Which definition best describes a dependent clause? A. a group of words that contain a subject and a verb and express a complete thought B. a group of words that form a complete sentence C. a group of words that contain a subject and a verb and do not express a complete thought D. a group of words that are not connected with an independent clause

Answers

Answer 1

Answer:

C a group of words that contain a subject and a verb and do not express a complete thought

Answer 2

Answer:

C. Is the answer

Explanation:


Related Questions

I need help with this

Answers

Answer:

You're telling a story of how you think the person would feel in the picture when a shark is about to attack them. Put yourself in their shoes and think of how you would feel when you see a shark about to attack you.

what did Cortes do to end the practice of human sacrifice?

Answers

Hernán Cortés and his allies disrupted the Aztec practice of human sacrifice, effectively ending it through conquest and forced conversion to Christianity.

Hernán Cortés, along with his Tlazcalan allies, played a role in ending the practice of human sacrifice by the Aztecs. Amidst the conquest of Tenochtitlán in 1521, Cortés encountered and ultimately disrupted the Aztec tradition of sacrifices to gods like Huitzilopochtli. Cortés, shocked at the custom, suggested the Aztecs cease their sacrifices, and during his time there, he did not observe any further sacrificial ceremonies. The practice of human sacrifice was deeply rooted in Aztec culture, serving as a means of appeasing their gods and maintaining cosmic order. However, through the conquest and conversion efforts to Christianity, along with the imposition of Spanish rule, the practice was forcefully brought to an end.

What is the noun in. The little girl goes to class

Answers

Answer: girl and class.

Explanation:

Answer: Girl - Class

Explanation: I'm not sure on what you are asking, there are two as shown above.

A. Neither the meat nor the vegetables has been hot. B. Neither the meat nor the vegetables was hot. C. Neither the meat nor the vegetables are hot. D. Neither the meat nor the vegetables is hot.

Answers

Answer:

C. Neither the meat nor the vegetables are hot.

Answer:

. Neither the meat nor the vegetables are hot.

Explanation:

The use of neither indicates that there is a negative sense for one, two or more ideas a linked together by (nor) and some other word.  In this case hot.

Formally, Neither is  followed by a singular verb. However if nor is included to unite different  nouns or pronouns and one of them is in the plural form, the verb normally agrees with the adjacent noun or pronoun.

For example neither of the boys are in the house.

Which description best sums up Anne's view of her mother, Edith Frank, in Anne Frank: A Diary of a Young Girl?


Anne admires her mother's patient and quiet nature.


Anne finds her mother difficult to get along with at times.


Anne considers her mother to be her closest friend.


Anne sees her mother as overly meek and submissive.

Answers

The answer would be B) she is always arguing with her mother and never really gets along.  

"Anne finds her mother difficult to get along with at times" best sums up Anne's view of her mother, Edith Frank, in Anne Frank: A Diary of a Young Girl. Thus, option 'B' is the correct option.

Why does Anne not get along with her mother?

Because she treated Anne and Margot more like friends than like her own children, she felt that she lacked respect for her mother. For instance, rather than offering comfort and direction when Anne was angry or crying, her mother often made light of her feelings. One person with whom Anne Frank always found herself at odds was her mother.

She thought her mother didn't get her and that she went out of her way to put her down. Her mother frequently criticized Anne for being ignorant and conceited. For instance, at one point, they were discussing the appropriate terminology for referring to maids and other domestic staff. Anne's mother told her that she wasn't a lady and that she spent too much time worrying about the future when Anne dissented from her.

Learn more about Anne Frank, here:

https://brainly.com/question/7889208

#SPJ3

What is the best definition of a context clue ?

A. An asterisk next to a word that leads to a footnote with the words meaning

B. A word or phrase in parentheses after a word that defines it

C. Information around a word that helps you figure out what it means

D. A dictionary definition of the word given in the glossary

Answers

Answer:

C. Information around a word that helps you figure out what it means

Explanation:

Context clues are hints that an author gives to help define a difficult or unusual word within a book. The clue may appear within the same sentence as the word to which it refers or it may follow in the next sentence.

A context clue is information around a word that helps you figure out what it means. It provides hints about the meaning of an unfamiliar word by using the surrounding context. For example, if you are reading a sentence and come across an unfamiliar word, the words around it can provide context clues to help you understand its meaning.

A context clue is information around a word that helps you figure out what it means. These clues can be found in the same sentence or paragraph as the unfamiliar word, providing hints about its meaning.

For example, if you read a sentence like, 'The cat is snoozing lazily on the couch,' the word 'couch' is unfamiliar, but the context clue 'cat is snoozing lazily on the' suggests that a 'couch' is something comfortable to sleep on.

Learn more about Context Clue:

https://brainly.com/question/11247029

#SPJ2

Which of the following English words are Latin in origin?

Select all that apply.

1. café
2.mirage
3.clique
4.villager
5.poltergeist

Answers

Final answer:

The words 'mirage' and 'poltergeist' are Latin in origin. 'Café' has Arabic roots but entered English via French, while 'clique' and 'villager' come from French and Old French respectively, not directly from Latin.

Explanation:

The question asks which of the provided English words are Latin in origin. The words mirage and poltergeist have Latin roots. Mirage comes from the Latin word mirari, meaning 'to wonder at.' Poltergeist is derived from the German poltern ('to knock') and Geist ('ghost'), which has its origins in the Latin spiritus, meaning 'spirit.' The word café originates from the French, but its roots can be traced back to the Arabic qahwah. Clique and villager do not come from Latin; clique is originally from the French, and villager is formed by adding the French suffix -ager to English 'village,' which has its roots in Old French.

This is an example of which type of sentence ?

Answers

Answer:

you had it right, its a simple sentence

Explanation:

imagine you want to send an email to a dear friend who is going through a rough time. which example will get your message across most clearly?

Answers

Answer:

Using sympathetic language helps your friend realize they have a person to talk too that will listen to their problem and help them find the best way to overcome it.

Explanation:

what does "Yet I’ll not shed her blood; Nor scar that whiter skin of hers than snow, And smooth as monumental alabaster. Yet she must die, else she’ll betray more men. Put out the light, and then put out the light: if I quench thee, thou flaming minister, I can again thy former light restore" mean from Othello - Act V, Scene ii

Answers

I think what it means that the character does not want to kill her yet he has to. Because he/she has no choice but to do so.

Quiz - present simple
1. Ann usually
shopping on Friday.
a) go
b) goes
c) jumps
2. Tom always
after school.
a) plays
b) play
c) does
3. This girl sometimes
her homework.
a) don't do b) doesn't does c) doesn't do
4. Lisa and Mike
to the same school.
a) listen
b) goes
5. Mary is a singer. She can
beautiful songs
a) sing
b) sings
c) draw
c) go​

Answers

Answer:

Answer: b, a, c, b, b

Explanation:

These are all the right answers

In 300 words or less, identify the three types of dramatic irony and give at least one example of each.

Answers

Answer:

There are many examples of dramatic irony in literature, movies, television and fairy tales. You can use it in your own stories too. Some examples include:

A woman thinks her boyfriend is acting strangely because he's about to propose, but the audience knows that he is planning to run away with another woman, intensifying emotions.

In a scary movie, the character goes into a house they think is empty, but the audience knows the killer is in the house. This increases the suspense.

Sometimes a person is in disguise and the other character talks with him as if he is someone else. Since this is known by the audience, it adds to the humor of the dialogue.

In Shakespeare's Romeo and Juliet, the audience knows Juliet is in a drugged sleep, so when Romeo thinks she is dead and kills himself (followed by Juliet doing the same) it increases the audience's shock.

In Ibsen's A Doll's House, the audience knows Nora borrowed money forging her father's signature and her husband is unaware. We also know Nora's husband thinks of her as a doll and Nora is unaware.

In Shakespeare's Hamlet, we are aware that Hamlet knows the truth about his father's murder and that Hamlet is not mad. He is simply deceiving others so that he can plan his revenge. He does not reveal his true feelings to the other characters but the audience is fully aware of them.

In Shakespeare's King Lear, we know that Lear's most loyal daughter is Cordelia and he can't see it.

In the Star Wars movies, Luke does not know Darth Vader is his father until Episode V, but the audience knows sooner.

In Shakespeare's Macbeth, the audience knows that Macbeth acts loyal to Duncan while planning his murder.

In the TV show Smallville, Clark Kent comments that in the future he does not want to put on a suit and fly around but the audience knows he will.

In the movie There's Something About Mary, the audience knows that Ted is being interrogated about a murder but Ted thinks he is being arrested for picking up a hitchhiker. His words are funny because of his misunderstanding.

In the movie Toy Story, Buzz Lightyear thinks he is a real space ranger but the other toys and the audience knows that he is just a toy.

Hank Schrader in Breaking Bad is a DEA agent looking for crystal-meth producer "Heisenberg". We know that "Heisenberg" is Schrader's brother-in-law, Walter White, while Hank has no idea.

In Beauty and the Beast, the audience knows that the Beast is a prince living under a curse from the start but Belle is unaware of the Beast's true identity.

In Frozen, the audience is aware that Elsa has powers that are hard to control. Her sister Anna does not know about these powers and thinks of Elsa as standoffish and cold. The truth is that Elsa is being distant from Anna to protect her and is scared of hurting her. The audience feels for both girls.

Explanation:

Answer:

The answers are explained below.

Explanation:

The three main types of dramatic irony are dramatic (the characters don't have information the public has), situational (what actually happens is different from the expectations), and verbal (the speaker says something different from his thoughts or that is not truth.)

The Truman Show is an example of dramatic irony since the main character doesn't know that he is being filmed.

Pride and Prejudge contains several examples of verbal irony; for example, when Darcy mentions that one of the women is not "handsome enough for him" but in the end he falls in love with her.

Harry Potter could be considered as an example of situational irony, since it is believed that he must kill Voldemort, but later, he realizes that Harry must let Voldemort kill him.

What is the function of the adverb clause in the sentence? Since you're getting up early, can you take the dog for a walk in the morning? It is a dependent clause that acts as a verb. It answers the question what and modifies the noun dog. It answers the question why and modifies the verb take. It is a dependent clause that acts as an adjective.

Answers

Answer:

It answers the question why and modifies the verb take.

Explanation:

The adverb clause in the sentence above is Since you're getting up early. Adverb clauses are types of dependent clauses, meaning they cannot stand on their own (the clause above means nothing without the rest of the sentence).

However, adverb clauses do have a particular function in a sentence. Here, it performs the function of an adverb and further modifies, or rather, describes, gives reason to the verb take.

Final answer:

The function of the adverb clause 'Since you're getting up early' in the given sentence is to explain why the action of taking the dog for a walk in the morning should be performed, hence it modifies the verb 'take'. This illustrates how adverb clauses serve to provide reasons or causes behind actions expressed in sentences.

Explanation:

The question asked was: What is the function of the adverb clause in the sentence? Since you're getting up early, can you take the dog for a walk in the morning? The correct option among the given choices is that it answers the question why and modifies the verb take. This is because the adverb clause, 'Since you're getting up early,' provides a reason for the action expressed in the main clause, which involves taking the dog for a walk. In this context, the adverb clause is functioning to explain why the action of the verb 'take' should be performed.

Adverb clauses, such as the one presented, highlight the reason or cause behind an action and are thus essential in providing additional details that modify verbs, making the sentence more informative. Adverb clauses are introduced by subordinating conjunctions and are dependent clauses that cannot stand on their own but add significant value to the sentence structure by modifying the main verb. Therefore, understanding how adverb clauses operate within a sentence helps in grasping the deeper meanings and relationships between actions and motivations described in the text.

Object Jews are words that describe limit for point out nouns true or false

Answers

Answer:

your answer will be false

Explanation:

False, adverbs are any word that modifies any other part of language: verbs, adjectives, clauses, sentences and other adverbs, except for nouns; modifiers of nouns are primarily determiners and adjectives.

How many letters are in the word supercalifragilisticexpialidocious?

Answers

34

lol.... Doesn't really have an explanation so im just tryna fill this in

Answer:

There are 34 letters in the word supercalifragilisticexpialidocious.

Explanation:

I just counted how many letters were in the word. Hope this helps! :)

What figurative language technique is used in the following sentence? The text states, “I was torturing the fire, giving it life, and snuffing it out” (walls 33)

Answers

my answer would be metaphor.

How does the underlined figurative language contribute to the meaning of the poem? It describes the reason for Frida’s pain and suffering. It indicates that the love Frida once felt has died. It shows that Frida continues to think of politics. It suggests that Frida prefers to be around nature.

Answers

Answer:

The underlined figurative language contributes to the meaning of the poem “Sonnet in Primary Colors” by Rita Dove.

It indicates that the love Frida once felt has died.

Here, the right option is Option B.

Explanation:

This sonnet was written about the famous Mexican painter Frida Kahlo. This sonnet dedicated to Kahlo salutes her and represents the same thought as that of the primary colours - red, yellow and blue which can’t be created by mixing other colours. It means that Kahlo’s style is uncommon and is cherished. It can’t be created from the scratch just like the primary colours. The sonnet throws light on certain areas of Frida’s life. She was married to Diego Rivera, also a famous painter and muralist. The ending lines of the poem, give a sneak-peek into their relationship. The love that both had affected Frida in a negative way and was maybe the reason behind her pain. The love that they had was dead and it was beautifully expressed by Rita Dove with the use of the metaphor described by a "skull.”

Answer:

B

Explanation:

How would you expect obdurate people to respond to advertisements

Answers

Answer:

I would expect obdurate people to respond negatively to advertisements, they wouldn't really be persuaded by advertisements. This is a difficult question because a stolid friend would be dependable and calm which would be nice, but they also would have little emotion which would be annoying or awkward

Explanation:

Final answer:

Obdurate people are stubborn and not easily swayed by popular opinion or pressure. They're not usually susceptible to bandwagon advertising attempts, choosing instead to base their choices on personal beliefs and needs.

Explanation:

Obdurate people, being stubborn and unwilling to change their opinions, would likely be resistant to persuasive attempts in advertisements. Obdurate individuals usually have their minds made up and are not easily influenced by others' opinions or popular movements. This quality makes them less susceptible to the bandwagon fallacy, a common strategy in advertising wherein marketers attempt to convince people that 'everyone' is buying a product, creating a sense of urgency or social pressure to join the trend. In general, we might expect an obdurate person to evaluate ads and products critically, based on their personal beliefs and needs rather than on popular opinion or high-pressure sales tactics.

Learn more about Obdurate people and advertising here:

https://brainly.com/question/28899525

#SPJ11

after the robbery, jonathan says’” or is it greater than other things that went with war?” to what is he referring? explain

Answers

Final answer:

Jonathan is questioning whether the aims of war justify its losses and broader implications. This reflects on the profound and complex costs of conflict, as seen through the varied perspectives within the text.

Explanation:

Jonathan's statement "Or is it greater than other things that went with war?" refers to the personal and societal costs of war. He's questioning whether the goal of the war, in this case possibly the liberation of the oppressed, justifies the extensive losses and changes that accompany warfare. This reflects a broader contemplation of the moral and ethical implications of war.

Throughout the provided text, war is depicted with a variety of perspectives that range from glory and honor to tragedy and disillusionment. Characters grapple with the direct and indirect effects of conflict, including shifting societal values and personal sacrifice.

The discussions reveal inner conflicts about participating in war, including its impact on loved ones and personal beliefs. For instance, George Gearson’s mother educates him to view war negatively, yet he feels compelled to join when the conflict becomes imminent. The complexities of war are further illustrated by historical references and the transformative experiences of characters who have to justify the reasons for fighting to themselves and others.

George Herbert’s poems, “The alter” and “Easter wings” are examples of what kind of formal poem

Answers

Answer:

The poem is a sample; of a genre poem, it can also be called a concrete or shape poem. This is because the poem has varied lines in each sentence that creates a visual shape and patterns of the poem. The essence of the poem becomes a representation of the poem on each page.

As the wings narrow and grow full, they reinforce the meaning of the poem through communication. For instance, every stanza narrows down, and the center of each verse defines the purpose of the poem.

Final answer:

George Herbert's poems 'The Altar' and 'Easter Wings' are examples of concrete or pattern poetry, which utilize their visual shape to enhance their thematic elements and add deeper meaning to the poems.

Explanation:

George Herbert’s poems, “The Altar” and “Easter Wings,” are exquisite examples of concrete poetry or pattern poetry. This type of formal poem takes advantage of the poem’s visual form to convey meaning, where the layout and shape of the poem on the page play a crucial role in its overall impact.

Concrete poetry is a form that emerged significantly in the Renaissance when poets like George Herbert created poems that visually resembled the subjects they were discussing. In Herbert’s case, “The Altar" is shaped like an altar, and "Easter Wings" resembles the wings of a bird in flight when printed horizontally, signifying resurrection and hope. These physical shapes help enhance the thematic elements of the poems, creating a multi-dimensional experience for the reader. The interplay between form and content in Herbert’s poems highlights the importance of visual elements in poetic form, and how the use of form can add layers of meaning to poetry.

Which of Chaucer's descriptions from "The Monk's Tale" best illustrates
Fortune as deceitful?

Answers

Answer:

Who then may trust the dice, at Fortune's throw?

Explanation:

Which answer choice is a sentence fragment?


A) I can't think of anyplace better than the beach.

B) Lemonade, a tuna sandwich, and an apple.

C) She said she'd leave the key in the flowerpot.

D) The band played my favorite song.

Answers

Answer:

B) Lemonade, a tuna sandwich, and an

apple.

Explanation:

The sentence fragments in the above-given options are - Lemonade, a tuna sandwich, and an apple. Therefore option B is the correct response.

What is a Sentence Fragment?

A sentence fragment, however, is lacking one of these components: it lacks a subject or a verb, or it is a clause that cannot stand alone to convey a complete idea. The topic was oozing abundantly is absent from the example in our introduction.

The most typical splinters and understanding how to repair them. Fragments of subordinate clauses. A subject, a verb, plus subordinate conjunction make up a subordinate clause. Infinitive Phrase Fragments. Participle Phrase Fragments. Fragments of an afterthought. Solitary Verb Pieces.

Typically, sentence fragments lack the primary verb or the subject (or both). Check to see whether a sentence includes at least one major verb and one main subject if you're unsure if it's a sentence fragment. Run-on sentences include at least two separate clauses joined in a single sentence without using the appropriate punctuation.

To read more about Sentence Fragments, refer to - https://brainly.com/question/10596402

#SPJ2

Use context clues from the text determine the meaning of the words.

CONTEXT CLUES
DEFINITION

Cater

Occupations

Range

Providing

Qualification

Top Notch

Option

please help me ASAP​

Answers

Answer:

Cater: Tend to

Explanation:

Occupations: Jobs

Range: the space in between to points

Providing: giving them

Qualification: something that makes them experienced enough

Top Notch: the best

Option: the choice to pick between two things

Final answer:

This answer provides definitions for keywords related to the context of the passage discussing traditional and technical high schools.

Explanation:

We are provided with the paragraph from where we are required to find the definitions of the words provided based on the context of the paragraph which are as under:

Cater: To provide or supply what is needed or wanted

Occupations: Jobs or professions

Range: The area or extent covered by something

Providing: Supplying or making available something that is needed

Qualification: An ability, characteristic, or experience that makes a person suitable for a particular job or activity

Top Notch: Of the highest quality or excellence

Option: A choice or alternative

What type of fallacy does the author use?
Experts have linked the increase in teen car accidents to
an increase in the use of social media while driving. Teen
drivers are using social media to take selfies while
driving. This behavior causes dangerous driving
situations that may result in deadly accidents. The only
way to stop teen accidents caused by distracted driving is
to block social media apps while a car is in motion.
bandwagon
appeal to pity
illogical reasoning
false dilemma

Answers

Answer:

The correct answer would be D. false dilemma

Explanation:

Answer:

Step 1:  Determine which options are correct

What type of fallacy does the author use?

- Option D: false dilemma

The only option that makes sense is false dilemma.  False dilemma means that there is a problem, and there is only one solution.  The problem in this article is that teens are getting into car crashes.  The author states the ONLY solution is to block social media apps on teens phones.

Look at attachment

How does Juliet’s monologue in lines 15 through 31 affect Romeo

Answers

Answer:

Juliet's monologue in lines 15-31 affects Romeo since he better understands the views of Juliet and how different her views are as compare to her family's ones. From that moment on, Romeo is willing to give up his family name in order to be with her and falls more in love with her so that he convinces her to marry him.

Select the correctly punctuated sentence. Since I had my tonsils out, I have had few sore throats. Since, I had my tonsils out; I have had few sore throats.

Answers

Answer:

The first one is correct

Explanation:

this is because a comma kind of represents a short pause, but a semi colon represents more of a period. on the other side of a semi colon you would sort of explain your sentence. For example, someone might text you, "I have a big test tomorrow; I cant go out tonight" they are explaining why they cant go out.

hope this helps!

Which of the following is not a basic need?

Answers

i need to know what possible answers are.

According to Maslow's Hierarchy of Needs, Financial Needs are not categorized as basic human needs.

According to Maslow's Hierarchy of Needs, the basic human needs are:

Physiological Needs: These are essential for survival, such as air, water, food, clothing, and shelter.Safety Needs: These include personal and family safety, financial security, and health and well-being.Belongingness and Love Needs: These involve feelings of belonging and acceptance from family and friends.

Financial needs, while important for achieving security and well-being, are not explicitly categorized as a basic human need on their own within Maslow's framework. Hence, the correct answer is Financial Needs.

Complete Question:

Which of the following in NOT a basic human need?

Physiological Needs

Safety Needs

Financial Needs

Belongingness and Love Needs

Lines 38-40 Notice the word slaughterhouses and the phrase factories of death. What tone do these words create

Answers

It creates a dark tone of death

Joe comes home from work and opens his mailbox. In his mailbox, he finds a yellow bottle of soap—soap for washing dishes.
​The dish soap is a free sample from a soap company. The company wants people to use the free soap and they hope that next time the customers will buy it. Millions of people get the soap. It is new and it has the smell of lemons in it. It has a picture of two lemons on the label.
​“Good!” Joe thinks. “A free sample of lemon juice! I am going to have a salad for dinner. This lemon juice will taste good on my salad.” Joe puts the soap on the salad and eats it. After, Joe feels sick. How can I write in past tense?

Answers

Joe came home from work and opened his mailbox. In his mailbox, he found a yellow bottle of soap—soap for washing dishes.
The dish soap was a free sample from a soAP company. The company wanted people to use the free soap and they were hoping that next time the customers would buy it. Millions of people got the soap. It was new and had the smell of lemons in it. It had a picture of two lemons on the label.
”Good!” Joe thought. ”A free sample of lemon juice! I am going to have a salad for dinner. This lemon juice will taste good on my salad.” Joe put the soap on the salad and ate it. After, Joe felt sick.
Final answer:

To write in past tense, change the present tense verbs to past tense verbs to indicate that the actions occurred in the past.

Explanation:

To write in past tense, you need to change the verb forms to indicate that the action happened in the past. In this case, the student can write "Joe came home from work" instead of "Joe comes home from work." They can also write "Joe put the soap on the salad and ate it" instead of "Joe puts the soap on the salad and eats it." By changing the present tense verbs to past tense verbs, the student can convey that the actions described in the story happened in the past.

Learn more about Writing in past tense here:

https://brainly.com/question/37352047

#SPJ12

Based on the context clues, what can be determined about the definition of the word havoc as it is used in the passage above?


A. anger and hate

B. widespread destruction

C. a tyrant ruler

D. waves in the water

Answers

Answer:

The definition of havoc (generally) is widespread destruction

Other Questions
Two parallel lines are crossed by a transversal. Horizontal and parallel lines b and c are cut by transversal a. At the intersection of lines b and a, the bottom left angle is (5 x + 5) degrees. At the intersection of lines c and a, the bottom right angle is 115 degrees. What is the value of x? x = 12 x = 14 x = 22 x = 24 In this problem, we explore the effect on the mean, median, and mode of adding the same number to each data value. Consider the data set 2, 2, 3, 6, 10. (a) Compute the mode, median, and mean. (b) Add 5 to each of the data values. Compute the mode, median, and mean. (c) Compare the results of parts (a) and (b). In general, how do you think the mode, median, and mean are affected when the same constant is added to each data value in a set? Paraphrase this text from the Ellis Island site. "Ellis Island doctors were particularly watching for signs of contagious diseases. Incurable diseases included trachoma and tuberculosis and guaranteed a return trip to where the immigrant came from." What prompted the formation of the Tertium Quids in 1808? a. Jefferson's desire to buy West Florida. b. Jefferson's opposition to the Embargo Act. c. Napoleon's attack on American shipping. d. The Federalists clamoring for war with England. to create a formula in______, you would first click in one of the cells Dr. Han is studying which brain structure is associated with aggressive behavior among rats. Which part of the brain is she likely to see activated when using neuroimaging techniques? Please i need big helpChoose the adjective clause in the following sentence: The jeans that I want to buy are very expensive.to buyare very expensivethe jeans thatthat I want to buyI want True or false tasks are required activities that need to take place in order to complete a goal Two train whistles have identical frequencies of 175 Hz. When one train is at rest in the station and the other is moving nearby, a commuter standing on the station platform hears beats with a frequency of 4.05 beats/s when the whistles operate together. What are the two possible speeds and directions the moving train can have? slower speed m/s Correct: Your answer is correct. faster speed m/s Changed: Your submitted answer was incorrect. Your current answer has not been submitted. The processivity of a DNA polymerase depends on all of the following actions, EXCEPT for __________. A. association of the DNA polymerase with a sliding clamp (like eukaryotic PCNA) B. interaction between the thumb domain of DNA polymerase and the DNA C. interaction between the minor groove of DNA and the palm domain of the DNA polymerase D. loss of the hydrogen from the 3-OH of the primer due to interaction with a divalent metal ion associated with the palm domain of the DNA polymerase the romans introduced and estabished a common system of written laws why was that important The economy of early villages and cities was based mainly on What is the solution to 4x+5y=12x6y=22 Edouard Daladier became Prime Minister of which country in 1933? A __________ is a wide-mouthed body of water close to shore. Cusic Industries had the following operating results for 2019: sales = $34,621; cost of goods sold = $24,359; depreciation expense = $6,027; interest expense = $2,725; dividends paid = $2,023. At the beginning of the year, net fixed assets were $19,970, current assets were $7,075, and current liabilities were $4,010. At the end of the year, net fixed assets were $24,529, current assets were $8,702, and current liabilities were $4,700. The tax rate was 25 percent. a. What is net income for 2019? (Do not round intermediate calculations.) b. What is the operating cash flow for 2019? (Do not round intermediate calculations.) c. What is the cash flow from assets for 2019? (A negative answer should be indicated by a minus sign. Do not round intermediate calculations.) d-1. If no new debt was issued during the year, what is the cash flow to creditors? (Do not round intermediate calculations.) d-2. If no new debt was issued during the year, what is the cash flow to stockholders? (A negative answer should be indicated by a minus sign. Do not round intermediate calculations.) Evaluate M2/P2 for M = 10, N = -5, and P = -2? A.-5 B.5 C.-25 D.25 Read the sentences. Sentence 1: I hope the dinner comes out perfectly, but even if it doesnt, Im pretty sure theyll know how hard I tried. Sentence 2: Then well have coffee cake for dessert, which I made from scratch. Sentence 3: I am making my sisters favorite: roasted chicken, brown rice, and brussels sprouts. Sentence 4: I cannot wait to cook dinner for my family tonight. What is the most logical sequence for these sentences in a story? 1, 3, 2, 4 4, 1, 3, 2 4, 3, 2, 1 3, 2, 1, 4 An RNA virus that infects plant cells is copied into a DNA molecule after it enters the plant cell. What would be the sequence of bases in the first strand of DNA made complementary to the section of viral RNA shown here? 5' CCCUUGGAACUACAAAGCCGAGAUUAA 3' Reasoning if you multiply two decimals that are less than 1,can you predict whether the product will be less thanor greater than either of the factors? Explain