Which strand of mrna has the bases guanine-adenine-cytosine. Which amino acid corresponds to these bases
A- gln
B- Asp
C- Arg
D- cys

Which Strand Of Mrna Has The Bases Guanine-adenine-cytosine. Which Amino Acid Corresponds To These Bases

Answers

Answer 1
The answer to this question is b ASP
Answer 2

Answer:

The answer is: B- Asp.

Explanation:

Aspartic acid, symbols Asp, in RNA is encoded by the GAU or GAC codons.

The answer is: B- Asp.


Related Questions

What is the difference between the revolution and rotation of the Earth and the revolution and rotation of moon

Answers

It is important to understand the difference between rotations and revolutions. When an object turns around an internal axis (like the Earth turns around its axis) it is called a rotation. When an object circles an external axis (like the Earth circles the sun) it is called a revolution.

Hope this helps!

-Payshence xoxo

Which planet most resembles Earth in terms of all of the factors: temperature, gravity, atmosphere, and water?

Answers

No planet in the solar system is equal to Earth.

Organisms belonging to the Kingdom Eubacteria, Kingdom Archaebacteria, and some organisms in the Kingdom Protista are unicellular. What is it that places them into different kingdoms?

Answers

How old they are and whether or not they are multi-celled or single-celled

What are Ceres,lda,and Gaspra

A. asteroids

B. comets

C. meteors

D. stars

Answers

Answer:

A. Asteroids

Explanation:

They are asteroids.

Here you find pictures of these amazing asteroids. From left to right you will find Ceres, Ida and Gaspra.

Describe what is happening in each stage and what each stage looks like:

Prophase

Prometaphase

Metaphase

Anaphase

Telophase

Cytokinesis


Describe the purpose of mitosis.

Answers

Prophase is the first phase is when the two sister chromatids pair up and the nucleoli disappears. Prometaphase is the second phase where the microtubules begin to separate from each other, each pair of microtubules attach to the kinetochores and some nonkinetohore microtubules interact with those from the opposite pole of the spindle. Metaphase is the third phase where the chromosomes are lined up on the invisible line of the metaphase plate. Anaphase is the fourth phase where the two daughter chromosomes begin to separate from each other to opposite poles. Telophase is the last phase where the two daughter nuclei form creating two identical nuclei.

Answer:

Mitosis is a type of cell division which produces two genetically similar daughter cells. This is involved in the cells of growth of somatic cells in an organism which has to to be produced with the same genetic material. It is also involved in the asexual mode of reproduction as it produces clones with the same genetic material such as in angiosperms.

Mitosis is divided into two phases- karyokinesis and cytokinesis where karyokinesis is divided into 4 stages which can be easily marked as:

Prophase- chromatin condensation, nuclear envelope disappears. Prometaphase- chromatin condenses to form a packaged structure called chromosomes. Metaphase- chromosomes align at the equatorial plate of the cell, chromosomes highly condensed. Anaphase- chromosomes start separating, each chromatid moves towards the opposite pole of the cell. Telophase - cytokinesis begins, nuclear envelope reappears. Cytokinesis- cell division by the appearance of cell furrow in animal cells and cell plate in plant cells.

Which of the following was determined by Charles Darwin but based on contributions from another scientist

A. Species can go extinct during catastrophes

B. Species could go extinct when their environment changed if they could not adapt to the change

C. The population can increase faster than the food supply

D. The processes that change organisms work quickly and have only been around for a short time

Answers

The answer is *B. Species could go extinct when their environment changed if they could not adapt to the change* hope that helps.

The correct answer is option B, that is, Species could go extinct when their environment changed if they could not adapt to the change.

According to Darwin and some of the other scientists who studied the concept of evolution, extinction is usually a result of a change in environmental conditions. When conditions modify, some of the species exhibit adaptations, which permit them to reproduce and survive, while others do not.

If the environment modifies gradually, then the species at certain occasions will develop the essential adaptations, with various generations. If conditions modify more briskly than a species can develop, however, and if the individuals of that species are devoid of the trait, which is required to thrive in the novel surrounding, the probable outcome will be extinction.


What is the result of sex cells having mutations during replication

Answers

The offspring could have mutations like physical or mental deformities. Another result is death.

Answer:

offpsring with mutations

Explanation:

:)

Explain the effects of radiation on the cellular process of mitosis and meiosis

Answers

Mitosis is a process whereby somatic cell divides while meiosis is a process in which germ cell divides.Both are essential processes that occur during development.  However, delay in mitosis can result into alteration in cell kinetics pattern resulting in depletions of all populations.

can you list six physical properties

and 2 chemical properties of this picture Hurryy!!

Answers

water, ice=chemical. color, smell, freezing point, boiling point, melting point, infrared spectrum=physical

Name 5 things our atmosphere does for us

Answers

1the atmosphere also protects living things on Earth from the sun's harmful ultraviolet radiation. 2tmosphere filters out these dangerous rays. 3The atmosphere also helps to sustain life of Earth. .4blocks harmful electromagnetic 5.provide oxgen
 The answers are ( 1. Without the atmosphere average temperature on Earth would be freezing below.

   2. The atmosphere protects us and the animals from dangerous radiation from the sun.
   3. The atmosphere provides oxygen for humans animals ect. to breath and CO2.
   4. The atmosphere protects us from objects coming towards the earth.) hope it helps and have a good day!
sorry it took long

Which of the following best describes our MRNA is produced?

Answers

A i think that is the correct answer hope this helps

Answer:

DNA provides a template for RNA polymerase.

Explanation:

A liver cell must create a protein to carry fats through the body. Where would the instructions be found?

A) Brain

B) Nucleus

C) Hormone

D) Enzyme

Answers

The answer is B:Nucleus

B) Nucleus its B@@@@@@@@@@@

HELP PLEASE!!!!!!


In the United States, less than 0.8% of the population has type I diabetes. Which of the following facts supports the theory that a person's risk of developing diabetes has a genetic, inherited component?
A. If one parent has type I diabetes, each child's chance of developing diabetes is between 1% and 6%.
B. If one identical twin has diabetes, the other twin has a 50-75% chance of having diabetes.
C. If both parents have type I diabetes, each child's chance of developing diabetes is between 10% and 25%.
D. all of these

Answers

The corrert answer is D

Which statement describes the blood type of a person with Alleles lAi? A. It is type ab because I and I are codominant. B. It is type an because a and I are codominant. C. It is type a and I is dominant and A is recessive. D. It is type a because a is dominant and I is recessive .

Answers

the answer is a i think

Answer:

It's D

Explanation:

It is type A because A is dominant and i is recessive.

This is the correct answer

hope it helps! ;)

Using the periodic table and your knowledge of atomic structure. Compare the number of electrons in a Carbon-12 and Carbon-14 isotope.

Answers

They both carbon 12 and carbon 14 have the same number of Electrons but the difference is carbon 14 has more neutrons.

The difference between Carbon-12 and Carbon-14 is that Carbon-12 has 6 electrons and Carbon-14 has 8 electrons.

Colliding air masses can form a weather front. Which of the following is not a type of front:
2 points
A Stationary Front
B Storm Front
C Cold Front
D Occluded Front

Answers

Storm Front is not a type of front the types of fronts are stationary ,cold, warm and occluded

The germ theory of disease states that many diseases are caused by the presence and action of specific

Answers

The germ theory of disease states that many diseases are caused by the presence and action of specific microorganisms.

Answer:

Microorganisms

Explanation:

Which headline would be an example of genetic engineering?

A.) Mrs. O'Hara Gives Birth to Fourth Redhead

B.)Farmer Brown's Pigs: Best Quality Ham for the money

C.) Gene Added to Liver Improves Clotting Time

D.) Bacteria Make Human Insulin

Answers

Bacteria Make Human Insulin because the body has its own genetic insulin.

Answer:

The correct answer is option D, Bacteria Make Human Insulin

Explanation:

Through the recombinant technology of genetic engineering, DNA of one organism can be transferred into the DNA of other organism. In a bacteria, the genes can be modified to produce human insulin. The gene for human insulin is chemically joined to the plasmid of bacterial DNA. Thus whenever the bacteria replicates its DNA, it also replicates the gene for human insulin thereby producing multiple sets of synthetic human insulin.

During which process is mRNA converted into a sequence of amino acids for protein production?

Answers

Ribosomes perform the process of protein synthesis on messengerRNA to create a sequence of amino acids that are joined together, this is called a polypeptide chain. So your answer Would be Translation.

~ Mark Brainliest if you find this helpful 
/\/\/\/\/\/\/\/\/\/\/\/\\/\//\/\/\/\/\/\/\/\//\\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\\//\\/\/\/\//\\/\/\/\//\/\//\/\/\\/\//\/\//
===========================================================

Final answer:

The process wherein mRNA is translated into a protein is known as translation, a critical phase of protein synthesis occurring in the cytoplasm where ribosomes synthesize polypeptide chains that fold into functional proteins.

Explanation:

The process in which mRNA is converted into a sequence of amino acids for protein production is known as translation. During translation, the cellular machinery interprets the nucleotide sequence of mRNA to produce a chain of amino acids, which then fold into functional proteins. Translation occurs in the cytoplasm, where the ribosomes facilitate the assembly of amino acids into polypeptides.

The mechanism of translation involves several key steps:

The activation of amino acids, preparing them for incorporation into the protein chain.tRNA molecules match specific amino acids to corresponding codons on the mRNA template.As tRNAs bring amino acids to the ribosome, the ribosome catalyzes the formation of peptide bonds between amino acids, elongating the polypeptide chain.The ribosome moves along the mRNA strand, synthesizing the protein until it reaches a stop codon, which signals the end of the translation process.Finally, the newly synthesized polypeptide chain folds into its functional three-dimensional structure.

Each codon, a triplet of nucleotides within the mRNA, specifies a particular amino acid. The genetic code underpinning this process is nearly universal across all life forms, reflecting the fundamental role of proteins in biology.

after being vaccinated, many children are treated for fever. this is not considered a danger or harm. why might this happen?

Answers

Vaccinations inject a bit of liquid inside the person that is fairly similar to the symptoms they have for a fever so their body knows what to do when an actual fever comes along. hope this helps! :)

Farmers in areas where there are no major rivers still require water for their crops. Where do these farmers most likely obtain the water needed for their crops? Question 11 options: 1) nearby oceans 2) melting ice 3) morning dew 4) underground sources

Answers

4) underground sources is the best answer.
Oceans have saline not fresh water and morning dew would not be sufficient water.
The answers 4)underground sources

Describe the mass and surface temperature of the main sequence stars.

Answers

 About 90 percent of the stars in the universe, including the sun, are main sequence stars. These stars can range from about a tenth of the mass of the sun to up to 200 times as massive.  But if the body has sufficient mass, the collapsing gas and dust burns hotter, eventually reaching temperatures sufficient to fuse hydrogen into helium. All main sequence stars (including the Sun) are powered by the fusion of hydrogen (H) into helium (He). Fusion of hydrogen requires temperatures of more than 10 million Kelvin.

Answer:

Mass of main sequence star - 10 to 200 times of mass of sun

Temperature of main sequence star - 15-18 million kelvin

Explanation:

Majority of stars in the universe are main sequence stars. These stars consists of helium in their cores. Mass of main sequence stars can be as low as one tenth of mass of sun and can be as high as 150 to 200 times the mass of sun. The age of a star depends on its mass. Thus more massive a star is more is its life. The temperature of star is high enough to fuse the hydrogen with in them to form helium atom. Their temperature can be as high as 15-18 million kelvin.

Which statements accurately describe matter? Check all that apply. Only living things are made up of matter. Matter is made up of tiny particles called atoms. Atoms were discovered in the twenty-first century. Atoms cannot be divided. A single atom can be seen only with a standard microscope.

Answers

The right options are;

Matter is made up of tiny particles called atoms, and atoms cannot be divided.

A matter is any object that has mass and occupies space (volume). All matter are made up of tiny particles known as atoms. Atoms are composed of interacting subatomic particles which are; electrons, protons, and neutrons. Matter exists in various states such as solid, liquid, and gas.

Answer:

Matter is made up of tiny particles called atoms.

Atoms cannot be divided.

Matter is defined as anything that has mass and occupies space which could be a plant or animal.

Matter is however made up of smaller/tiny particles called Atom. Matter was discovered in the seventeenth century and not in the twenty first century.

Atom however cannot be divided into smaller parts and is regarded as the smallest unit of matter although it contains some sub-atomic particles such as proton and neutron.

It can however be viewed only with an electron microscope as it is too small to be viewed by a  light or standard microscope.

Read more on https://brainly.com/question/9110669

At what level does the relationship between a blue whale and ferret separate?

Answers

Probably once they get to the water lol

Blue whales and ferrets separate at the superorder level in biology.

Blue whales and ferrets separate at the superorder level, which happened between 85 and 105 million years ago. The exact relationships among the superorders are still not entirely clear, but they have distinct evolutionary paths.

can you help me,,,,,,please

Answers

Answer: I am going to say the third choice is your best bet.

Explanation:

Assuming the hawk is to be considered top of its food chain, all options besides the third are false.

Some traits, such as earlobe attachment, blood type, and the presence or absence of dimples, have limited variation throughout the human population because they are controlled by a single gene. Other traits, such as skin color and human height, are widely variable throughout the human population because

Answers

They are controlled by more than one gene

Answer:

The correct answer would be "they are polygenic traits".

Polygenic traits are those which are controlled by at least two different genes.

As more than two genes are involved in controlling a single trait, so they show more variations as compared to the traits which are controlled by a single gene.

For example, height is controlled by at least three genes and thus six alleles are involved in regulating height.  

Polygenic traits often show a bell-shaped curve in a population.

Explain why crops in the Arctic grow larger than normal during the summer months.

Answers

The reason to maybe explain why crops in the Arctic grow larger than normal during the summer months is because of warmth. The sun may be making it warmer down there at that time.

Answer: Sunlight.

Explanation:

Crops in the Arctic region grows more in summer season because there is  more absorption of sunlight by the leaves and other parts of the body.

More sunlight favors the growth of crops and due to this reason the crops in the summer season grows better than in winters.

Plants requires adequate amount of sunlight for their growth and development and during winters plants do not receive more sunlight.

6. Which of these BEST describes our current understanding about how species evolve over time?

A) As organisms use certain traits more frequently, each organism evolves over time.

B) Populations of organisms evolve rapidly due to genetic changes brought about by random mating patterns.

C) Traits that result in a greater number of mutations occur more frequently, causing the population to evolve.

D) Populations evolve as natural selection results in a change in the frequency of alleles within the population over time.

7) A change in a sequence of DNA bases in a bacterial cell has resulted in a mutation. This mutation has increased the ability of the bacteria to break down and digest organic molecules in the environment. Bacteria with this mutation are better able to find and utilize food sources. According to the theory of natural selection, what is MOST likely to occur in future generations of this bacteria?

A) The relative frequency of the mutation will increase as time passes.

B) Because the mutation has changed the DNA of the bacteria, a new species will be formed.

C) Because the mutation is abnormal, the mutation will become more rare with every passing generation.

D) Bacteria with the mutation will increase in number until the food supply is exhausted, causing the bacteria to become extinct.

Answers

Hello!

6)
D. Populations evolve as natural selection results in a change in the frequency of alleles within the population over time.

Our current understanding about how species evolve is natural selection produces adaptations vital to the survival of organisms. 

7)
B. The relative frequency of the mutation will increase as time passes.

The information provided makes it clear that the mutation is an advantageous mutation; according to the theory of natural selection, since the mutation is beneficial to the bacteria, those with the mutation will survive and reproduce more, passing on the mutation. This way, the frequency of the mutation will increase.

Four groups of mice consume different amounts of sweetener in their food. The control group is the one that receives ____.

Answers

The control group is the group that receives no sweetener. Hope this helps!
they receive no sweeterner

Write a series of paragraphs that shows your knowledge of the following: the biochemical structure of DNA, how DNA replicates, how the DNA structure forms the genetic code, and how that genetic code comes to be expressed as a phenotype.

Answers

The answers are as follows:
1. THE BIOCHEMICAL STRUCTURE OF DNA
The DNA is composed of molecules called nucleotide. Each nucleotide is made up of a phosphate group, a sugar group and a nitrogenous base. The nitrogenous bases are four in number, they are adenine, cytosine, guanine and thymine. The genetic code of a DNA molecule depend on the manner in which the bases are arranged. It has been reported that the nitrogenous bases in DNA molecules of humans is approximately 3 billion in number. Double stranded DNA is made up of two spiral nucleic acid chains, which are twisted into double helix shape. The DNA is packed into tightly coiled structure called chromatin and are stored in the nucleus of cells. Chromatin usually condense to form chromosomes during cell division.

2. DNA REPLICATION
DNA replication is the biochemical process by which two identical DNA molecules are produced from a single original double stranded DNA parent molecule. This is the basic way by which the DNA molecule makes copies of itself. This process is the basis of inheritance and it occurs in all living organisms. DNA replication is a semi conservative process, this means that, each strand in the double helix DNA acts as a template for the formation of a new complementary strand. The major enzyme that catalyses this process is DNA polymerase and other enzymes that are involved include: DNA ligase, DNA primase, DNA helicase and topoisomerase. 

3. HOW DNA STRUCTURE FORM GENETIC CODE
The genetic code is the route via which the DNA molecule carry genetic information in living cells. The genetic code refers to the rules by which the genetic information that is encoded inside the DNA molecule is translated into different type of proteins by the cells of living organisms. The translation process involves the ribosomes, which links up amino acids in the specific manner specified by messenger RNA. Transfer RNA participate in the process by carrying amino acids and by reading the messenger RNA three nucleotides at a time. In genetic code, a group of three DNA bases, called codon, codes for one particular amino acid. For instance, the codon CGT codes for the amino acid alanine. 

4. HOW GENETIC CODES COME TO BE EXPRESSED AS PHENOTYPE
Phenotype refers to a set of observable features of an individual, that is formed as a result of the interaction of the genotype with the environment. Examples of phenotype are: eye color, hair color, skin colour, nose shape, etc.  The genotype refers to the set of genes in a DNA, which is responsible for a particular trait in a man.The phenotype is the physical expression of that trait. Each gene in living organisms typically code for a particular trait, for exmaple eye color. Each gene have different alleles, which code for the same trait.The allele may be dominant or recessive. The phenotype that will eventually be formed will depend on the whether the alleles are dominants or recessive.

Other Questions
What is the measure of an angle that turns through 3/4 of a complete circle What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatctcatccagcattctgaaagggtaatgaataattattccgctgagttcatgaggtatccgaaggaggagcaacacttaggctataagagtatcatgcacatagatcgggataaatcgcctatcatatgtgacaacaatttcatgattaaaagt code for? Which is a pro-election of federal judges argument?A. When judges are elected they can be biased by party politics. B. When judges are elected there they can focus more time on reviewing law.C. Judges are more accountable to the people and what they think is just when they are elected Which statement displays an effect of developing a successful atomic bomb? Question 11 options: A.encouraged private sector employees to not share their discoveries with the government B.was the final time that the government and private sector combined to form any great invention C.served as a model for future government or private research and development labs to create innovationsD.proved that military innovation is always ahead of private innovation the graph shows the percentage of dog breeds affected by elbow dysplasia, which causes dogs to limp. What???s the most likely explanation for the mixed breed???s disease incidence? The probability is 0.2 that a person shopping at a certain store will What is the differecne of the following polynomials? (6x^2 - 3x^3) - (2x^3 + 4x^2 -5) Congratulations As you know, the position for which you are applying requires superlative problem-solving skills in a variety of arenas, and the ability to think critically on the fly is essential. To evaluate your ability in this area, the practical portion of the interview process consists of a series of locked-room puzzles. You will need to use all of your ingenuity to find the key to unlocking each room. There are six rooms total; four of the rooms will have individual time limits, while the remaining two rooms will be untimed. You will be observed by the interview team from a remote location, and your progress through the rooms will be recorded. For which type of communication would this paragraph be used?A)casual noteB)informal emailC)formal business If 1495 J of heat is needed to raise the temperature of a 337 g sample of a metal from 55.0C to 66.0C, what is the specific heat capacity of the metal? Evaluate the expression when a=15 and b=5. b2 ------------ = a + 5Help Do you think that humans and humpback whales share a common evolutionary lineage? Help Im really stuck and need help fastttttttt!!!!!!!? which is an example of circadian rhythm in plants? Which of the following bodies of water is located between the countries of Malaysia and Indonesia and connects the Pacific Ocean to the east with the Indian Ocean to the west? Bodies of Water in Eastern Asia (Points : 1) The Strait of Sunda The Strait of Malacca The Makassar Strait The Java Sea, Who ran as a third party candidate in the 1968 presidential election answer.com\? The Sixth Amendment states that in criminal prosecutions, people have the right to speedy trial with a How do the functions of the skeletal system relate to muscular system functions Help with a few health questions I really can't get??20. An inflammation of the tissue under the foot (fascia) caused by overuse and improper athletic footwear. Characterized by intense "start-up" pain under the heel bone: (1point) pronation plantar fasciitis *my answerosteoporosis osteoarthritis21. Personal and specific fitness objectives and plans are referred to as: (1point) specific goals health issues fitness goals *my answerrealistic goals24. A set of actions to offset counterproductive behaviors: (1point) motivations strategies behaviors changes What type of volcano will most likely form when intermittent eruptions of different intensities take place over a long period of time and layers of ash and lava pile up? Cinder volcano Composite volcano Cone volcano Shield volcano Write each statement as a proportion using colons. 4 is to 20 as 2 is to 10.