Answer:false
Explanation:
Which region of skin hosts the largest bacterial population?
which structures are not found in prokaryotic cells
The answer is cilia. It actually means "motile" or moving.
What are the constituents of the vascular and lymphatic systems? consider structural similarities and differences between blood and lymph vessels, differences in the cell and molecular content of the blood and lymph, differences in the mechanism of fluid propulsion within blood and lymph vessels?
WILL GIVE MEDELS AND RATE!!!
Translation is a process by which the sequence:
a) a bases of mRNA is converted into a sequence of amineo acids of a protien
b) a basis of tRNA is converted into cytoplasm before attaching itself to a polypeptide
c) of basis of tRNA is converted into a sqeunce of amino acids of a protien
d) of basis of an mRNA is converted into cytoplasm before attaching itself to polypeptide.
If you've taken this quick check then plz post the other questions. I would like the help! I think its c,
Which head glands secrete sucrase, lipase, amylase, and invertase?
Centers for disease control and prevention have determined that ___________ is the single largest factor affecting longevity of life.
The leading preventable cause of cancer is _____.
A.tobacco B.UV exposure C.HPV D.bacterial infection
Answer:
The answer is A: Tobbaco
Explanation:
Health officials estimate that almost 40 percent of cancers can be prevented by a healthy diet, physical activity, and avoidance of tobacco. In fact, tobacco use is the single most preventable cause of cancer in the world.
Heat exhaustion is a deadly heat stress illness that occurs when the body's heat production significantly exceeds its cooling capacities and core body temperature rises to dangerous levels. heat exhaustion is a deadly heat stress illness that occurs when the body's heat production significantly exceeds its cooling capacities and core body temperature rises to dangerous levels.
a. True
b. False
From which type of organism did the ancestor of land plants likely evolve
How does producing plastics benefit the economy?
Plastic has economic benefits and can save resources. It increases food shelf life and reduces fuel usage by being lightweight.
Why is plastic industry important?The use of plastic has been shown to have a number of direct financial benefits as well as the potential to improve resource efficiency. It lengthens the time that food can be stored without going bad, which cuts down on food waste, and its relatively low weight cuts down on the amount of fuel needed to transport items.
The invention of computers, mobile phones, and the majority of the life-saving advancements in modern medicine would not have been conceivable without plastics. Plastics, thanks to their low weight and superior insulating properties, contribute to the reduction of fossil fuel consumption in heating and transportation.
The usage of plastics not only enables us to lead more fulfilling lives but also makes a positive contribution to the preservation of the environment. Plastics are actually beneficial to the protection of the environment since they help cut down on trash, which in turn helps save energy in our houses, cuts down on the weight of vehicles, which results in fewer greenhouse gas emissions from the burning of gasoline, and so much more.
Learn more about plastics, here:
https://brainly.com/question/11452652
#SPJ2
Why is it said that natural selection acts on pheno- types rather than on the genetic material of organisms?
What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatctcatccagcattctgaaagggtaatgaataattattccgctgagttcatgaggtatccgaaggaggagcaacacttaggctataagagtatcatgcacatagatcgggataaatcgcctatcatatgtgacaacaatttcatgattaaaagt code for?
Describe the process by which coral polyps and algae create a coral reef.
What evolutionary development allowed plants to grow tall? see concept 29.3 (page 626)?
Final answer:
The development of a vascular system with xylem and phloem enabled plants to grow tall, while the adaptations of seed and pollen facilitated reproduction independent of water and promoted wide dispersion, respectively.
Explanation:
The evolutionary development that allowed plants to grow tall was the development of a vascular system. This system includes xylem and phloem, which are tubes that transport water, minerals, and nutrients throughout the plant. The xylem is responsible for the upward transportation of water and minerals from the roots, while the phloem distributes sugars and other organic nutrients from the leaves to the rest of the plant.
Seed and pollen adaptations were crucial for the development and expansion of seed plants. Seeds allow plants to reproduce without being dependent on water, thus enabling them to survive in a variety of environments, including arid zones. Pollen, with its hardy structure, could be dispersed by wind or animals, reaching far distances and promoting gene flow between plant populations.
These developments provided plants with structural support to grow tall and compete for sunlight, while also being able to spread across vast territories.
How the planes could be used to help a patient describe a patient concern?
The three planes namely, sagittal (median) plane, coronal plane and transverse plane. Through these planes, the position and orientation of the body parts can be described. Median plane cuts body into left and right symmetrical halves, coronal plane cuts into front and rear halves and transverse plane cuts into upper and lower portions.
A neuron that carries impulses away from the central nervous system is a:
"cold and dry" temperature and precipitation patterns are characteristic of
"cold and dry" temperature and precipitation patterns are characteristic of polar climates.
What are polar climates?
The polar climate regions are characterized by a lack of warm summers but with varying winters. Every month in a polar climate has an average temperature of less than 10 °C. Regions with polar climate cover more than 20% of the Earth's area.
Moreover, a polar climate is a place where the climate usually has a temperature below freezing, icy, and covered in snow. These areas do not get direct heat and sunlight from the sun. Polar climates are located at the North Pole of the Arctic, and at the South Pole on the continent of Antarctica.
Therefore, the polar regions surround Earth's North and South Poles. The area around the North Pole is called the Arctic. The area around the South Pole is called Antarctica.
Learn more about polar climates:
https://brainly.com/question/26116310
#SPJ6
Which state would best be suited to harness wind energy?
The correct answer is North Dakota.
The best state which is suited to harness wind energy is North Dakota.
Harvesting of wind energy has some advantages. For example,
1 .Wind energy is one of the leanest and most effective forms of harnessing a renewable form of energy.
2. Wind energy is cleaner, more renewable and cheaper than many of the current sources of energy.
We use harnessing wind energy because,
1. It produces no pollution.
2. It produces more jobs per watt.
3.It is renewable and lasts for long
Do you think that humans and humpback whales share a common evolutionary lineage?
Yes, humans and humpback whales share a common evolutionary lineage. Both humans and humpback whales are mammals, which means they have many biological similarities.
Additionally, research has shown that all mammals share a common ancestor that lived approximately 200 million years ago, so humans and humpback whales would have diverged from this common ancestor and evolved along separate paths.
Genetic studies have also provided evidence for the relatedness of humans and other mammals, including whales.
The last common ancestor of humans and whales lived over 95 million years ago and was a small, insect-eating mammal that lived on land.
Learn more about mammals at:
https://brainly.com/question/15326492
#SPJ2
Does meiosis and mitosis (or both) end with unreplicated chromosomes? Which begins with replicated chromosomes?
Yes, both meiosis and mitosis end with unreplicated chromosomes.
Both meiosis and mitosis end with unreplicated chromosomes because mitosis has diploid chromosomes and meiosis has haploid chromosomes. We know that in mitosis, two daughter cells are produced that has double number of chromosomes each.
While on the other hand, in meiosis, four daughter cells are produced, each has half number of chromosomes. Mitosis is a type of cell division that start with replication of DNA in which exact copy of DNA formed which is distributed equally among the two daughter cells so we can conclude that both mitosis and meiosis end with unreplicated chromosomes.
Learn more: https://brainly.com/question/9074834
odd one between carrot,beetroot,potato,radish
The protoplasm and cytoplasm of a plant are interchangeable terms.
a. True
b. False
SOS:
The answer is FALSE!!!
The cytoplasm is protoplasm that surrounds the nucleus. All the organic substances of the cell are referred to as the protoplasm. The cytoplasm and the nucleus make up the protoplasm.
Hope this helps!!
Anywhere the skin is touched in that area stimulates that ____________ neuron.
What advantage might chromosome banding patterns have in the analysis and diagnosis of chromosomal problems or abnormalities?
Eukaryotic cells have developed more specialized functions than prokaryotic cells. What is this referring to?
Prokaryotic cells do not have a means for movement like eukaryotic cells do.
Prokaryotic cells exist in multicellular organisms and differentiate, but eukaryotic cells do not.
Eukaryotic cells are larger and have smaller surface area to volume ratios than prokaryotic cells.
Eukaryotic cells have membrane-bound organelles with specific functions, but prokaryotic cells do not.
Eukaryotic cells have membrane-bound organelles with specific functions, but prokaryotic cells do not.
Eukaryotic cells have membrane-bound organelles with specific functions, but prokaryotic cells do not, this makes eukaryotic cells more specialized, hence option D is correct.
Why are eukaryotic cells considered more specialized?Eukaryotic cells also contain additional membrane-bound components known as organelles in addition to a nucleus. Eukaryotic cells can be more specialized than prokaryotic ones because to organelles.
Eukaryotes frequently have several cells, but prokaryotes are invariably unicellular. Eukaryotic cells are also between 100 to 10,000 times bigger and more complicated than prokaryotic cells. Prokaryotic DNA is kept in the cytoplasm, whereas DNA in eukaryotes is kept in the nucleus.
Therefore, they are able to perform complicated metabolic reactions that prokaryotic cells are unable to due to their ability to maintain many habitats within a single cell.
Learn more about eukaryotes, here:
https://brainly.com/question/14823352
#SPJ2
Which of the following is malleable?Question 6 options:
pottery
gold
glass
ice
the graph shows the percentage of dog breeds affected by elbow dysplasia, which causes dogs to limp. What???s the most likely explanation for the mixed breed???s disease incidence?
Answer:
The most likely explanation is that the mixed race has a low diversity in genes.
Explanation:
Elbow dysplasia is a condition that causes a bad development in the elbows of dogs, causing a bad formation of cartilage in that region of the paw, or a bad structure of the surrounding bones.
This condition is common in mixed breeds, because these breeds have little diversity of genes, allowing this disease to be passed to the offspring during crossbreeding between dogs that already have the disease.
What is a strategic mineral?
Question 3 options:
A)one that is exported from the United States
B)a nonmetallic resource
C)one that must be imported to the United States
D)one that is easily removed from the ground
A strategic mineral is a nonmetallic resource which are the commodities which are essential for the national defense during the situation of war. Thus, the correct option is B.
What is Strategic minerals?Strategic minerals are the commodities which are essential to the national defense for which the supply during war is wholly, or partially dependent upon the sources outside the boundaries of the United States. These resources would be difficult to obtain as strict measures are used for controlling the conservation and distribution of resources.
Strategic minerals are imported from those countries where these are abundant and when the domestic production is unable to meet up with the demands of the country such as the during the situation of war. Nonmetallic Minerals like Petroleum, Aluminium, Copper, Uranium, etc are the examples of Strategic Minerals.
Therefore, the correct option is B.
Learn more about Strategic minerals here:
https://brainly.com/question/1263149
#SPJ2
The major problem with hydrogen as an alternative source of energy is that none exists on the surface of the earth.
a. True
b. False
In sickle-cell disease, variation in one gene causes red blood cells to bend, or sickle. This means the sickled cells _____.
carry toxic levels of oxygen through the body
attract larger numbers of the malaria parasite
are better at destroying the malaria parasite
cannot carry normal levels of oxygen to cells
In sickle-cell disease, variation in one gene causes red blood cells to bend, or sickle. This means the sickled cells cannot carry normal levels of oxygen to cells. Thus, the correct option is D.
What is sickle-cell disease?Sickle-cell disease may be defined as a cluster of inherited red blood cell disorders.
Due to this disease, the shape of the red blood cells has an abnormal crescent, blocks small blood vessels, and does not last as long as normal red blood cells.
Due to the alterations in the shape of red blood cells, the affinity of oxygen binding decreases, and hence they cannot carry normal levels of oxygen to cells.
Therefore, the correct option for this question is D.
To learn more about the sickle-cell disease, refer to the link:
https://brainly.com/question/17063471
#SPJ5