Statistically, who is at greatest risk for committing suicide?
a. ​sue, a 30-year-old japanese american female
b. ​star, a 35-year-old native american female
c. ​stuart, a 65-year-old white male
d. ​bobby, a 14-year-old african american male

Answers

Answer 1

d. bobby a 14 year old boy



Related Questions

Honor-killings generally involve death by _________ for a shaming offense.

Answers

honor killings generally involve death by family members for a shaming offense.

If the biochemical oxygen demand (bod) of a lake is very high, how will that affect the aquatic life in the lake? view available hint(s) if the biochemical oxygen demand (bod) of a lake is very high, how will that affect the aquatic life in the lake? there will be more oxygen available for the aquatic life but much less oxygen available to the microbial populations. there will be less oxygen available for the aquatic life due to the microbial activity. there will be more oxygen available for the aquatic life due to the microbial activity. the bod does not have an impact on available oxygen in the lake.

Answers

The answer is ‘there will be less oxygen available for the aquatic life due to the microbial activity’. Too much microbial activity utilizes the oxygen dissolved in the water hence making the waters anoxic. This occurs especially after algae blooms. When the algae grow exponentially and later die, microbes that oxidize the organic matter for energy utilize the oxygen and cause dissolved oxygen in the water to deplete. This hence suffocates other aquatic life.






About 88 percent of geologic time is represented by the time span called the ________ era. paleozoic phanerozoic mesozoic precambrian

Answers

About 88 percent of geologic time is represented by the time span called the precambrian era.

About 88 percent of geologic time is represented by the time span called the Precambrian era.

What is Precambrian era?

The Precambrian era is the largest span of geologic time, representing roughly 88 percent of Earth's history. It encompasses the time period from the formation of the planet, approximately 4.6 billion years ago, to the beginning of the Cambrian period, approximately 541 million years ago.

During this era, the Earth's atmosphere and oceans formed, and the first life forms appeared. Despite its significance, the Precambrian era is poorly understood due to a lack of fossil evidence and a scarcity of geological record. Nevertheless, it remains a crucial period in Earth's history that laid the foundation for the development of life and the evolution of the planet.

Learn more about Precambrian era, here:

https://brainly.com/question/1698817

#SPJ6

According to skinner, biology is important because 1. every type of organism is subject to a unique learning process. 2. it determines an organism's range of potential responses. 3. most important behaviors of an organism are innate. 4. it determines an organism's appearance. 5. the genetic contributions of the parents vary between organisms within a species

Answers

5. The genetic contributions of the oarents vary between organisms within a species

Determine the effect of each ocean process on the salinity of the ocean.

Answers

Ocean Salinity Increases:

Ocean water evaporates.

Sea ice forms.


Ocean Salinity Decreases:

A freshwater stream enters the ocean.

Sea ice melts.


Ocean water evaporates and sea ice is forms when ocean salinity increases .When Ocean Salinity Decreases a freshwater stream enters the ocean and sea ice melts.

What is the effect of increasing salinity of ocean?

With increase in salinity , the freezing point decreases which meaning that ocean with higher salinity has less potential to form sea ice and therefore remains ice free at much lower temperatures.

What is the effect of decrease salinity of ocean?

With decrease in salinity it would be difficult to adding fresh streams and also the sea ice will melt .

To learn more about Ocean , here

https://brainly.com/question/16237714

#SPJ2

Glacial grooves and striations are scratches or gouges in bedrock created when?

Answers

These scratches and gouges are usually created by a moving glacier, another term would be glacial abrasion. Scratches were formed when boulders and gravel get trapped under the ice. These are best seen after rain and through a low-angle light.
Answer:

These scratches and gouges are usually created by a moving glacier; another term would be glacial abrasion. Scratches were formed when boulders and gravel get trapped under the ice. These are best seen after rain and through a low-angle light. Glacial grooves and striations are gouged or scratched into the bedrock as the glacier moves downstream. Boulders and coarse gravel get trapped under the glacial ice and abrade the land as the glacier pushes and pulls them along.

In a particular ecosystem, the climate undergoes a gradual change, resulting in increased rainfall. Mosquitoes living in the ecosystem depend on water for reproduction. How will this climatic change most likely affect the mosquitoes in this ecosystem?

Answers

there will be an increased amount of mosquitoes 
hope it helps
please mark as brainliest

It will lead to an increase in the mosquito population.

Use the phylogenetic tree to the right to choose the true statement below.

Crocodiles are more closely related to amphibians than to primates.

Ray-finned fish evolved before sharks.

Rodents and rabbits are most closely related to primates.

Amphibians are more closely related to ray-finned fish than to primates.
Image of phylogenetic tree

Answers

The phylogenetic tree is a graph that shows the evolutive history of different lineages and how the groups are related to each other. The correct option is 3) Rodents and rabbits are most closely related to primates.      

Note: Since I do not have the image, I will provide you with a phylogenetic tree with the animals mentioned among the options. I suggest you compare this tree with yours and check if it turns to be similar.

The phylogenetic tree is a graph composed of,

Lineages → The taxonomic groups of interest. These are placed in the extremes of the branches.  

Nodes → These are the ramification points, which are also known as divergence points. They represent the location of the most recent common ancestor.  

Root → This is the older common ancestor that all lineages share. The first one in the tree.  

Highly related groups that share a recent common ancestor. This means that they all diverge from the same node.

Lineages less related to each other are those whose common ancestor is far away in history.  

What we need to know is that two species are more related if they have a recent common ancestor.

On the other hand, two species will be less related if their common ancestor is not a recent one and is located far away in the tree.

Options:

1) Crocodiles are more closely related to amphibians than to primates.

FALSE. Crocodiles are more related to mammals. They share a more recent common ancestor with primates than with amphibians.

2) Ray-finned fish evolved before sharks.

FALSE. Ray-finned fishes are bony animals, so they evolved after sharks, which are cartilaginous fishes. You can see sharks placed before Ray-finned fishes in the tree.

3) Rodents and rabbits are most closely related to primates.

TRUE. First of all, they are all mammals, meaning they belong to the same monophyletic group. Second, they share a recent common ancestor, which suggests they are more related to each other than to any other group.  

4) Amphibians are more closely related to ray-finned fish than to primates.

FALSE. Amphibians are equally related to ray-finned fish and primates.  They share a recent common ancestor with ray-finned fish and a common ancestor with primates. The difference is that ray-finned fish evolved first, then amphibians, and finally mammals.

You can learn more about phylogenetic trees at the following links

https://brainly.com/question/22693415?referrer=searchResults

https://brainly.com/question/16312582?referrer=searchResults

Answer: c is the answer

Explanation:

i just did it

An impulse travels through the structures of the neuron in which order?

Answers

endrites, cell body, and axon

Which structure in the cheek cell did you observe that separates and protects the cell from the environment?

Answers

The answer is epithelium. In particular, stratified squamous epithelium. Epithelium is protective tissue that is found on the outer surfaces of organs and  blood vessels and inner surfaces of cavities in many internal organs. Epithelium contains no blood vessels, and nutrients reach the epithelial cells through diffusion from the underlying tissue.

Which is a point mutation?
frameshift
insertion
deletion
missense

Answers

This would actually be very dependable. The point of a mutation would actually be known to be both "deletion" and also "insertion". But, from search and understanding, this would be known more to actually be "deletion" than anything else of this matter due to the point of mutation.

The best example of point mutation is Missense.

Point of mutation is termed as single nucleotide which its base are either deleted, inserted or changed from frequency of RNA or DNA.

It has variety of effects which are found on the downstream for the product of protein.

It occurs when there is replication of DNA.

"a patient is brought to the emergency department with decreased respirations and somnolence. the nurse notes a heart rate of 60 beats per minute and a blood pressure of 80/58 mm hg. the patient is known to take alprazolam (xanax) to treat anxiety. which medication will the nurse anticipate the provider to order?"

Answers

This is a case of benzodiazepine overdose from Alprazolam (Xanax). Benzodiazepine overdose presents mostly with inhibition of the central nervous system including the brainstem (hence explaining the decreased respiratory rate and somnolence) as well as systemic effects such as decrease in heart rate and in blood pressure. The antidote for benzodiazepine overdose is Flumenazil which is a selective benzodiazepine receptor antagonist and prevent further binding and action of the administrated benzodiazepine. 

Dna has unique properties that allow it to accurately retain genetic information, even after multiple rounds of replication. one aspect of dna that allows it to accurately store genetic information is the base pairing from chargaff\'s first rule of the four nucleotide bases. if the a content of a dna molecule is 16%, what are the percentages of the remaining bases?

Answers

There are four different bases that make the DNA molecule:
Adenine, Cytosine, Guanine, and Thymine.
Due to chemical properties of the bases, there are two pairs of bases that are complementary, Adenine and Thymine and Guanine and Cytosine.
So, if we have 16% of Adenine, there must be the same amount of Thymine, since they only appear in a pair.
16% of Adenine + 16% of Thymine - 32 %
the rest of the abundance of the bases can be calculated by subtracting the 32% out of the 100%: 100-32 = 68
So, Guanine and Cytosine make up 68% of the bases, and a half of that number is the amount each of the bases has in the total amount. 68/2= 34
16% Adenine -  16% Thymine
34% Guanine - 34% Cytosine 


A closed system can experience an increase in entropy only when irreversibilities are present within the system during the process

Answers

(c) One corollary of the second law of thermodynamics states that the change in entropy of a closed system must be greater than zero or equal to zero. (d) A closed system can experience an increase in entropy only when irreversibilities are present within the system during the process.

Which of the following statements about change in ecosystems is true?

a.Ecosystems experience change through human activity only.

b.Ecosystems experience change through natural events only.

c.Ecosystems experience no change.

d.Ecosystems experience change through human activity and natural events.

Answers

Ecosystems experience change through human activity and natural events. This is because human activity can impact changes in nature, like climate for example. As a result, ecosystems change in response to the change in nature or natural events, which was caused by human activities. They are interrelated so to speak.  
Answer: D

Just did the assignment.

Directional selection only occurs in response to naturally occurring events. Please select the best answer from the choices provided T F

Answers

This is false

This selection and variation happens more gradually. It is hard to notice over a short period of time. The change is slow, constant and consistent. In punctuated equilibrium, the changes come in spurts. There are periods wherein a huge change occurs and there are also periods with very little change. The mutation is at random. Genetic drift is the change in the frequency of a gene variant due to a random sampling of organisms.

Directional selection does not occur in response to naturally occurring events. Hence, it is false.

What is directional selection?

When those with qualities that are on one side of the population's mean survive longer or reproduce more than those on the other, this is known as directional selection. It has been repeatedly shown in wild populations using both experimental and observational methods.

When exposed to environmental changes, a population's genetic variation shifts towards a new phenotype, which is known as directional selection.

When natural selection favors two or more extreme phenotypes that each have a distinct advantage, this process is known as 'diversifying' or 'disruptive selection,' which increases genetic diversity. Hence, this statement is false.

Learn more about directional selection, here:

https://brainly.com/question/12226774

#SPJ2

Suppose you are on a remote island known to have mice that carry either s. aureus or
e. coli. a mouse bites you and you develop an infection. there is no biology lab on the island, but there is a supply of antibiotics. you can only take one antibiotic because taking more than one will make you very sick from the drug interactions. which antibiotics would be the most effective for fighting the unidentified infection

Answers

Penicillin, is a antibiotic that fights bacteria which is most likely that rat infection would contain.

Answer:

You should take the penicillin and neomycin.

Explanation:

Neomycin is an antibiotic that has been shown to be effective in combating gram-negative bacteria, including Staphylococcus aureus (S. aureus). This antibiotic is also used to treat some skin, liver or intestinal infections. Penicillin, in turn, is another effective antibiotic for fighting Escherichia coli (E. coli). It can also be used to treat ear, throat, and urine infections, as well as treating pneumonia, sinusitis, rheumatic fever, meningitis, among others.

What's a fossil that's formed when an outline of the original organism is formed from left-over carbon?

Answers

Hi!

The answer is "Carbon films"

Hope this helps!

-Payshence xoxo

three examples of biomass sources used to produce biopower

Answers

Biomass might literally mean a biological mass, but it actually denotes sources that are burned to produce energy. Biomass is considered a renewable energy source. The primary one that has been used for thousands of years is wood; it is still widespread in many primitive areas and it is burned in old and new burners. Biofuels like ethanol from crops is another important source that has been on a rise. They are cheap and they are used a lot in developing countries. Finally, the burning of municipal waste is another source and many Nordic countries use it to produce energy and even some import waste to use as fuel.

Which can associate a suspect's gun with a crime?

Answers

The bullt casing became each gun affects a bullt in a different way

Final answer:

Forensic techniques, such as fingerprint analysis, matching gun descriptions, and knowledge of altered serial numbers, are used to associate a suspect's gun with a crime.

Explanation:

To associate a suspect's gun with a crime, law enforcement can use a variety of forensic techniques. The presence of a suspect's fingerprints on a gun can indicate ownership or use, but does not necessarily prove they committed a crime with it. It's possible, as in the scenario described, that someone else could have stolen the gun and used it in a crime, hence simply finding Jeremy's prints on his own gun doesn't conclusively show he killed Tim.

Furthermore, if the gun found at a crime scene matches the description of a gun owned by a suspect, such as a 9mm Beretta PX4 Sub-Compact, this could be a compelling piece of circumstantial evidence. However, if a witness like Isabel cannot reliably distinguish between gun models, her testimony may not be definitive. Courts look for additional evidence such as the knowledge of altered serial numbers, which the Indiana Court of Appeals ruled on, deeming the defendant's week-long possession and the gun's altered appearance sufficient for a juror to infer knowledge of the crime.

What influences the appearance and function of skeletal muscle?

Answers

Myopathies is the term of the disease of skeletal muscles. The responsible for muscle contraction are the interaction of myosin and actin. The responsible for the striated appearance of skeletal muscle, and forms the basic machinery necessary for muscle contraction is called sarcomere.

How do you think bones, muscles and joints work together to move the body?

Answers

Together our bones, muscles and joints form our musculoskeletal system and enable us to do everyday physical activities.

PLZ HELP!!!! I'LL GIVE BRAILLIEST!!!


How does a tobacco mosaic virus reproduce???

Answers

Tobacco mosaic virus (TMV) is a simple rod-shaped helical virus that contains single stranded RNA situated at its middle and is surrounded by a protein coat called capsid. After tobacco mosaic virus enters its infected host cells through mechanical inoculation, it removes its capsid to release its single stranded viral nucleic acid which is then transported into the nucleolus. The single stranded viral RNA actuates the production of specific enzymes (RNA polymerases) and it also produces another RNA strand (replicative RNA). The new viral-RNAs are transported from the nucleus into the cytoplasm and functions as messenger-RNAs (mRNAs). Each mRNA, ribosomes, and t-RNA, of the infected host cell all controls the production of protein subunits (capsomeres). After the production of the preferred capsomeres, the new viral-RNAs arrange the capsomeres around it which lead to the production of a complete virus particle (virion). The viruses then migrate from one cell to another. Hence, creating organized infection.

Answer:

Replication. TMV enters the plant cell through minor wounds. Once TMV enters the cell, the virus particles disassemble in an organized manner to expose the TMV RNA. The virus RNA is positive-sense, or "+ sense", and serves directly as a messenger RNA (mRNA) that is translated using host ribosomes.

Explanation:

theres your answer.

Which process is the one in which glucose is oxidized to generate two molecules of pyruvate and in which atp and nadh are produced?

Answers

it is Glycolysis.
a word from (Glyco from glucose), (lysis from breaking)

Glycolysis is the one in which glucose is oxidized to generate two molecules of pyruvate and in which atp and nadh are produced.

What is glycolysis?

Glycolysis is the metabolic pathway that converts glucose into pyruvate. The free energy released in this process is used to form the high-energy molecules adenosine triphosphate and reduced nicotinamide adenine dinucleotide.

Glycolysis is a cytoplasmic pathway which breaks down glucose into two three-carbon compounds and generates energy. Glucose is trapped by phosphorylation, with the help of the enzyme hexokinase.

Glycolysis is the first step in the breakdown of glucose to extract energy for cellular metabolism. Glycolysis consists of an energy-requiring phase followed by an energy-releasing phase.

Learn more about glycolysis:

https://brainly.com/question/29604117

#SPJ6

Describe the relationship between fungal structure

Answers

Fungi are more related to animals than plants because they are not photosynthetic. They can be harmful because they do not respond to traditional antibiotic but they are also commercially beneficial especially in the food industry that uses yeast like baking, brewing and cheese and wine making. The pileus is the term given to the cap-like structure of the fungi. It supports the spore-bearing surface which is the hymenium which consists of lamellae, tube or teeth on the underside of the pileus. Annulus is the ring-like structure found in the stipes of some species of mushroom and is a remnant of the partial veil. Stipe is the stem or stalk of the mushroom that supports the cap of the mushroom. Volva is the caplike structure found at the base of the fungi which is a remnant of the universal veil. Hypha is the long, branching, filamentous structure of a fungus that is the main mode of vegetative growth. Each fungus has a vast number of these hyphae which are intertwined to make a tangled web called mycelium. Through mycelium, fungus absorb nutrients from its environment. 

In the following food chain which organism receives the least amount of energy plant=> mouse=> snake=> owl

Answers

The organism that receives the least amount of energy is the owl.

The organism that will receive the least amount of energy would be the owl.

Energy transfer in food chains

Only about 10% of the energy present at one trophic level of food chains is transferred to the next while the remaining energy is lost as heat to the surroundings.

Thus, as we move up the trophic level, the amount of energy received by the organisms decreases.

Hence, in the illustrated food chain, Owl being at the highest level would be the one to receive the least amount of energy.

More on food chains can be found here: https://brainly.com/question/6947412

#SPJ2

You are performing chemical tests on a sample of fatty acid. you find that you cannot hydrogenate the sample, leading you to suspect that it is

Answers

You are performing chemical tests on a sample of fatty acid. you find that you cannot hydrogenate the sample, leading you to suspect that it is saturated. 

What can be said about the relationship between enzymes and proteins? a few enzymes are proteins. no enzymes are proteins. a few enzymes contain proteins. all enzymes are proteins. all enzymes contain proteins. most enzymes are proteins?

Answers

All enzymes are protein in nature

Final answer:

Most enzymes are proteins that act as biological catalysts, speeding up chemical reactions with high specificity. While all enzymes are proteins, not all proteins act as enzymes, as they have a variety of functions. Some enzymes, known as metalloenzymes, contain metal ions that are essential to their function.

Explanation:

When discussing the relationship between enzymes and proteins, it is important to recognize that most enzymes are indeed proteins. These biological catalysts are composed of long chains of amino acids that fold into specific three-dimensional structures, determining their activity and functionality. Enzymes specialize in speeding up chemical reactions within cells, and they do so with remarkable precision and specificity; each enzyme typically catalyzes only one or a few chemical reactions. While all enzymes are proteins, not all proteins are enzymes, since proteins have a wide variety of functions including structural roles, such as in cell shape and muscle tissues, as well as in transporting molecules and replicating DNA.

Additionally, it's worth noting that while most enzymes are purely protein in nature, some are metalloenzymes, which are metalloproteins that act as enzymes. These metalloenzymes have one or more metal ions that are necessary for their catalytic activity, further illustrating the diverse nature of enzymes. Therefore, the correct statement regarding the relationship between enzymes and proteins is that most enzymes are proteins.

What risk factors predispose paul to a myocardial infarction?

Answers

1. What risk factors predispose Paul to a myocardial infarction? Some risk factors that predispose Paul to myocardial infarction are that he is obese, smokes, and seems to be stressed. He also has a family history of hypertension.2. Explain the physiological basis of Paul’s elevated serum lactate and lactate dehydrogenase concentrations. These lactate levels can become elevated when more is produced by the body than what is being used. When the heart is under a form of duress and not functioning normally, many things become affected including irregular oxygen levels and lactate levels. 3. Explain why Paul is given an aspirin to chew on the way to the hospital. Paul is given an aspirin because it helps to minimize blood clotting. His initial signs conveyed that his condition was probably cardiac related, in which it is important to minimize any possible blood clotting.4. If Paul’s MI results from occlusion of the circumflex coronary artery only, where would you expect to find the myocardial lesion in a PET scan of the heart? An occlusion is a blockage. A coronary artery regulates blood flow. The circumflex coronary artery regulated blood flow on left side of heart.

The risk factors are those that are associated with a greater probability of suffering a myocardial infarction are:

High blood pressure, high cholesterol levels, coronary artery disease, tobacco use, obesity and sedentary lifestyle.

What is a myocardial infarction?

It is a situation that is characterized by the sudden appearance of a picture of ischemic suffering (lack of irrigation) to a part of the heart muscle caused by the obstruction of the coronary arteries.

Characteristics of a myocardial infarction

The infarction is recognized by the sudden onset of intense pain in the chest, in the precordial area, a feeling of general malaise, dizziness, and sweating.

Myocardial infarctions appear in people who have so-called risk factors.

The risk factors are, apart from a certain family predisposition and age, smoking, high blood pressure, diabetes and changes in blood fats (cholesterol).

Therefore, we can conclude that myocardial infarction is caused by insufficient blood supply to the heart and whose risk factors include obesity, high cholesterol levels.

Learn more about myocardial infarction here: https://brainly.com/question/1373449

Patient has a suspicious lesion of the right axilla. the area was infiltrated with local anesthetic and prepped and draped in a sterile fashion. with the use of a 3 mm punch tool the lesion was excised and closed with 5.0 prolene suture. pathology report indicated this was a seborrheic keratosis. what cpt® and icd-10-cm codes are reported?

Answers

11400, 702.19

- CPT 11400  coded as Excision, benign lesion, except skin tag (Only of listed elsewhere), trunk, arms or legs; lesion diameter 0.5 cm or less.

this code should only be used when the excision is in full thickness lesion removal that includes the margins, and also including of simple closures. 

- ICD-9-CM Diagnosis Code 702.19 - other Seborrheic Keratosis.
Final answer:

The correct billing codes for the excision of a seborrheic keratosis lesion are 11300 (CPT) and L82.1 (ICD-10-CM).

Explanation:

The clinical procedure portrayed in the question involves excision of a seborrheic keratosis with a 3 mm punch tool. The Correct Procedural Terminology (CPT) for this process would be 11300, which is the code for Shaving of epidermal or dermal lesion, single lesion. The lesion is located over the right axilla. The International Classification of Diseases (ICD-10-CM) for a seborrheic keratosis lesion is L82.1. These codes are important since they are used in medical billing to explain the diagnosis and the procedures carried out.

Learn more about Medical Coding here:

https://brainly.com/question/10823807

#SPJ3

Other Questions
What is the measure of an angle that turns through 3/4 of a complete circle What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatctcatccagcattctgaaagggtaatgaataattattccgctgagttcatgaggtatccgaaggaggagcaacacttaggctataagagtatcatgcacatagatcgggataaatcgcctatcatatgtgacaacaatttcatgattaaaagt code for? Which is a pro-election of federal judges argument?A. When judges are elected they can be biased by party politics. B. When judges are elected there they can focus more time on reviewing law.C. Judges are more accountable to the people and what they think is just when they are elected Which statement displays an effect of developing a successful atomic bomb? Question 11 options: A.encouraged private sector employees to not share their discoveries with the government B.was the final time that the government and private sector combined to form any great invention C.served as a model for future government or private research and development labs to create innovationsD.proved that military innovation is always ahead of private innovation the graph shows the percentage of dog breeds affected by elbow dysplasia, which causes dogs to limp. What???s the most likely explanation for the mixed breed???s disease incidence? The probability is 0.2 that a person shopping at a certain store will What is the differecne of the following polynomials? (6x^2 - 3x^3) - (2x^3 + 4x^2 -5) Congratulations As you know, the position for which you are applying requires superlative problem-solving skills in a variety of arenas, and the ability to think critically on the fly is essential. To evaluate your ability in this area, the practical portion of the interview process consists of a series of locked-room puzzles. You will need to use all of your ingenuity to find the key to unlocking each room. There are six rooms total; four of the rooms will have individual time limits, while the remaining two rooms will be untimed. You will be observed by the interview team from a remote location, and your progress through the rooms will be recorded. For which type of communication would this paragraph be used?A)casual noteB)informal emailC)formal business If 1495 J of heat is needed to raise the temperature of a 337 g sample of a metal from 55.0C to 66.0C, what is the specific heat capacity of the metal? Evaluate the expression when a=15 and b=5. b2 ------------ = a + 5Help Do you think that humans and humpback whales share a common evolutionary lineage? Help Im really stuck and need help fastttttttt!!!!!!!? which is an example of circadian rhythm in plants? Which of the following bodies of water is located between the countries of Malaysia and Indonesia and connects the Pacific Ocean to the east with the Indian Ocean to the west? Bodies of Water in Eastern Asia (Points : 1) The Strait of Sunda The Strait of Malacca The Makassar Strait The Java Sea, Who ran as a third party candidate in the 1968 presidential election answer.com\? The Sixth Amendment states that in criminal prosecutions, people have the right to speedy trial with a How do the functions of the skeletal system relate to muscular system functions Help with a few health questions I really can't get??20. An inflammation of the tissue under the foot (fascia) caused by overuse and improper athletic footwear. Characterized by intense "start-up" pain under the heel bone: (1point) pronation plantar fasciitis *my answerosteoporosis osteoarthritis21. Personal and specific fitness objectives and plans are referred to as: (1point) specific goals health issues fitness goals *my answerrealistic goals24. A set of actions to offset counterproductive behaviors: (1point) motivations strategies behaviors changes What type of volcano will most likely form when intermittent eruptions of different intensities take place over a long period of time and layers of ash and lava pile up? Cinder volcano Composite volcano Cone volcano Shield volcano Write each statement as a proportion using colons. 4 is to 20 as 2 is to 10.