this site, and pay homage to it, so that the battle and lives lost are not forgotten. 
Final answer:

Carl Sandburg's poem 'Grass' uses allusions to historical battlefields and personification to create a reflective tone on the nature of memory and the futility of war. The presence of memorials, while aiming to preserve history, might not be sufficient to prevent the gradual fading of individual memories over time.

Explanation:

In Carl Sandburg's poem Grass, the allusions refer to various notable battlefields such as Austerlitz, Waterloo, Gettysburg, Ypres, and Verdun. These allusions are used to highlight the historical significance of the battles that took place at these locations, implying the vast number of lives lost and the ease with which history can be forgotten despite such monumental events.

The poem also prominently features personification by giving the grass human characteristics, like the ability to cover and 'forget' the dead from these battles. This personification creates a somber and reflective tone, leading readers to contemplate the transient nature of human memory and the futility of war.

Regarding the existence of monuments and memorials at the site of the Battle of Gettysburg, it can be argued that while these structures seek to prevent the forgetting of the past, Sandburg may suggest that the natural passage of time and the continuous cycle of life, represented by the grass growing over battlefields, will eventually obscure individual memories, despite physical attempts to preserve them.

grade 2
favorite holiday and write sentences to tell what happened first,next and last? 1.first..............
2.Next.........
3.last...........

Answers

My favorite holiday is Christmas. First we wake up and go down to the Christmas tree. Next we open all of our presents and play with our toys. Then we go to church and we come back home and eat Christmas dinner. Lastly we tell stories in the living room and go to bed.
I hope this helped! :-)

Here is a sample about favorite holiday: First, we decorated the Christmas tree. Next, we baked cookies and made hot cocoa. Last, we gathered to listen to stories and open presents.

My favorite holiday is Christmas as it brings a lot of joy. The sentences about my favorite holiday and what happens first, next, and last can be written as:

First, we decorated our Christmas tree with shiny ornaments and many colorful lights.Next, we baked gingerbread cookies and prepared hot cocoa to enjoy together. My mother also prepared a cake.Last, we gathered around the fireplace to listen to stories and open our presents. We were anticipating Santa to also visit us.

This structure allows you to create a coherent and engaging narrative about your favorite holiday experience


1. What should Alicia do to prepare for her meeting with her boss?

Answers

Proffesional must be

Plan to discuss the ways attending college is helping Alicia be better at her job.

The Secret Garden how did Mrs.lennox treat mary?

PLEASE HELP ASAP!!! WIll GIVE BRAINLIST!!!!


(PLEASE HELP :c)

Answers

She was weary of her and did not treat her very kindly

Check my answers?? English Homework:

Which of the following did NOT contribute to the Harlem Renaissance?
Question 1

A. The Emancipation Proclamation.

B. By 1930, the population of African Americans in Harlem grew to over 200,000.

C. F. Scott Fitzgerald <---

Question 2
In the poem, "We Wear the Mask", of what is the mask a metaphor?

A. religious faith

B. the long road ahead for African Americans

C. the false exteriors of African Americans <----

Question 3

Who is the speaker in Paul Lawrence Dunbar’s, “We Wear the Mask”?

A. The collective voice of the African American community. <----

B. Paul Lawrence Dunbar.

C. Other poets who lived in Harlem, NY.

Question 4

In Paul Lawrence Dunbar’s poem, “Sympathy”, what does the caged bird most want?

A. To get a message to Heaven.

B. To be free. <---

C. To remember what life was like before being caged.

Question 5

Which of the following lines from Paul Lawrence Dunbar’s “Sympathy” is an example of imagery using a simile?

A. “When the sun is bright on the upland slopes”

B. “And the faint perfume from its chalice steals”

C. “And the river flows like a stream of glass” <----

Answers

I think all of these are correct, Im not certain

If you have this question (same question, different answer choices):

Which of the following did NOT contribute to the Harlem Renaissance?

a) The Emancipation Proclamation

b) By 1930, the population of African Americans in Harlem grew to over 200,000

c) The Korean War

d) Jim Crow laws and little opportunity in southern states

The answer is c) The Korean War. (:

Read this paragraph.
Abram woke up at 6:30 a.m. He showered, ate breakfast, and gathered his books for school. He was on time for the bus, and he made it to homeroom early enough to compare notes with his friend Dave for that day's algebra exam. He was feeling good about the test by the time he walked into class. What text structure does the paragraph use?
sequence
compare-contrast
cause-effect
problem-solution

Answers

The answer is squence because there is no problem so 4 and 3 is out. Not 2 because even though they were comparing notes that is not compare and contrast.

so the answer is sequence

which statment is an opinion a)the yankees play better than the new york era b) Babe Ruth played for the yankees c) yankee stadium sells hotdogs d)yankees are the best team in history

Answers

A is an opinion! hope I helped :)
D is the more prominent opinion though. A is an opinion, but can be backed by fact. D is just an opinion


"Everything we ever said, to one another, is wrong," she told me.

Select the choice in which the sentence is punctuated correctly.
A) NO CHANGE
B) "Everything we ever said to one another, is wrong," she told me.
C) "Everything we ever said to one another is wrong," she told me.
D) "Everything we ever said to one another is wrong" she told me.

Answers

C is the correct answer. "Everything we ever  said to one another is wrong," she told me.  

The choice in which the sentence is punctuated properly is (C) -  "Everything we ever said to one another is wrong," she told me.

What is a punctuation ?

Punctuation is the use of white space, traditional indicators known as punctuation marks, and specific typographical methods to help readers understand and interpret written material correctly, whether they are reading it silently or loudly.

Punctuation in written English is essential for clarifying sentence meaning. Language, place, register, and time all have different and ever-changing punctuation norms. Shorthand language forms, such those used in online platforms and text messaging, or aesthetic punctuation choices made by the author can also be utilized.

Therefore, the sentence in option C is properly punctuated.

To learn more on Punctuation, click here:

https://brainly.com/question/30515563

#SPJ3

In your statement you assert that our actions, even though peaceful, must be condemned because they precipitate violence. But is this a logical assertion? Isn't this like condemning a robbed man because his possession of money precipitated the evil act of robbery? Isn't this like condemning Socrates because his unswerving commitment to truth and his philosophical inquiries precipitated the act by the misguided populace in which they made him drink hemlock? Isn't this like condemning Jesus because his unique God consciousness and never ceasing devotion to God's will precipitated the evil act of crucifixion? (paragraph 21 of “Letter from Birmingham Jail”)

The series of questions in the excerpt is best described as _____. a)quotations b) images c) metaphorical d) rhetorical
I will give branliest! Please Help!

Answers

Answer:

d) rhetorical

Explanation:

These questions can best be described as rhetorical questions. Rhetorical questions are those that are not intended to be answered. Instead, their purpose is to motivate the listener to think about the topic being discussed and reflect on it. In this example, King does not expect to receive any replies. Instead, he wants to motivate the reader to think about the questions he posed and reflect on whether his argument is a logical one.

Question 2 (1 point) Question 2 Unsaved
The groundlings in Shakespearean theaters
Question 2 options:

stood and watched the play for a penny

were hung like banners around the stage

illuminated the stage

secured the stage to the floor
Question 3 (1 point) Question 3 Unsaved
When Romeo calls Juliet "the sun" in the "Balcony Scene," it is one of many references to his belief that she brightens every environment she appears in. How do Romeo's comparisons shape his and readers' view of Juliet?
Question 3 options:

They make Juliet seem ordinary, someone Romeo can easily win.

They make Juliet seem heavenly and wonderful, someone who is like the sun and stars.

They make Juliet seem friendly and kind, someone to whom Romeo can tell his troubles.

Romeo is a Montague and Juliet is a Capulet
Question 4 (1 point) Question 4 Unsaved
In the balcony love scene, several of Juliet's speeches convey a sense of foreboding. Which one of the following fears is not mentioned?
Question 4 options:

This love will result in her death.

Romeo could prove faithless

Their love is moving too swiftly.

Romeo will be discovered.
Question 5 (1 point) Question 5 Unsaved
In this excerpt, Romeo and Juliet have "discovered" and voiced their feelings for one another. How can something so great be so dangerous for them?

Question 5

Juliet is underage, and if Romeo is caught, the police will arrest him.

Their families are fueding and usually fight each other to the death.

Benvolio is engaged to Juliet and is Romeo's good friend.

Tybalt forbade Juliet from seeing Romeo because Tybalt lost a bet to him.

Answers

Question 2: A Stood and watched the play for a penny in a pit.

Answer:

Question 2: A Stood and watched the play for a penny in a pit.

Question 3: They make Juliet seem heavenly and wonderful, someone who is like the sun and stars.

Question 4: This love will result in her death.

Question 5: Their families are fueding and usually fight each other to the death.

Help me please?Im having difficulties with this and I just need help at the moment please if you see this please help and don’t ignore

Answers

First off, creativity is an excellent quality to have in leaders, because the protocol is usually wrong for situations that require quick thinking and not memorized passages. Creativity is a great trait for an individual because it creates a sense of independence and fun in an everyday environment.
Hope I helped!
Good luck~~
The question isn't really about Pres. Obama. The question is about a creative mind.

This is very hard for someone else to answer. Do you have a creative mind? If you do, how do you and your creative mind get along? Do your friends like that part of you that can be very quirky. Do you make comments that don't exactly fit what everyone else says. Do you look at things differently than other people do and if you do, how?

If you do not have a creative mind (I don't. I'm very logical) then do you know someone who does? My wife does, and we can drive each other crazy. She thinks I'm a dirt clod and I think she lives in a world uninhabited by anyone but her.

We've been married 37 years. Maybe that's just the way of things. 

So choose. You have enough here to get you going. Good luck.

A theme covered in “The White Umbrella” is ________

A- being new to a neighborhood

B- anger toward an enemy

C- the differences between schools

D- having a sense of belonging

Answers

I would say D and A because the poem is most about you belonging somewhere and also about being knew and all that stuff.

Answer:

id say D because they are looking for a sense of belonging, finally finding it near the end.

Explanation:

Which example from "Everyday Use" best shows the reader that the narrator is strong and a hard worker? A. It seems to me I have talked to them always with one foot raised in flight. B. I can kill and clean a hog as mercilessly as a man. C. Sometimes I dream a dream in which Dee and I are suddenly brought together. D. My hair glistens in the hot bright lights.

Answers

B is the answer to this question,....Hope this helps.

Answer:

B. I can kill and clean a hog as mercilessly as a man.

Explanation:

In "Everyday Use," we encounter a mother and her two daughters, Dee and Maggie. The mother in the story is a strong and hard worker, as she explains in these lines. She compares herself to a man, and in doing so, she realizes she is equally capable than any of them. She tells us that she can kill and clean a hog in the same merciless way, which requires significant strength and hard work.

Which sentence using commas correctly? Consider that the correct sentence may not require commas.


(A) Lost in thought I didn’t notice the crashing wave until it was too late!


(B) According to my mother an inner tube, is the best way to be in the water.


(C) Oh look out, for that motorboat!


(D) After the roll of thunder, we should get out of the water.

Answers

I think the answer is D.
D is the best choice. If you say the sentences out loud that always helps you know when it's wrong or right.

Which part of an essay helps identify the type of essay?

A)keywords
B)headings
C)title
D)length

Answers

Answer: A

Explanation:

A - keywords give different moods and can contribute to an informational sense or a narrative one

B - headings are like titles, they can be interpreted in several ways, for example, let's say a book (or essay/ heading) was named "Forests". It could be informing the reader about forests or entertaining them with a story about a magical forest.

C- look at the last explanation.

D- length, as long as it is over the minimum amount required, it does not matter

Final answer:

The title of an essay is crucial in identifying the type of essay, as it conveys the main point and sets the expectation for the essay's content. While keywords and headings can offer clues, the title is the most indicative element.

Explanation:

To identify the type of essay, the title plays a crucial role. A well-crafted title is designed to convey the main point of the essay and can hint at the genre, whether it be narrative, argumentative, descriptive, or expository, among others. The title serves as a peek into the content and if enticing enough, it encourages further reading. While other elements such as keywords, headings, and length also provide clues, the title is the most indicative of the essay type.

A writer selects a title that alludes to the main point of the essay, comparable to a headline in a newspaper or magazine. Titles help readers determine the topic of the essay, focus the writer's thoughts, and set the expectation for the essay content. For instance, a scholarly essay may feature a title with academic language that differs from a more creative or personal piece.

Read this excerpt from “Ridiculous Rhymes.” Which line in the poem is an end-stop line? Ridiculous rhymes belong to these times For these times are as ridiculous [As these rhymes.] This rhyme might be a waste of time But why should you care [You’re doing just fine.] This ridiculous rhyme [Does tinkle and chime] Perhaps it isn’t such a waste of time.

Answers

Answer:

B. You’re doing just fine.  Explanation:

how do I get out of IEP classes I want my regular classes back somebody let me know please

Answers

either with a counselor or change it at the end of the year


Read the paragraph. What would be the best way to correctly edit the underlined sentence?


Music piracy occurs when you share music with friends, such as giving friends a free copy of a song. This behavior may not seem like a big deal, but it can have a huge impact on the music industry. Their is a lot of people working together to create a song, songwriters, audio enginers, computer technicians, producers, recording artists, and more. A study by the Institute for Policy Innovation found that music piracy led to over 70,000 lost jobs and billions of dollars in lost wages. In order to keep your favorite singers in business, it’s important to avoid getting music without paying for it.






There is a lot of people working together to create a song, songwriters, producers, recording artists, and others.



There are a lot of people working together to create a song, songwriters, producers, recording artists, and others.



Their are a lot of people working together to create a song: songwriters, producers, recording artists, and others.



There are a lot of people working together to create a song, including songwriters, producers, recording artists, and others.



There is a lot of people working together to create a song, songwriters, producers, recording artists, and others.

Answers

Choice D is correct. "There are a lot of people working together to create a song, including songwriters, producers, recording artists, and others."
Hope this helps!

Answer:

The best way to correctly edit the underlined sentence is the following one: There are a lot of people working together to create a song, including songwriters, producers, recording artists, and others.

Explanation:

First of all, the verb to be should be plural because the existential phrase is referring to a plural noun, people. Then, you should always include a comma before "including" when followed by a nonrestrictive, nonessential phrase or clause.

When using Scrum, who is primarily responsible for making scope versus schedule trade-off decisions?

Answers

The Product Owner is responsible.

The product owner is primarily responsible. The Scrum system is a framework used to manage knowledge work, specially software development. The product owner is the one who represents the product's stakeholders (he is the key stakeholder), as well as the customer. It is his responsibility to maximize the value delivered by the team.

Video Presentation Permission Form
Mary O'Dell

Video Broadcast Permission Form

Willow High School



Teacher’s Name: __________________________ Date: __________



Name of Video:____________________________________________

Video rating - G PG PG-13 R NR (not rated) Unknown

(You must have signed parental permission slips for ratings above PG-13)

What alternate activity will be provided for any students who do not have parental permission?

How was the video acquired?

_____ taped from TV/Cable date(_______________)

_____ rented (I have permission to show it.)

_____ owned by the school

_____ teacher owned

_____ other (explain) ____________________________________

Length of video ____________ Date(s) to be shown ________ Blocks(s) you will be showing this video - 1st 2nd 3rd 4th (Circle all that apply)

What essential question(s) are you studying and how will this video relate to them?

What follow-up activities are planned for the video? (1 is required)

Teacher’s Signature _______________________________________

The teacher signed above accepts responsibility for copyright compliance for broadcasting this video.



_____________________________________________
Principal’s signature (or designee)

_____________________________________________
Date

Approval is required for materials not owned by the school

Approved __________ Denied __________

1)

What essential question(s) are you studying and how will this video relate to them?

What follow-up activities are planned for the video? (1 is required)

Based on the form, what inference can you make from the comparison of these two questions?

A)
Video presentations require planning.


B)
Video presentations are required at least one time.


C)
Videos presentations are used during free time and after tests.


D)
It is essential to ask students questions about each video presentation.


2)
Which is a valid conclusion that can be drawn from reading this form?

A)
Teachers can show videos to their students at any time for any reason at all.


B)
Videos are great instructional aides that should be utilized by all teachers.


C)
Teachers must justify every use of video in their classroom probably due to past video misuse.


D)
Television and videos are limited as teaching tools and are not as effective as simply face-to-face teaching.

Answers

CORRECT ANSWER IS

C) Teachers must justify every use of video in their classroom probably due to past video misuse.

What is the best way to combine this information into a grammatically correct sentence

Answers

Is that the question or is there a sentence that is supposed to go along with it? 

Hi there! Can you help me?

I am struggling with an assignment and I feel if I have examples of the same assignment I can have an easier time with this.

Assignment:
Write an 8 lined poem about any topic of your choice.

Include at least 3 of the following

1. Onomatopoeia
2. Alliteration
3. Meter (rhythm)
4. Rhyme scheme
5. Assonance
6. Consonance

Answers

Like doves, we fly.
Also like doves, we shall die.
Boom!
A bang is heard in the distance.
This means we shall make ourselves distant.
The free flock of feathers flies away, now just a cloud of grey.
As the sun goes down, silent is the town.
The doves have fleed, leaving only you and me.
Like doves, we find hope.



Hi! Hope this was good enough. If you liked this please mark as Brainliest answer, I’d appreciate it. :^) . The examples used in this poem are: Onomatopoeia, Alliteration, and Meter. Hope this helped you, have a good day/night!

Read the passage from Of the Wisdom of the Ancients. Now the philosophy of the Greeks, which in investigating the material principles of things is careful and acute, in inquiring the principles of motion, wherein lies all vigour of operation, is negligent and languid; and on the point now in question seems to be altogether blind and babbling; for that opinion of the Peripatetics which refers the original impulse of matter to privation, is little more than words—a name for the thing rather than a description of it. Which phrase from the passage best states its central idea?

Answers

"And on the point now in question seems to be altogether blind and babbling" seems to sum up the opinion of the ancient Greeks and their studies of processes like the motion of matter perhaps because at that time of history of the classical learning much of it was based on pure speculation without going out and getting one's hands dirty and really perceiving phenomena with one's 5  senses as Georgius Agricola did in going down in underground mines to find out firsthand how mining was carried out.

Answer:

it should be D

Explanation:

edge im not sure

The praying mantis is a member of the Mantid group of insects. Mantids come in many shapes and sizes and are found all over the world. Some have patterns on their bodies that help them look like the ground. Some are bright green to blend in with leaves and plants. One special mantis is bright pink and looks like an orchid. The mantis is such a strange and engaging creature that many people keep them as pets. For many reasons, mantids have fascinated humans for many years. First, mantids show an amazing mastery of hunting skills. Mantids eat a wide variety of insects, including moths, crickets, bees, flies, grasshoppers, other mantids, and even, on occasion, small birds and snakes. They can capture prey many times larger than they are. Their powerful armor and amazing hunting skills make them quite effective. They have large powerful front legs, with spikes that help them hold on to prey. Their head can turn almost entirely around to follow prey without moving. Their front legs are so powerful and so fast that it is hard to see them move when capturing prey. One second their legs are empty and the next they are clutching tightly to something they have caught. Mantids are also stealthy. They wait, very still, very patiently for prey to come into sight. They also make slight swaying movements, to mimic leaves and grass moved by the wind. They focus intently on their victim. Then they pounce, suddenly, rarely missing their target. They are so successful they can triple in size every few months by molting when they outgrow their exoskeletons. They start out as nymphs, able to capture only prey that is smaller than they are. They end their lives about a year later becoming predators that can take down prey as large as hummingbirds. Finally, they are very personable, as far as insects go. They have a large, triangular-shaped head with large eyes. This alien-like appearance makes them quite cute. When you come across them in the garden, you can tell right away they are aware of you. They follow your movements as if to assess if you are either something to eat or something that will eat them. The little ones will accept rides on your finger if you are gentle. But be careful—they can jump surprisingly far even when small. If they think your freckle is prey, you may be surprised to find a mantis on your nose. As far as predatory insects go, the mantis is one of the most impressive. Gardeners love to find them in on vegetables because mantids eat many insects that damage crops. However, they may also eat some insects that help a gardener—like bees. Regardless, the mantis is a fascinating insect, and if you happen to see one hunting in the wild, consider yourself lucky. Read the following line from the text: As far as predatory insects go, the mantis is one of the most impressive. Gardeners love to find them in on vegetables because mantids eat many insects that damage crops. Based on the text, insects that are predatory are most likely which of the following? Collectors Hiders Hunters Imitators

Answers

In my best judgment, I think the answer is collectors. 

Answer:

C. Hunters

Explanation:

Because predators usually hunt which means they're hunters, stephanierose1p2s84o you were very close to the answer but just not they're yet

How does Alan Paton convey his views of South African society in Cry, the Beloved Country?

Answers

He puts the facts that he has so that people can see the truth.

Alan Paton conveys his views of South African society in Cry, the Beloved country, by depicting the kindness and support offered to Kumalo by Msimangu, Paton communicates the idea that the people of South Africa can overcome problems if they work together.

This is a story intended to be a social protest towards certain social structures that set themselves higher and stronger than others. In the story, white people are depicted as affected by 'native crime' whereas black people are illustrated as victims suffering from social instability, and the only way to resist this pressure is huddle with their tribes.

Other Questions
What is the measure of an angle that turns through 3/4 of a complete circle What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatctcatccagcattctgaaagggtaatgaataattattccgctgagttcatgaggtatccgaaggaggagcaacacttaggctataagagtatcatgcacatagatcgggataaatcgcctatcatatgtgacaacaatttcatgattaaaagt code for? Which is a pro-election of federal judges argument?A. When judges are elected they can be biased by party politics. B. When judges are elected there they can focus more time on reviewing law.C. Judges are more accountable to the people and what they think is just when they are elected Which statement displays an effect of developing a successful atomic bomb? Question 11 options: A.encouraged private sector employees to not share their discoveries with the government B.was the final time that the government and private sector combined to form any great invention C.served as a model for future government or private research and development labs to create innovationsD.proved that military innovation is always ahead of private innovation the graph shows the percentage of dog breeds affected by elbow dysplasia, which causes dogs to limp. What???s the most likely explanation for the mixed breed???s disease incidence? The probability is 0.2 that a person shopping at a certain store will What is the differecne of the following polynomials? (6x^2 - 3x^3) - (2x^3 + 4x^2 -5) Congratulations As you know, the position for which you are applying requires superlative problem-solving skills in a variety of arenas, and the ability to think critically on the fly is essential. To evaluate your ability in this area, the practical portion of the interview process consists of a series of locked-room puzzles. You will need to use all of your ingenuity to find the key to unlocking each room. There are six rooms total; four of the rooms will have individual time limits, while the remaining two rooms will be untimed. You will be observed by the interview team from a remote location, and your progress through the rooms will be recorded. For which type of communication would this paragraph be used?A)casual noteB)informal emailC)formal business If 1495 J of heat is needed to raise the temperature of a 337 g sample of a metal from 55.0C to 66.0C, what is the specific heat capacity of the metal? Evaluate the expression when a=15 and b=5. b2 ------------ = a + 5Help Do you think that humans and humpback whales share a common evolutionary lineage? Help Im really stuck and need help fastttttttt!!!!!!!? which is an example of circadian rhythm in plants? Which of the following bodies of water is located between the countries of Malaysia and Indonesia and connects the Pacific Ocean to the east with the Indian Ocean to the west? Bodies of Water in Eastern Asia (Points : 1) The Strait of Sunda The Strait of Malacca The Makassar Strait The Java Sea, Who ran as a third party candidate in the 1968 presidential election answer.com\? The Sixth Amendment states that in criminal prosecutions, people have the right to speedy trial with a How do the functions of the skeletal system relate to muscular system functions Help with a few health questions I really can't get??20. An inflammation of the tissue under the foot (fascia) caused by overuse and improper athletic footwear. Characterized by intense "start-up" pain under the heel bone: (1point) pronation plantar fasciitis *my answerosteoporosis osteoarthritis21. Personal and specific fitness objectives and plans are referred to as: (1point) specific goals health issues fitness goals *my answerrealistic goals24. A set of actions to offset counterproductive behaviors: (1point) motivations strategies behaviors changes What type of volcano will most likely form when intermittent eruptions of different intensities take place over a long period of time and layers of ash and lava pile up? Cinder volcano Composite volcano Cone volcano Shield volcano Write each statement as a proportion using colons. 4 is to 20 as 2 is to 10.