Simplify 4x(2x3-7x2+x)

Answers

Answer 1
To simplify this all you need to do is distribute the 4x across each term in the parenthesis
[tex]4x(2x^3 - 7x^2 + x) \\ (4x)(2x^3) - (4x)(7x^2) + (4x)(x) \\ 8x^4 - 28x^3 + 4x^2[/tex]

Related Questions

Natalie picked 135 berries in 15 minutes. If she continues picking at that rate, how many total minutes will it take her to pick 486 berries?


Can you please give a step by step explanation? Thank you.

Answers

It would take her around 37 minutes, I divided 486 by 195 and got 2.5, basically. I then timed that by 15 and got 37

NEED HELP ASAP

Which of the following expressions is equivalent to (-7)(-7)(-7)?

3 · -7
-7 · 3
(-7)3
3-7

According to the order of operations, which of the following operations should be completed first in the following expression?

2(5 - 3)^2 + 6^2

multiply (5 - 3) by 2
square (5 - 3)
simplify (5 - 3)
add (5 - 3) to 6^2

Select all that apply.

Which expressions are equal to "five to the third power"?

5^3
3 · 3 · 3 · 3 · 3
5 · 5 · 5
125
15
243
3^5

The expression -8 · -8 · -8 · -8 can be expressed as _____.

-8^4
(-8)^4
-(8^4)

What is the value of -6^2?

-36
36
-12
12


Find the value of |5| - 4(3^2 - 2).

-11
-33
7
-23

Evaluate 8 ÷ -2 · 4^2 + 9.

-100
-55
73
-23

Simplify -5^2 + 8|-1| + (-3).

30
14
-20
-36

Answers

1) (-7)3

2) PEMDAS; simplify (5-3)

3) 5^3, 5x5x5 and 125

4) -8^4

5) 36

6) 7

7) -100

8) 30

There ya go! Pretty sure they're all right!



Answer:

The answers are solved below.

Step-by-step explanation:

we have to solve the given expressions

Part A: The expression (-7)(-7)(-7)

[tex] (-7)(-7)(-7)=(-1)^37^3[/tex]

Option 3 is correct

Part B: [tex]2(5 - 3)^2 + 6^2[/tex]

First step to solve the above expression is to simplify (5-3) by BODMAS rule then to square the simplification.

Option 3 is correct.

Part C: To choose the expression  "five to the third power"

"five to the third power" is

[tex]5^3=5.5.5=125[/tex]

All 3 represents the expression  "five to the third power"

Option 1,3,4 are correct.

Part D: The expression -8 · -8 · -8 · -8

The above expression can be written as

[tex](-8)^4[/tex]

Option 2 is correct

Part E: [tex]\text{The value of } -6^2[/tex]

[tex]-6^2=-(6\times 6)=-36[/tex]

Option 1 is correct

Part F: [tex]\text{The value of } |5| - 4(3^2 - 2)[/tex]

[tex]|5| - 4(3^2 - 2)=5-4(9-2)=5-4(7)=5-28=-23[/tex]

Option 4 is correct.

Part G: Evaluate [tex]\frac{8}{ -2}\times 4^2 + 9[/tex]

[tex]\frac{8}{ -2}\times 4^2 + 9=-4\times 16+9=-64+9=-55{ [/tex]

Option 2 is correct.

Part H:  Simplify [tex]-5^2 + 8|-1| + (-3)[/tex]

[tex]-5^2 + 8|-1| + (-3)=-25+8-3=-17-3=-20[/tex]

Option 3 is correct.

Question 5 of 5 At 7:00 a.m., the temperature was 8°C. What was the temperature at midnight if the temperature was 10° lower? A. −18° C B. −2° C C. 2° C D. 18° C

Answers

The answer that's displayed above is B. -2 degrees

What is 56% written as a ratio?

Answers

56 written as a ratio is 56/100

That’s the proper fraction


If it asked for improper, it can be 56/10 or 56/1 etc
Hey there! :D

You can write it as:

56:100, since 56% is out of 100. 

Simplify it by 2. 

28:50 

14:25 <=== simplest ratio 

I hope this helps!
~kaikers

If s = 1 over 2 unit and A = 12s2, what is the value of A, in square units? ____ square unit(s). (Input whole number only.)

Answers

 For this case we have the following expression:
 [tex]A = 12s ^ 2 [/tex]
 Where, the value of s is given by:
 [tex]s = 1/2 [/tex]
 So, replacing values we have:
 [tex]A = 12 (1/2) ^ 2 [/tex]
 Rewriting we have:
 [tex]A = 12 (1/4) A = 12/4 A = 3 units ^ 2[/tex]
 Answer:
 the value of A, in square units is:
 3 square units

Answer:

The value of A is 3 square units.

Step-by-step explanation:

Given: [tex]s=\frac{1}[2}[/tex] unit  and A is given by [tex]A=12s^2[/tex]

We have to find the value of A.

Consider the given formula [tex]A=12s^2[/tex]

Put [tex]s=\frac{1}[2}[/tex]

We get,

[tex]A=12(\frac{1}{2})^2[/tex]

Simplify, we have,

[tex]A=12\cdot\frac{1}{4}[/tex]

Further simplify, we have,

[tex]A=3[/tex]

Thus, The value of A is 3 square units.

The stem-and-leaf plot represents the distances, in miles, people in an office drive to work each morning.

How many people drive 20 miles or fewer to work?



Enter your answer in the box.


Answers

The answer should be 7. 7 People drive 20 miles of fewer to work. 
You can tell, by looking at the number of numbers across from the "1" in the "Stem" section.
Hope this helps!:)
~Scarlett

Answer: it is 7.7

Step-by-step explanation:

trust me the person abuv me is right i did the quiz and got 100% i swear!

give them a round of applause! wooo i would give branliest but it dost let me.

if LuxRide's revenues in London grow by 20% next year, what will their market share be?

Answers

Answer: If this case, you would have to write an expression to represent their market share. It could be 1.2x.

Since we don't know the actual amount of their current market share, we will have to use a variable. Let x = their current market share.

The problem states that it will grow by 20% or 0.2. Therefore, we just need to multiply the current amount, x, by 1 plus the extra 20% or just 1.2.

what value is most affected by an outlier, the median or the ranhe? explain. can you see these effects in a dot plot

Answers

The range. An outlier is a set of data that changes the overall look of everything. Let's say you had the numbers 2, 3, 5, and 19.  19 is the outlier. To find the range, you subtract the largest number by the smallest, making the range of this set of numbers 17. If we didn't have 19, our range would be 3. The median would be 3, without the outlier, and with the outlier it would be 4. Hope this helps ;)

What is the area of 14km and 12km and 8km and 5km and 4km and 9km

Answers

To find area, you multiply the length and width together.

14km and 12km 
area = 14 x 12 = 168 square km

8km and 5km
area = 8 x 5 = 40 square km

4km and 9km
area = 4 x 9 = 36 square km

Final answer:

Calculate the sum of areas of squares with given side lengths to find the total area.

Explanation:

Area of a Square:

Calculate the area of each square:

14 km x 14 km = (14)² = 196 km²

12 km x 12 km = (12)² = 144 km²

8 km x 8 km = (8)² = 64 km²

5 km x 5 km =  (5)² = 25 km²

4 km x 4 km = (4)² = 16 km²

9 km x 9 km =  (9)² = 81 km²

Sum of Areas:

Add the areas of all squares together:

196 km² + 144 km² + 64 km² + 25 km² + 16 km² + 81 km² = 526 km²

Therefore, the total area is 526 km².

A cleaning company charges x dollars per hour to clean floors and y dollars per hour to clean the rest of a house.
-When the company spends 2 hours to clean floors and 3 hours to clean the rest of a house, the total charge is $84.
-When the company spends 1 hour to clean floors and 4 hours to clean the rest of a house, the total charge is $87.
Which ordered pair represents the hourly charges to clean floors and to clean the rest of the house?
A. (12, 20)
B. (15, 18)
C. (18, 15)
D. (20, 12)

Note: Please show work. My teacher checks it.

Answers

The answer is B. (15,18)

Solution:

First, let's set the variables first.

X = dollars per hour to clean the floor
Y = dollars per hour to clean the rest of the house

For the first statement, "2 hours to clean floors and 3 hours to clean the rest of a house, the total charge is $84"
We can put it into an equation.
         2X + 3Y = 84       ⇒    equation 1

For the first statement, "1 hour to clean floors and 4 hours to clean the rest of a house, the total charge is $87'
         X + 4Y = 87         ⇒    equation 2

Multiply first equation 2 by 2 to make the coefficient of both equations 1 and 2 the same.

Using elimination method in solving for x and y,

 
  (equation 1)              2X + 3Y = 84
  
 (equation 2)            2(X + 4Y) = 87   
                                    2X + 8Y = 174  
⇒ equation 3

Next, subtract equation 3 from equation 1.
            2X + 3Y = 84
      -   (2X + 8Y = 174)
        -------------------------
                  - 5Y = -90
                      Y = 18

Find X when Y = 18
@ equation 1  :    2X + 3Y = 84
                            2X + 3(18) = 84
                            2X + 54 = 84
                            2X = 84 - 54
                            2X = 30
                             X = 15
   
The answer is in ordered pairs of cleaning the floors and to clean the rest of the house. So, in the form (X,Y).

Answer: (15,18)

The hourly charges to clean floors and to clean the rest of the house are $15 and $18, respectively. We determine this by setting up a system of equations from the provided scenarios and solving for x and y.

To solve for the hourly charges to clean floors (x) and to clean the rest of the house (y), we need to set up two equations based on the information provided:

2x + 3y = 84 (from the first scenario)1x + 4y = 87 (from the second scenario)

Let's solve this system of equations step by step.

Step 1: From the second equation, we can express x in terms of y:
 x = 87 - 4y

Step 2: Substitute this expression for x in the first equation:
 2(87 - 4y) + 3y = 84

Which simplifies to:
 174 - 8y + 3y = 84

Combining like terms gives us:
 -5y = -90

Step 3: Solve for y:
 y = 18

Step 4: Now, plug the value of y back into the expression for x:
 x = 87 - 4(18)
 x = 15

Therefore, the hourly charges to clean floors and to clean the rest of the house are $15 and $18 respectively, which corresponds to option B. (15, 18).

Prove that the triangles shown below are similar and provide a similarity statement

Answers

The triangles are similar because two angles have the same measurements

Determine if the side lengths 2.1in,4in,7.9in form a triangle

Answers

Nope.

They don't meet the requirements of the triangle inequality.
2.1 + 4 = 6.1 < 7.9
The triangle inequality requires the sum of any two sides be greater than the third side.

Val’s go cart has a gas tank with the dimensions shown below. He uses a gas can that holds 1 gallon of gas, to fill the go cart tank. 1 gallon = 231 inched cubed

Answers


[tex]v = bh[/tex]

[tex]v = (15.4 \times 10) \times 3[/tex]

[tex]v = {462} \: inches \: ^{3} [/tex]

~~

[tex]462 \div 231 = 2[/tex]

~~

It will take 2 full gas cans to fill it up!!

~~

I hope that helps you out!!

Any more questions, please feel free to ask me and I will gladly help you out!!

~Zoey

can someone please help me i got stuck in this question

Answers

You could set up a ratio given that it is a 5% solution (5% of the total, not 5% of water.

5/100 = x/473 You need to find out how much is vinegar. Cross multiply
5 * 473 = 100 x  Find the number on the left.
2365 = 100 x Divide by 100
2365 / 100 = x 
x = 23.65 mL of vinegar.
The water is found by subtraction
473 - 23.65 = 449.35 mL of water.

Which of the following is the inverse of the statement "if I like carrots, then I like vegetables

Answers

If I don't like carrots, then I don't like vegetables 

Answer:

f I don't like carrots, then I don't like vegetables  

Step-by-step explanation:

Help me on this question

Answers

Infinite, because if you simplify the answer, you get 4x+3=4x+3
And that means anything can be a solution

Can somebody please help me, I’m stumped. Please explain easily to

Answers

You want to find the unit rate...how many miles in one hour. To do this we just divide the distance she walks by the time it takes her to walk that distance.

[tex]\sf 2\dfrac{1}{2}\div\dfrac{3}{4}[/tex]

Convert the mixed number into an improper fraction. We do this by multiplying the denominator to the whole number, adding it to the numerator, which becomes our new numerator, and we keep the denominator the same:

[tex]\sf \dfrac{5}{2}\div\dfrac{3}{4}[/tex]

When dividing fractions we flip(the reciprocal) the one we're dividing by and multiply:

[tex]\sf \dfrac{5}{2}\times\dfrac{4}{3}[/tex]

Multiply the numerators and denominators together:

[tex]\sf\dfrac{20}{6}[/tex]

Convert it back to a mixed number. Six goes into twenty three times. 6 * 3 = 18. 20 - 18 = 2. So we have 3 wholes and 2 left over, or:

[tex]\sf 3\dfrac{2}{6}[/tex]

We can simplify this further, divide 2 to the numerator and denominator of the fraction:

[tex]\boxed{\sf 3\dfrac{1}{3}}[/tex]

Help me asap please !!

Answers

Make a right triangle using the two given points as two of the points. 
One of the legs is 6 miles and the other leg is 5 miles. 
The pythagorean theorem states that a² + b² = c². 
a = 6 and b = 5. 
6² + 5² = c² 
Square 6 and 5. 
36 + 25 = c² 
Add the two together. 
61 = c² 
Find the square root of both. Since 61 is not a square number, leave it in radical form or you could approximate it. I gave it to the nearest hundredth. 
[tex] \sqrt{61} [/tex] = c OR 7.81 = c 
Hope this helps!

How do u solve 63=-9d?

Answers

-9d = 63
you divide both side by -9

sooo...

d = -7

A bag contains 8 blue marbles, 6 green marbles, 12 yellow marbles, and 10 orange marbles. A marble is drawn at random from the bag.

What is the probability that the marble drawn will not be blue?

A.) 29
B.) 34
C.) 79
D.) 78

Answers

Total number of marbles = 8 + 6 + 12 + 10 = 36

Number of marbles that aren't blue = 36 - 8 = 28

Hence the probability of not drawing a blue marble is [tex]\dfrac{28}{36}=\dfrac79[/tex]

Answer:

C

Step-by-step explanation:

I got it right and here is proof

If it is blurry, just press it and it will be non-blurry

write the next number in this pattern. 10, 11, 20, 21, 30, 31

Answers

The answer to that number pattern is 40,41,50,51
 The answer is 40,41 I mean it's not that hard to find the pattern.

What is an equation that represents 4 1/4 as a sum of whole numbers and unit fractions

Answers

Final answer:

The equation that represents 4 1/4 as a sum of whole numbers and unit fractions is simply 4 + 1/4. This approach demonstrates the decomposition of a mixed number into its integral and fractional components.

Explanation:

To represent 4 1/4 as a sum of whole numbers and unit fractions, we can break it down into its components. This fraction essentially means 4 plus 1/4. The whole number part is straightforward, and the fraction part can be represented as a unit fraction. Thus, 4 1/4 can be expressed as the sum 4 + 1/4.

In mathematics, when decomposing mixed numbers into a sum of whole numbers and fractions, it’s essential to clearly distinguish between the integral and fractional parts. For example, similar numbers like 5 1/3 would decompose into 5 + 1/3. This helps illustrate how mixed numbers can be broken into more straightforward components, making them easier to work with in various mathematical operations and providing a bridge to understanding fractional expressions and addition.

Answer:

  4 1/4 = 1 + 3 + 1/6 + 1/12

Step-by-step explanation:

You want an equation that represents 4 1/4 as the sum of whole numbers and unit fractions.

Whole numbers

The whole number portion of 4 1/4 is 4. The number 4 can be represented as a sum of whole numbers (plural) several ways:

  4 = 0 + 4
  4 = 1 + 3
  4 = 2 + 2

  4 = 0 + 1 + 3
  4 = 1 + 1 + 2

  4 = 1 + 1 + 1 + 1

Of course, any quantity of the whole number 0 can be added to any of these sums. We have shown a couple of instances of that.

In our answer here, we choose the representation to be 4 = 1 +3.

Unit fractions

A unit fraction is a fraction with a numerator of 1. In the mixed number 4 1/4, the fraction portion, 1/4, is already a unit fraction. The problem statement here asks for a representation involving "unit fractions" (plural). We can divide 1/4 into any number of equal unit fractions:

  1/4 = 1/8 + 1/8 . . . . 2 equal unit fractions

  1/4 = 1/12 + 1/12 + 1/12 . . . . 3 equal unit fractions

This latter representation suggests a way to use unequal unit fractions to represent 1/4:

  1/4 = (1/12 + 1/12) +1/12 = 2/12 +1/12 = 1/6 +1/12

Using these two unit fractions, our equation can be written ...

  4 1/4 = 1 + 3 + 1/6 + 1/12

A baseball has a diameter of 5.1 inches. Find the volume of the baseball. Round your answer to the nearest tenth. Use 3.14 for pi

Answers

The volume of the baseball is 65.8

r = 1/2 d
r = 1/2 5.1
r = 2.505

V = 4/3 π r^3 
V = 4/3 π 2.505^3
V = 65.8


I hope this helps!

the number of club members is at least 25

Answers

i think your answer is

x(number of club members) is equal(=) or larger(>) to 25

im not sure its right though

how long will it take for the pool to completely full with water? (explain why so i understand)

Answers

First, you find out how much can be filled in 1 minute. Then you divide that into 120 to get your answer. 
To find out how much can be filled in 1 minute, take the time and divide it into the volume. We'll use the second row (2 minutes and 8 gallons.)
8/2=4. So it takes 1 minute to fill 4 gallons. Now, you just divide 4 into 120. 
120/4=30
It takes 30 minutes to fill the pool up to 120 gallons. 
120 it the awnser ok

One ounce is about the same as 0.06 pound. What is 0.06 written as a fraction?

Answers

Answer:

[tex].06 = \frac{6}{100} = \frac{3}{50} [/tex]

Find the length of the leg of a 16 90 45 triangle

Answers

This question is missing information. You probably meant a 30°-60°-90° triangle or a 45°-45°-90° triangle. Get back to me.

compare the amount of sand in the top cone of the hourglass to the amount there will be when the height of the sand in the top cone is only one inch.

Answers

Final answer:

To compare the amount of sand in the top cone of an hourglass when the height is one inch, calculate the volume using the formula volume = length × width × height. Compare the original volume to the new volume with a height of one inch to determine the difference in the amount of sand.

Explanation:

The question asks to compare the amount of sand in the top cone of an hourglass to the amount when the height of the sand in the top cone is only one inch. In an idealized model of the hourglass, the volume of the stack of sand in the top cone can be calculated using the formula volume = length × width × height. From the given information, the volume of the stack is 9 in³. To find the amount of sand when the height is one inch, we can calculate the new volume using the same formula with the new height.

Original volume of stack = length × width × height = 9 in³New volume of stack with a height of one inch = length × width × 1 in.

By comparing the original volume of 9 in³ to the new volume with a height of one inch, you can determine the difference in the amount of sand in the top cone of the hourglass.

Learn more about hourglass sand amount here:

https://brainly.com/question/13368190

#SPJ12

The amount of sand in the top cone when the height of the sand is h is h times the amount of sand there will be when the height of the sand is only one inch.

The volume of a cone is given by the formula:

V = (1/3)πr²h

where r is the radius of the base of the cone and h is the height of the cone.

If the height of the sand in the top cone is currently h, then the volume of the sand in the top cone is:

V₁ = (1/3)πr²h

When the height of the sand in the top cone is only one inch, the volume of the sand in the top cone will be:

V₂ = (1/3)πr²(1 inch)

To compare the two volumes, we can divide V₁ by V₂

V₁ / V₂ = (1/3)πr²h / (1/3)πr²(1 inch)

V₁ / V₂ = h / 1 inch

Therefore, the amount of sand in the top cone when the height of the sand is h is h times the amount of sand there will be when the height of the sand is only one inch.

For such more question on height

https://brainly.com/question/28990670

#SPJ6

What is the area of sector​ GPH? the angle inside the circle measures 80º and the radius from p to h is 15

Answers

area = π r²

area of the required sector = (80/360) π * 15²
                                           ≈ 157.08

Answer:

The area of sector GPH is equal to [tex]50\pi\ units^{2}[/tex]

Step-by-step explanation:

we know that

The area of a circle is equal to

[tex]A=\pi r^{2}[/tex]

we have

[tex]r=15\ units[/tex]

substitute

[tex]A=\pi(15)^{2}=225 \pi\ units^{2}[/tex]

[tex]360\°[/tex] subtends the complete circle of area [tex]225 \pi\ units^{2}[/tex]

so

By proportion

Find the area of sector GPH

[tex]\frac{225 \pi}{360}\frac{\ units^{2} }{degrees} =\frac{x}{80}\frac{\ units^{2} }{degrees}\\ \\x=80*225\pi /360\\ \\x=50\pi\ units^{2}[/tex]

Could anyone help me with these?

Answers

Part A:

Derrick is incorrect.
A yard is equivalent to 3 feet.
Thus, 20 yards will be equivalent to 60 feet.

The width is 20 yard and 2 feet. It's the same as 60 feet and 2 feet, or 62 feet. Thus, Derrick is incorrect.

Part B:

Let's calculate the area of the parking lot.

We know the width is 62 feet from part A.
The length is 30 yards, or 90 feet.

Multiply the length and width to get the area in square feet.

[tex]90 \times 62=5580[/tex]

The parking lot has an area of 5580 square foot.
It costs 2 dollars per square foot to repave the parking lot. Multiply the area by 2 dollars.

[tex]5580 \times 2=11160[/tex]

It will cost $11,160 to repave the whole parking lot.
Part A) Derrick is wrong because 1 yd = 3ft he just add the yd and the ft as if they were the same
The correct answer is the 20yd and 2ft = 62ft

Part B) Based on my first answer of there being 62 ft in the parking lot i would say all you had to do is multiply 62 by 2 which is 124
Your answer is $124

I hope I helped if so mark me as brainliest
Other Questions
What is the measure of an angle that turns through 3/4 of a complete circle What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatctcatccagcattctgaaagggtaatgaataattattccgctgagttcatgaggtatccgaaggaggagcaacacttaggctataagagtatcatgcacatagatcgggataaatcgcctatcatatgtgacaacaatttcatgattaaaagt code for? Which is a pro-election of federal judges argument?A. When judges are elected they can be biased by party politics. B. When judges are elected there they can focus more time on reviewing law.C. Judges are more accountable to the people and what they think is just when they are elected Which statement displays an effect of developing a successful atomic bomb? Question 11 options: A.encouraged private sector employees to not share their discoveries with the government B.was the final time that the government and private sector combined to form any great invention C.served as a model for future government or private research and development labs to create innovationsD.proved that military innovation is always ahead of private innovation the graph shows the percentage of dog breeds affected by elbow dysplasia, which causes dogs to limp. What???s the most likely explanation for the mixed breed???s disease incidence? The probability is 0.2 that a person shopping at a certain store will What is the differecne of the following polynomials? (6x^2 - 3x^3) - (2x^3 + 4x^2 -5) Congratulations As you know, the position for which you are applying requires superlative problem-solving skills in a variety of arenas, and the ability to think critically on the fly is essential. To evaluate your ability in this area, the practical portion of the interview process consists of a series of locked-room puzzles. You will need to use all of your ingenuity to find the key to unlocking each room. There are six rooms total; four of the rooms will have individual time limits, while the remaining two rooms will be untimed. You will be observed by the interview team from a remote location, and your progress through the rooms will be recorded. For which type of communication would this paragraph be used?A)casual noteB)informal emailC)formal business If 1495 J of heat is needed to raise the temperature of a 337 g sample of a metal from 55.0C to 66.0C, what is the specific heat capacity of the metal? Evaluate the expression when a=15 and b=5. b2 ------------ = a + 5Help Do you think that humans and humpback whales share a common evolutionary lineage? Help Im really stuck and need help fastttttttt!!!!!!!? which is an example of circadian rhythm in plants? Which of the following bodies of water is located between the countries of Malaysia and Indonesia and connects the Pacific Ocean to the east with the Indian Ocean to the west? Bodies of Water in Eastern Asia (Points : 1) The Strait of Sunda The Strait of Malacca The Makassar Strait The Java Sea, Who ran as a third party candidate in the 1968 presidential election answer.com\? The Sixth Amendment states that in criminal prosecutions, people have the right to speedy trial with a How do the functions of the skeletal system relate to muscular system functions Help with a few health questions I really can't get??20. An inflammation of the tissue under the foot (fascia) caused by overuse and improper athletic footwear. Characterized by intense "start-up" pain under the heel bone: (1point) pronation plantar fasciitis *my answerosteoporosis osteoarthritis21. Personal and specific fitness objectives and plans are referred to as: (1point) specific goals health issues fitness goals *my answerrealistic goals24. A set of actions to offset counterproductive behaviors: (1point) motivations strategies behaviors changes What type of volcano will most likely form when intermittent eruptions of different intensities take place over a long period of time and layers of ash and lava pile up? Cinder volcano Composite volcano Cone volcano Shield volcano Write each statement as a proportion using colons. 4 is to 20 as 2 is to 10.